Homologs in group_2090

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15360 FBDBKF_15360 100.0 Morganella morganii S1 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
EHELCC_10885 EHELCC_10885 100.0 Morganella morganii S2 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
NLDBIP_11230 NLDBIP_11230 100.0 Morganella morganii S4 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
HKOGLL_09700 HKOGLL_09700 100.0 Morganella morganii S5 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
F4V73_RS12095 F4V73_RS12095 94.2 Morganella psychrotolerans rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
PMI_RS01910 PMI_RS01910 85.2 Proteus mirabilis HI4320 rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD

Distribution of the homologs in the orthogroup group_2090

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2090

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P65836 0.0 567 82 0 325 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 0.0 567 82 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
Q8X9F0 0.0 566 82 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
P65835 0.0 565 82 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 0.0 565 82 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P33643 0.0 564 82 0 325 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
Q8ZBV7 0.0 558 82 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
Q9CKA6 3.54e-180 503 75 1 325 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
Q87S65 3.82e-173 486 71 0 319 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DEV0 2.2e-172 484 71 0 319 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
P44445 5.51e-172 483 70 0 322 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9L7A7 6.49e-167 470 71 0 325 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KU20 1.98e-163 461 67 0 317 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P33640 8.84e-116 340 54 1 315 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P59838 1.19e-115 340 53 4 307 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
Q8P682 1.98e-113 334 52 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PHN2 2.59e-112 332 52 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
Q87AR7 1.96e-109 324 52 1 307 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PET9 2.21e-109 324 52 1 307 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
Q8K9E9 1.14e-107 319 50 4 300 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57481 7.37e-107 317 50 1 308 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AD9 7.53e-106 315 47 1 316 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9JVB6 5.47e-98 296 52 5 303 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K0B0 2.22e-97 295 51 5 303 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q82WZ5 1.37e-93 284 50 4 305 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8XYX8 3.08e-88 271 48 7 317 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P50513 4.4e-74 234 43 5 310 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q45480 3.75e-72 228 41 4 315 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
P74346 1.15e-68 220 43 8 321 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q45826 1.1e-67 217 41 5 315 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
O67638 3.78e-65 211 41 6 286 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
O50310 6.66e-57 190 36 6 321 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q5Z8P2 4.33e-54 186 35 7 338 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
Q3ECD0 1.22e-53 184 33 5 344 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
P54604 5.02e-51 174 37 9 308 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
O31613 1.06e-48 167 40 3 241 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
P70870 2.92e-44 157 35 7 257 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P0A5T3 3.58e-40 145 33 8 312 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 3.58e-40 145 33 8 312 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 3.58e-40 145 33 8 312 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8D8G1 4.44e-34 130 31 10 317 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q8K9J8 5.35e-34 129 29 8 305 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57430 1.02e-33 129 30 8 313 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P47451 1.08e-33 129 30 6 276 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8ZFU1 1.65e-33 128 31 10 326 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
Q8Z7J7 5.53e-33 127 31 8 322 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q9KQH0 1.31e-32 126 31 8 302 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87N15 3.21e-32 125 30 9 309 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8X8J3 5.22e-32 124 31 8 319 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
P75485 5.51e-32 124 30 8 293 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9CM51 5.76e-32 124 30 9 318 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q8ZQ16 7.82e-32 124 31 8 319 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AA40 1.81e-31 123 31 8 319 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 1.81e-31 123 31 8 319 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
Q8FIP7 1.91e-31 123 31 8 319 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q89AH2 1.89e-30 120 27 9 311 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P44433 5.25e-30 119 29 9 319 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HZM9 5.21e-29 116 33 14 305 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P59835 5.3e-28 114 30 10 325 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O25441 8.42e-28 113 31 6 240 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZL98 4.84e-27 111 31 5 240 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
P0AA38 3.33e-26 106 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 3.33e-26 106 36 6 225 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q8Z9J5 4.64e-26 106 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
Q8FL93 5.77e-26 105 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZRV9 2.6e-25 104 36 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XA10 2.06e-24 102 35 6 225 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
Q5M721 7.88e-24 103 30 9 252 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
Q8DCG0 1.65e-23 100 34 8 215 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q87LD3 2.22e-23 99 33 7 226 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KP71 3.27e-22 96 32 4 215 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4UKQ3 1.28e-21 96 25 8 304 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q47417 1.91e-21 97 28 7 244 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
Q0DST9 2.72e-21 96 28 13 321 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q9ZKP5 5.23e-21 93 25 6 249 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
Q8ZH72 2.29e-20 92 28 6 228 3 truC tRNA pseudouridine synthase C Yersinia pestis
O16686 4.02e-20 93 26 6 278 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
O25610 1.2e-19 89 27 6 223 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
Q1RJX7 1.5e-19 90 25 11 313 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q68XB2 1.7e-19 90 24 8 301 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P72970 1.95e-19 90 28 9 280 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8ZIK1 2.35e-19 87 32 7 219 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
Q92IS6 2.39e-19 90 24 8 304 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZDR7 2.41e-19 90 24 8 301 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
P44782 3.69e-19 87 30 10 241 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CK02 1.17e-18 86 31 8 224 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
Q12362 2.26e-18 89 32 8 230 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8IZ73 2.76e-18 89 31 2 172 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
Q8VCZ8 3.81e-18 86 29 7 236 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
P59831 5.09e-18 84 31 8 229 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O25114 1.39e-17 84 28 4 186 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
Q8FEF9 1.71e-17 84 26 7 245 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9ZMA1 2.16e-17 84 28 3 184 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
Q8X6T6 4.94e-17 82 26 7 245 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
P0AA42 5.09e-17 82 26 7 245 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 5.09e-17 82 26 7 245 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
P53294 7.92e-17 84 31 5 205 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q149F1 8.82e-17 84 30 2 172 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
Q08C69 1.86e-16 81 30 7 197 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
Q9UJJ7 1.88e-16 82 31 9 220 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
P75230 5.51e-16 80 28 7 222 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O66114 6.17e-16 79 29 6 178 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q12069 7.74e-16 81 29 3 178 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8Z439 2.18e-15 78 27 7 228 3 truC tRNA pseudouridine synthase C Salmonella typhi
Q8ZMD5 2.43e-15 77 27 7 228 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P47610 3e-15 78 24 9 303 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q17QT4 3.13e-15 78 30 11 253 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
Q09709 3.64e-15 79 27 7 252 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LT72 7e-15 78 32 9 197 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
Q28C59 8.29e-15 77 29 9 262 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
P59840 1.32e-14 75 27 7 224 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P43930 1.32e-14 75 26 6 222 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87MD4 1.71e-14 75 25 7 256 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DBG5 6.94e-14 73 27 8 230 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q9CNF3 3.17e-13 71 25 7 256 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
P45614 4e-13 72 23 8 267 3 MCAP_0714 Uncharacterized RNA pseudouridine synthase MCAP_0714 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9KTL4 5.48e-13 70 26 8 237 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0E0Y3 1.6e-12 71 25 10 260 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
Q2QNM3 4.57e-12 69 24 9 282 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
Q9LU60 3.28e-11 67 22 7 267 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
P44197 4.08e-11 65 24 8 250 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6DBR0 5.91e-11 66 28 8 199 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Danio rerio
Q5E9Z1 1.37e-10 65 29 7 195 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
Q7XA65 2.12e-10 64 24 7 263 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
Q96CM3 3.5e-09 60 26 6 198 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
Q4QQT0 1.03e-08 59 28 8 201 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
Q9CWX4 1.09e-08 59 28 7 201 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
Q0J4D4 1.96e-08 58 28 8 197 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q8I3Z1 2.97e-05 49 57 0 35 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)
Q06244 5.3e-05 47 26 8 186 1 PUS5 21S rRNA pseudouridine(2819) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q69K07 6.19e-05 48 26 9 172 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
Q6FS81 0.00014 46 27 10 218 3 PUS5 21S rRNA pseudouridine(2819) synthase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q750S3 0.000254 45 29 10 189 3 PUS5 21S rRNA pseudouridine(2819) synthase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_11090
Feature type CDS
Gene rluD
Product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
Location 3949 - 4926 (strand: -1)
Length 978 (nucleotides) / 325 (amino acids)
In genomic island -

Contig

Accession ZDB_368
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2090
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase
PF01479 S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06180 23S rRNA pseudouridine1911/1915/1917 synthase [EC:5.4.99.23] - -

Protein Sequence

MAQEIQLTATINESQLGQRLDQALAELFPDYSRSRIKEWILDDRVQVNGRLVNKPKEKMLGGEQISIDALIDEDMRFEPQNLPLNIVYEDDDILVINKPRDFVVHPGAGNPDGTVLNALLYHYPDIADVPRAGIVHRLDKDTTGLMVVAKTVPAQTRLVESLQLREITREYEAVANGRMTAGGKVEEPISRHPTKRTHMAVNPMGKPAVTHYRVMEHFRAHTRLRLRLETGRTHQIRVHMAHINHPLVGDQLYGGRPRPLKGASDEFRDALREFDRQALHATMLRLYHPISGIQMEWHAPIPDDMVKLIEVLKADAQEHQDDMDW

Flanking regions ( +/- flanking 50bp)

ATGAAACGGTGTTACCGTTCAAAATATAACTTTCTGAAACAGAGACAAACATGGCTCAAGAAATACAACTTACCGCAACTATTAATGAATCACAGCTCGGTCAGCGTTTAGATCAGGCTTTGGCGGAATTGTTCCCTGATTATTCACGATCACGTATAAAAGAGTGGATCTTAGATGACAGGGTTCAGGTTAACGGCCGTCTTGTCAACAAACCAAAAGAAAAAATGCTGGGCGGGGAACAGATCAGTATTGATGCACTGATTGATGAGGACATGCGTTTTGAACCGCAAAACCTGCCGCTCAATATCGTTTATGAAGATGATGATATCCTGGTGATTAATAAACCGCGTGATTTTGTGGTGCACCCGGGAGCAGGTAATCCGGACGGTACTGTCCTGAACGCGCTGCTGTATCATTATCCTGATATTGCCGATGTGCCGCGTGCGGGTATCGTTCACCGCCTGGATAAAGATACCACCGGGCTGATGGTGGTGGCGAAAACTGTACCTGCCCAGACACGGCTGGTGGAATCACTGCAACTGCGCGAAATCACCCGTGAATATGAAGCGGTGGCTAATGGCCGTATGACAGCGGGCGGTAAAGTGGAAGAACCGATTTCCCGCCACCCGACCAAACGTACTCATATGGCCGTTAACCCGATGGGTAAACCGGCGGTGACACATTACCGTGTGATGGAGCATTTCCGTGCTCACACCCGTCTGCGTCTGCGTCTGGAAACCGGCCGTACTCACCAGATCCGTGTGCATATGGCACATATCAATCATCCGTTGGTGGGTGATCAGCTCTACGGCGGTCGTCCGCGCCCGCTGAAAGGGGCAAGTGATGAATTCCGCGATGCACTGCGTGAATTTGACCGCCAGGCTCTGCATGCCACCATGCTGCGTCTTTACCATCCGATCTCCGGGATTCAGATGGAGTGGCACGCGCCGATTCCGGATGATATGGTGAAACTGATTGAAGTTCTCAAAGCTGATGCACAAGAGCATCAGGATGATATGGACTGGTAAGGAGTCACCATGACCGCACTGATTACCCCGCAATGGCCGCTGCCCGCAGG