Homologs in group_2090

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15360 FBDBKF_15360 85.2 Morganella morganii S1 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
EHELCC_10885 EHELCC_10885 85.2 Morganella morganii S2 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
NLDBIP_11230 NLDBIP_11230 85.2 Morganella morganii S4 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
LHKJJB_11090 LHKJJB_11090 85.2 Morganella morganii S3 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
HKOGLL_09700 HKOGLL_09700 85.2 Morganella morganii S5 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
F4V73_RS12095 F4V73_RS12095 84.0 Morganella psychrotolerans rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD

Distribution of the homologs in the orthogroup group_2090

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2090

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZBV7 0.0 561 83 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
P65835 0.0 553 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 0.0 553 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P33643 0.0 553 80 0 325 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
Q8X9F0 0.0 553 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
P65836 0.0 547 79 0 325 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 0.0 547 79 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
Q9CKA6 8.06e-175 490 72 0 322 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
P44445 3.16e-173 486 72 0 322 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87S65 9.5e-170 477 70 0 319 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DEV0 1.04e-169 477 72 0 318 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q9L7A7 5.55e-166 468 71 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KU20 1.36e-163 461 68 0 322 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P59838 1.02e-117 345 53 4 307 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
P33640 1.31e-116 342 55 1 319 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8P682 4.39e-114 336 53 1 309 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PHN2 5.34e-114 336 53 1 309 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
Q8K9E9 3.79e-112 330 53 2 299 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q87AR7 3.86e-110 326 50 2 318 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PET9 3.99e-110 326 51 1 312 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
P57481 1.09e-109 324 51 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AD9 8.08e-104 310 48 1 313 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q82WZ5 9.53e-95 287 51 4 305 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9JVB6 2.32e-94 287 49 5 325 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K0B0 3.24e-93 285 48 5 325 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8XYX8 2.66e-87 269 47 7 313 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P50513 2.54e-70 224 41 5 313 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q45480 1.13e-67 217 42 7 314 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
P74346 8.86e-66 213 43 7 312 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q45826 8.12e-65 210 41 5 307 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
O67638 3.17e-61 201 41 6 287 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
Q3ECD0 4.89e-54 185 34 9 355 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
O50310 6.11e-54 182 37 8 324 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P54604 5.05e-50 171 36 10 320 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
Q5Z8P2 3.22e-48 170 33 6 338 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
O31613 2.54e-47 164 41 3 241 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
P0A5T3 4.24e-41 148 34 8 315 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 4.24e-41 148 34 8 315 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 4.24e-41 148 34 8 315 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P70870 7.37e-41 148 34 6 255 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8D8G1 1.06e-34 131 30 10 327 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
P47451 1.38e-33 128 31 6 276 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75485 1.79e-33 128 33 8 293 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9KQH0 9.6e-33 126 31 8 296 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8Z7J7 1.23e-32 126 32 9 323 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q8ZQ16 1.5e-32 126 32 9 320 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87N15 1.97e-32 125 31 10 306 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8X8J3 2.52e-32 125 32 9 320 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
Q8FIP7 8.95e-32 124 31 9 320 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA40 1.27e-31 123 31 9 320 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 1.27e-31 123 31 9 320 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
Q8K9J8 1.85e-31 123 29 7 301 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8ZFU1 2.49e-31 122 30 9 325 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
O25441 2.28e-30 120 30 11 323 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9CM51 2.29e-30 120 29 8 317 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
P57430 2.39e-30 120 29 9 313 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P0AA38 6e-29 114 37 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 6e-29 114 37 6 225 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q89AH2 8.67e-29 115 27 9 307 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8FL93 9.31e-29 113 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59835 2.1e-28 115 29 8 319 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P44433 2.14e-28 115 29 8 321 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Z9J5 2.65e-28 112 36 5 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
Q9ZL98 2.81e-28 114 29 10 318 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
Q8ZRV9 1.68e-27 110 35 5 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XA10 3.52e-27 109 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
Q9HZM9 4.33e-26 108 32 13 304 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DCG0 5.4e-25 104 35 7 212 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q5M721 2.79e-24 104 30 9 252 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
Q0DST9 1.94e-23 102 28 12 323 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q9KP71 2.18e-22 97 32 4 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87LD3 2.64e-22 97 34 7 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4UKQ3 3.9e-22 97 25 10 319 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P44782 3.29e-21 93 31 8 237 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q47417 3.35e-21 96 28 7 244 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
Q9ZKP5 3.66e-21 93 29 5 206 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
Q8ZIK1 4.63e-21 92 33 8 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
Q8ZH72 1.5e-20 92 31 6 224 3 truC tRNA pseudouridine synthase C Yersinia pestis
Q9CK02 2e-20 91 32 7 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
O16686 2.42e-20 94 28 6 261 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
Q68XB2 2.81e-20 92 25 9 303 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O25610 5.22e-20 90 31 3 175 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
Q92IS6 6.49e-20 91 25 8 309 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P59831 7e-20 89 32 8 229 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8FEF9 1.24e-19 89 29 6 239 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9ZDR7 2.41e-19 90 25 9 303 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
P0AA42 3.66e-19 88 29 6 239 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 3.66e-19 88 29 6 239 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
Q8X6T6 4.17e-19 88 29 6 239 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
P72970 1.26e-18 87 27 10 289 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9ZMA1 4.74e-18 86 25 7 247 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
Q1RJX7 1.18e-17 85 24 9 309 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q09709 1.69e-17 85 28 7 252 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12069 2.85e-17 85 30 4 178 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12362 3.7e-17 85 33 4 177 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8IZ73 6.53e-17 84 30 2 172 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
Q8VCZ8 1.08e-16 82 31 6 186 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
Q149F1 1.6e-16 83 30 2 172 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
O66114 2.12e-16 80 29 7 181 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8ZMD5 7.25e-16 79 29 6 222 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z439 7.54e-16 79 28 6 239 3 truC tRNA pseudouridine synthase C Salmonella typhi
Q9UJJ7 1.01e-15 79 31 7 193 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
Q87MD4 1.07e-15 78 26 9 257 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P43930 1.3e-15 78 26 6 220 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75230 1.64e-15 79 25 9 300 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O25114 2.55e-15 78 25 8 249 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
P53294 2.83e-15 79 29 5 194 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P59840 7.82e-15 76 27 6 222 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P45614 8.74e-15 77 26 9 252 3 MCAP_0714 Uncharacterized RNA pseudouridine synthase MCAP_0714 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P47610 1.14e-14 77 23 8 295 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9KTL4 1.47e-14 75 27 8 233 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q17QT4 1.74e-14 76 30 9 217 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
Q8DBG5 3.15e-14 74 28 9 230 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q08C69 6.66e-14 74 28 6 190 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
Q28C59 1.25e-13 73 29 9 263 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
Q9LT72 2.35e-13 73 31 9 197 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
Q9CNF3 5.84e-13 70 25 6 256 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q7XA65 1.21e-12 70 26 8 265 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
Q0E0Y3 1.28e-12 71 25 8 258 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
Q6DBR0 2.55e-12 70 28 8 199 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Danio rerio
P44197 5.37e-12 68 25 9 242 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5E9Z1 7.95e-12 68 31 7 196 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
Q2QNM3 5.48e-10 63 23 7 284 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
Q9LU60 7.03e-10 63 25 3 178 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
Q96CM3 7.57e-10 63 27 6 195 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
Q4QQT0 1.66e-09 62 29 8 194 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
Q9CWX4 2.08e-09 61 28 7 194 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
Q0J4D4 1.33e-08 59 28 8 197 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q5XET6 1.91e-07 55 28 9 194 2 At1g78910 RNA pseudouridine synthase 3, mitochondrial Arabidopsis thaliana
Q69K07 2.93e-06 52 26 8 171 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
Q06244 4.28e-06 50 25 12 220 1 PUS5 21S rRNA pseudouridine(2819) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8I3Z1 4.94e-05 48 23 3 118 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)
Q8I3Z1 7.08e-05 48 54 0 35 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)
Q6FS81 0.000781 43 25 13 251 3 PUS5 21S rRNA pseudouridine(2819) synthase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01910
Feature type CDS
Gene rluD
Product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
Location 447955 - 448932 (strand: 1)
Length 978 (nucleotides) / 325 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2090
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase
PF01479 S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06180 23S rRNA pseudouridine1911/1915/1917 synthase [EC:5.4.99.23] - -

Protein Sequence

MSQQIRLNATVADSQLGQRLDQALAELFPDYSRSRIKEWILDNRVQVNDKIINKPKEKMLGGEKIEVDALIEEDVRWEPQNIPLNIVYEDDDILVINKPRDLVVHPGAGNPDGTVLNALLYRYPEIVNVPRAGIVHRLDKDTTGLMVVAKTVPAQTHLVEALQRREITREYEAVATGRMTAGGLVNEPISRHPTKRTHMAVHPMGKPAVTHYRVMEHFRAHTRLRLRLETGRTHQIRVHMAHIHHPLIGDQLYGGRPRPLKGASEEFRETLRRFDRQALHATMLRLYHPITGIEMEWHAPLPDDMVELIRVLKVDAEQFKDEMDW

Flanking regions ( +/- flanking 50bp)

AAATGAAACGGCTGTGCCGTCAAAATACTAACTTAATATAGAAACTATTTATGTCTCAACAAATACGACTTAATGCTACAGTCGCAGATTCACAGCTGGGTCAACGCTTAGATCAGGCTTTGGCCGAATTGTTCCCTGATTATTCAAGATCACGCATAAAAGAGTGGATCTTAGACAATAGAGTGCAGGTTAACGATAAAATCATCAATAAGCCAAAAGAAAAAATGCTTGGCGGTGAAAAAATTGAAGTCGATGCCTTAATCGAAGAGGATGTTCGTTGGGAGCCTCAGAATATTCCGTTAAATATCGTCTATGAAGATGATGATATTTTGGTGATTAATAAACCAAGAGATCTTGTTGTTCATCCCGGTGCAGGTAATCCTGATGGCACCGTATTAAATGCACTTCTTTATCGTTATCCAGAGATTGTTAATGTTCCCCGCGCTGGTATTGTTCATCGTTTAGATAAAGATACAACAGGTTTGATGGTTGTTGCAAAAACAGTTCCTGCTCAAACTCACTTGGTAGAAGCATTACAGCGTCGCGAAATCACCCGTGAATATGAAGCGGTTGCAACAGGAAGGATGACAGCAGGAGGGCTGGTTAATGAGCCAATTTCTCGACATCCCACCAAACGTACCCATATGGCAGTGCACCCAATGGGAAAACCTGCGGTGACGCATTATCGTGTTATGGAACATTTCCGTGCCCATACCCGCTTACGTTTGCGTCTAGAAACCGGTCGAACTCACCAAATTCGTGTCCATATGGCTCATATCCATCATCCATTAATTGGTGATCAACTGTATGGTGGTAGACCGCGTCCTTTGAAAGGGGCTAGTGAAGAATTTCGTGAGACGTTACGTCGCTTTGACCGACAAGCACTACATGCCACAATGTTACGCCTTTATCATCCTATTACCGGAATTGAAATGGAATGGCATGCACCGTTGCCTGATGATATGGTAGAACTTATTCGCGTACTAAAAGTGGACGCAGAACAGTTTAAAGATGAAATGGACTGGTAAATGACCTCATTGATTTATCCTGATTGGCCACAGCCTGACAATATTGGCGC