Homologs in group_1546

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10015 FBDBKF_10015 100.0 Morganella morganii S1 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
NLDBIP_04815 NLDBIP_04815 100.0 Morganella morganii S4 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
LHKJJB_13815 LHKJJB_13815 100.0 Morganella morganii S3 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
HKOGLL_12720 HKOGLL_12720 100.0 Morganella morganii S5 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
F4V73_RS00320 F4V73_RS00320 94.6 Morganella psychrotolerans - glutamate/aspartate ABC transporter substrate-binding protein
PMI_RS02155 PMI_RS02155 82.7 Proteus mirabilis HI4320 - amino acid ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_1546

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1546

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZF60 2.66e-173 484 78 1 299 3 gltI Glutamate/aspartate import solute-binding protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37902 2.88e-168 471 82 0 270 1 gltI Glutamate/aspartate import solute-binding protein Escherichia coli (strain K12)
Q9I402 7.71e-126 363 62 1 287 1 PA1342 L-glutamate/L-aspartate-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34563 2.33e-20 91 26 5 266 2 glnH ABC transporter glutamine-binding protein GlnH Bacillus subtilis (strain 168)
P27676 3.39e-17 82 29 4 217 3 glnH Glutamine-binding protein Geobacillus stearothermophilus
A1VZQ4 1.82e-15 77 26 6 257 3 peb1A Major cell-binding factor Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9X8 2.41e-15 77 26 6 257 1 peb1A Major cell-binding factor Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P45766 9.9e-15 77 25 2 224 1 yhdW Putative amino-acid ABC transporter-binding protein YhdW Escherichia coli (strain K12)
P58068 1.52e-14 76 25 2 224 3 yhdW Putative amino-acid ABC transporter-binding protein YhdW Escherichia coli O157:H7
P02911 6.87e-13 70 26 10 277 1 argT Lysine/arginine/ornithine-binding periplasmic protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09551 1.23e-11 67 26 9 273 1 argT Lysine/arginine/ornithine-binding periplasmic protein Escherichia coli (strain K12)
Q52812 1.95e-11 67 24 5 250 1 aapJ General L-amino acid-binding periplasmic protein AapJ Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P02910 9.69e-10 61 24 6 237 1 hisJ Histidine-binding periplasmic protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEU0 1.95e-09 60 24 6 237 1 hisJ Histidine-binding periplasmic protein Escherichia coli (strain K12)
P0AEU1 1.95e-09 60 24 6 237 3 hisJ Histidine-binding periplasmic protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEU2 1.95e-09 60 24 6 237 3 hisJ Histidine-binding periplasmic protein Escherichia coli O157:H7
P39906 1.33e-08 58 23 3 220 3 aabA Amino-acid-binding protein AabA Dichelobacter nodosus
P54535 1.48e-08 58 22 6 270 1 artP Arginine-binding extracellular protein ArtP Bacillus subtilis (strain 168)
P0AEM9 4.12e-08 56 22 6 267 1 tcyJ L-cystine-binding protein TcyJ Escherichia coli (strain K12)
P0AEN0 4.12e-08 56 22 6 267 3 tcyJ L-cystine-binding protein TcyJ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q01269 5.29e-07 53 24 9 251 1 pheC Cyclohexadienyl dehydratase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52663 1.19e-06 52 23 1 166 3 bztA Glutamate/glutamine/aspartate/asparagine-binding protein BztA Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P45091 2.15e-05 48 24 9 270 1 artI ABC transporter arginine-binding protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q06758 2.4e-05 48 24 6 240 3 hisJ Probable histidine-binding protein Neisseria gonorrhoeae
P52626 2.63e-05 48 24 8 237 3 patH Putative amino-acid ABC transporter-binding protein PatH Vibrio harveyi

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_04815
Feature type CDS
Gene hisJ
Product ABC-type amino acid transport/signal transduction system, periplasmic component/domain
Location 288395 - 289291 (strand: 1)
Length 897 (nucleotides) / 298 (amino acids)

Contig

Accession ZDB_214
Length 335585 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1546
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00497 Bacterial extracellular solute-binding proteins, family 3

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0834 Amino acid transport and metabolism (E)
Signal transduction mechanisms (T)
ET ABC-type amino acid transport/signal transduction system, periplasmic component/domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10001 glutamate/aspartate transport system substrate-binding protein ABC transporters
Two-component system
-

Protein Sequence

MRKLVLSVLVTGAALASTAVSAEELTGTLKKINDSGVIVVGHRESSVPFSYYDNQQNVVGYSQDYSNHIVDAVKKTLNKPDLQVKLIPVTSQNRIPLLQNGTFDFECGSTTNNLARQQQAAFSNTIFVVGTRLLTGKDSGIKDFADLAGKNVVVTSGTTSEMLLNKLNDEKQMKMRIISAKDHGDAFRTLESGRAVAFMMDDALLAGERAKAKKPDNWVIVGTPQSEEAYGCMLRKDDPQFKALIDKTVSDAQTSGEAEKSYTRWFKQPIPPKNLNLNFELSDEMKGLFKAPNDKAFE

Flanking regions ( +/- flanking 50bp)

ACACAAGAGCAACACACGTCCTTATACCGTTCCCCGAAAAGGAGTTGTTTATGCGCAAGTTAGTTTTGTCTGTACTGGTCACCGGAGCCGCGCTTGCCAGTACGGCGGTTTCTGCTGAAGAGCTGACCGGTACACTGAAAAAAATCAATGACAGCGGCGTGATTGTTGTCGGTCACCGCGAATCTTCCGTACCCTTCTCTTATTATGATAACCAGCAAAACGTGGTCGGCTATTCCCAGGATTACTCCAACCATATTGTTGATGCAGTGAAAAAGACCCTGAATAAACCGGATTTACAGGTCAAACTGATCCCGGTGACCTCGCAGAACCGTATCCCGCTGTTACAGAACGGCACATTCGATTTTGAGTGCGGCTCCACCACCAACAACCTGGCGCGCCAGCAGCAGGCCGCTTTCTCCAATACTATTTTTGTGGTCGGTACCCGCCTGCTGACCGGTAAAGATTCCGGTATTAAAGACTTTGCCGACCTTGCCGGGAAAAACGTGGTGGTTACGTCCGGTACCACGTCTGAAATGCTGCTCAACAAACTCAATGATGAGAAGCAGATGAAGATGCGCATTATCAGCGCCAAAGATCACGGGGATGCCTTCCGCACCCTGGAATCCGGCCGTGCGGTCGCCTTTATGATGGATGATGCCCTGCTGGCCGGTGAGCGCGCCAAAGCGAAAAAACCGGATAACTGGGTGATTGTCGGCACACCGCAGTCCGAAGAAGCTTACGGCTGTATGCTGCGCAAAGATGATCCGCAGTTCAAAGCCCTGATCGATAAAACCGTTTCTGATGCACAAACCTCCGGTGAGGCTGAAAAATCCTATACCCGCTGGTTCAAACAGCCGATTCCGCCTAAGAACCTCAACCTGAACTTTGAATTATCCGATGAAATGAAAGGGCTGTTCAAAGCGCCGAATGACAAGGCTTTTGAATAACCACCACGGCGGCTGACAGCCTGACCGGCTGCGCCGTCCGGACTGAGGAT