Homologs in group_2090

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15360 FBDBKF_15360 94.2 Morganella morganii S1 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
EHELCC_10885 EHELCC_10885 94.2 Morganella morganii S2 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
NLDBIP_11230 NLDBIP_11230 94.2 Morganella morganii S4 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
LHKJJB_11090 LHKJJB_11090 94.2 Morganella morganii S3 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
HKOGLL_09700 HKOGLL_09700 94.2 Morganella morganii S5 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
PMI_RS01910 PMI_RS01910 84.0 Proteus mirabilis HI4320 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD

Distribution of the homologs in the orthogroup group_2090

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2090

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZBV7 0.0 555 81 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
P65836 0.0 550 80 0 325 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 0.0 550 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
Q8X9F0 0.0 550 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
P65835 0.0 548 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 0.0 548 80 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P33643 0.0 548 80 0 325 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
Q9CKA6 6.37e-173 485 72 1 325 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
Q8DEV0 1.24e-169 477 71 0 319 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q87S65 1.96e-169 476 71 0 319 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P44445 1.29e-164 464 67 0 322 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KU20 4.24e-162 457 67 0 317 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9L7A7 5.62e-158 447 68 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P33640 2.19e-116 342 54 1 318 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P59838 1.9e-114 337 52 4 307 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
Q8PHN2 3.23e-114 337 53 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
Q8P682 3.16e-113 334 52 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9PET9 8.55e-110 325 52 1 307 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
Q87AR7 9.13e-110 325 52 1 307 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P57481 8.56e-106 314 50 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AD9 1.1e-104 311 47 1 316 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8K9E9 1.38e-104 311 49 2 299 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9JVB6 6.65e-95 289 51 5 303 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K0B0 2.45e-94 287 50 5 303 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q82WZ5 1.87e-91 279 49 4 305 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8XYX8 4.4e-85 263 47 7 311 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P50513 5.41e-74 233 43 5 310 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q45480 7.18e-72 228 41 4 315 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
P74346 4.64e-68 218 44 9 322 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q45826 3.58e-65 211 40 5 316 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
O67638 2.97e-61 201 39 5 302 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
O50310 1.44e-57 191 35 6 328 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q3ECD0 1.53e-54 186 33 6 358 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
Q5Z8P2 4.92e-52 180 35 7 335 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
P54604 4.54e-50 171 36 6 303 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
O31613 1.24e-47 164 39 4 268 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
P70870 3.9e-45 159 35 6 253 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P0A5T3 1.71e-40 146 33 7 318 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 1.71e-40 146 33 7 318 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 1.71e-40 146 33 7 318 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P75485 1.57e-35 134 31 8 293 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q87N15 2.73e-35 133 31 9 313 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P47451 1.31e-34 131 30 5 276 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8D8G1 3.53e-34 130 31 9 317 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q9CM51 1.31e-33 129 30 9 324 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q9KQH0 1.46e-33 128 31 9 309 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8ZFU1 4.17e-33 127 31 11 327 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
Q8Z7J7 1.09e-32 126 33 10 323 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q8X8J3 4.19e-32 125 33 10 320 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
Q8ZQ16 4.85e-32 124 33 10 320 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AA40 1.58e-31 123 32 10 320 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 1.58e-31 123 32 10 320 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
Q8FIP7 1.99e-31 123 32 10 320 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8K9J8 3.11e-31 122 28 8 302 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57430 3.64e-31 122 29 9 313 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P44433 7.23e-31 121 30 9 319 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P59835 8.37e-31 121 31 11 325 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q89AH2 2.49e-30 120 28 7 304 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9HZM9 8.37e-29 116 33 14 304 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25441 7.53e-28 113 32 6 239 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
P0AA38 6.71e-27 108 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 6.71e-27 108 36 6 225 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q9ZL98 1.01e-26 110 32 5 239 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
Q8FL93 1.07e-26 107 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z9J5 2.88e-26 107 36 7 230 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
Q8ZRV9 1.48e-25 105 36 7 230 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XA10 3.16e-25 103 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
Q8DCG0 5.46e-24 101 34 9 227 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q4UKQ3 9.11e-24 102 26 9 307 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9KP71 2.36e-23 99 34 5 216 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5M721 2.45e-23 102 31 9 252 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
Q87LD3 3.42e-23 99 34 7 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0DST9 4.49e-22 99 28 12 330 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q1RJX7 1.48e-21 95 25 9 308 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q47417 1.99e-21 97 28 7 240 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
Q92IS6 2.4e-21 95 25 9 307 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9CK02 2.66e-21 93 32 8 229 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
Q8ZH72 1.99e-20 92 29 7 230 3 truC tRNA pseudouridine synthase C Yersinia pestis
O16686 2.74e-20 94 29 4 213 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
P44782 4.17e-20 90 30 8 238 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZKP5 7.44e-20 90 25 5 235 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
Q9ZDR7 8e-20 91 24 9 301 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
Q68XB2 1.01e-19 90 24 9 301 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8ZIK1 1.08e-19 89 32 7 221 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
Q8IZ73 1.78e-19 92 32 2 172 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
P59831 5.1e-19 87 31 8 223 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q12362 9.76e-19 90 34 4 177 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O25610 1e-18 87 26 4 222 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
P47610 1.42e-18 88 25 10 297 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P72970 1.42e-18 87 27 8 285 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q12069 2.31e-18 89 30 4 178 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P75230 2.54e-18 87 28 7 228 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8FEF9 3.02e-18 86 27 5 240 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q149F1 4.63e-18 88 31 2 172 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
Q09709 6.93e-18 87 28 7 252 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0AA42 8.69e-18 84 27 5 240 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 8.69e-18 84 27 5 240 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
Q8VCZ8 8.87e-18 85 29 7 236 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
Q8X6T6 1.02e-17 84 27 5 240 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
O25114 2.76e-17 84 25 7 247 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZMA1 2.77e-17 84 25 6 247 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
O66114 3.84e-17 82 29 6 178 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P53294 8.79e-17 84 31 6 203 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UJJ7 1.66e-15 79 31 9 220 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
Q28C59 2.02e-15 79 28 9 267 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
Q8ZMD5 2.33e-15 78 27 5 222 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z439 2.55e-15 77 27 5 222 3 truC tRNA pseudouridine synthase C Salmonella typhi
Q9LT72 2.85e-15 79 32 9 197 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
Q87MD4 7.64e-15 76 26 9 265 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q08C69 8.31e-15 77 30 6 190 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
P59840 1.05e-14 75 28 7 224 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q17QT4 1.99e-14 75 31 11 244 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
Q9KTL4 4.86e-14 73 26 6 236 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DBG5 5.82e-14 73 27 8 230 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
P43930 7.01e-14 73 26 4 208 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2QNM3 2.39e-13 73 23 8 278 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
Q0E0Y3 2.75e-13 73 24 6 256 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
Q9CNF3 3.81e-13 71 25 7 259 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
P45614 9.86e-13 71 26 10 259 3 MCAP_0714 Uncharacterized RNA pseudouridine synthase MCAP_0714 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q96CM3 1.23e-12 71 26 8 246 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
Q9LU60 1.37e-12 71 23 6 246 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
Q5E9Z1 1.5e-12 71 31 8 203 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
Q7XA65 9.53e-12 68 25 7 261 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
Q4QQT0 1.24e-11 68 28 9 222 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
P44197 5.23e-11 65 24 8 250 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CWX4 1.08e-10 65 27 8 222 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
Q6DBR0 3.43e-10 63 27 8 199 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Danio rerio
Q0J4D4 2.56e-08 58 29 9 197 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q69K07 2.05e-06 52 27 8 178 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
Q06244 4.87e-06 50 25 8 188 1 PUS5 21S rRNA pseudouridine(2819) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q750S3 3.81e-05 48 30 10 187 3 PUS5 21S rRNA pseudouridine(2819) synthase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8I3Z1 0.000176 47 54 0 35 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)
Q8L960 0.000634 45 26 10 238 1 SVR1 Putative ribosomal large subunit pseudouridine synthase SVR1, chloroplastic Arabidopsis thaliana
Q6FS81 0.000767 43 27 10 213 3 PUS5 21S rRNA pseudouridine(2819) synthase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12095
Feature type CDS
Gene rluD
Product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
Location 4016 - 4993 (strand: -1)
Length 978 (nucleotides) / 325 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000003
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2090
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase
PF01479 S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06180 23S rRNA pseudouridine1911/1915/1917 synthase [EC:5.4.99.23] - -

Protein Sequence

MAQEIQLTATIDDSQLGQRLDQALAELFPDYSRSRIKEWILDNRVQVNGRLVNKPKEKMLGREQVSIDALIEEDVRFLPQDLPLTIVYEDDDILVINKPRGFVVHPGAGNPDGTVLNALLYHYPAIADVPRAGIVHRLDKDTTGLMVVAKTVPAQTRLVESLQLREITREYEAVATGRMTAGGKVEEPISRHSTKRTHMAVNPMGKPAVTHYRVMEHFRAHTRLRLRLETGRTHQIRVHMAYINHPLVGDQLYGGRPRPLKGASDEFRDEMREFDRQALHATMLRLYHPISGIQMEWHAPIPDDMVKLIAVLKADAQAHQDDMDW

Flanking regions ( +/- flanking 50bp)

ATGAAACGGTCTTGCCGTTCAAAATATAACTTTCAGATACAGAGACAAATATGGCTCAAGAAATACAACTTACCGCAACTATTGATGATTCTCAGCTCGGTCAGCGTTTAGATCAGGCTTTAGCGGAATTGTTCCCTGACTATTCACGTTCACGCATAAAAGAGTGGATTTTAGATAACAGAGTTCAGGTTAACGGGCGTCTTGTCAATAAACCGAAAGAAAAAATGCTGGGCAGAGAGCAAGTCAGTATTGATGCGCTGATCGAGGAAGATGTCCGTTTCCTGCCGCAGGACCTGCCTCTGACCATCGTTTATGAAGATGATGACATCCTGGTTATCAATAAGCCACGCGGCTTTGTCGTCCATCCGGGCGCGGGCAATCCGGACGGCACCGTCCTGAATGCACTGCTGTATCACTATCCGGCAATTGCGGATGTTCCGCGTGCGGGTATTGTTCACCGTCTGGATAAAGACACCACCGGCCTTATGGTTGTGGCAAAAACAGTTCCGGCACAGACCCGTCTGGTGGAATCACTTCAGTTACGGGAAATCACCCGTGAATATGAAGCGGTGGCAACCGGGCGCATGACCGCCGGCGGCAAAGTGGAAGAGCCTATCTCGCGTCACTCCACAAAACGTACTCACATGGCAGTAAACCCGATGGGTAAACCGGCTGTGACGCATTACCGTGTAATGGAGCACTTCCGTGCTCATACCCGTCTGCGTCTGCGTCTGGAAACCGGGCGTACCCACCAGATCCGCGTACATATGGCGTATATTAATCATCCGCTGGTGGGCGATCAGCTGTACGGCGGGCGTCCTCGTCCTCTGAAAGGCGCAAGTGATGAATTCCGTGATGAGATGCGTGAGTTTGACCGCCAGGCACTGCATGCAACAATGCTGCGCCTCTATCACCCGATTTCCGGTATTCAGATGGAGTGGCATGCGCCTATCCCTGATGATATGGTGAAGCTTATTGCCGTTCTGAAAGCTGACGCACAAGCCCATCAGGATGATATGGACTGGTAAGGAGTCACAATGACCACACTGCTCACCCCTGAATGGCCGGTACCTTCACA