Homologs in group_2003

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15060 FBDBKF_15060 85.8 Morganella morganii S1 gshB glutathione synthase
EHELCC_11185 EHELCC_11185 85.8 Morganella morganii S2 gshB glutathione synthase
NLDBIP_11530 NLDBIP_11530 85.8 Morganella morganii S4 gshB glutathione synthase
LHKJJB_11390 LHKJJB_11390 85.8 Morganella morganii S3 gshB glutathione synthase
HKOGLL_10000 HKOGLL_10000 85.8 Morganella morganii S5 gshB glutathione synthase
F4V73_RS12390 F4V73_RS12390 85.4 Morganella psychrotolerans gshB glutathione synthase

Distribution of the homologs in the orthogroup group_2003

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2003

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7M7H8 0.0 573 84 0 316 3 gshB Glutathione synthetase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P58582 0.0 545 80 0 318 3 gshB Glutathione synthetase Yersinia pestis
A0A482PU20 0.0 532 80 1 316 1 gshB Glutathione synthetase Citrobacter rodentium
Q8FE30 0.0 530 80 1 317 3 gshB Glutathione synthetase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P58580 0.0 529 80 1 316 3 gshB Glutathione synthetase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7UHZ4 0.0 529 80 1 317 1 gshB Glutathione synthetase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P58581 0.0 528 80 1 316 3 gshB Glutathione synthetase Salmonella typhi
P04425 0.0 527 79 1 317 1 gshB Glutathione synthetase Escherichia coli (strain K12)
P58578 0.0 526 80 1 316 3 gshB Glutathione synthetase Escherichia coli O157:H7
Q83Q91 0.0 524 79 1 317 3 gshB Glutathione synthetase Shigella flexneri
Q7MHK1 0.0 509 75 1 317 3 gshB Glutathione synthetase Vibrio vulnificus (strain YJ016)
Q8DCA9 0.0 508 75 1 317 3 gshB Glutathione synthetase Vibrio vulnificus (strain CMCP6)
Q9KUP7 0.0 508 76 1 315 3 gshB Glutathione synthetase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87LK1 0.0 507 76 1 314 3 gshB Glutathione synthetase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8EIK8 7.12e-164 461 68 1 316 3 gshB Glutathione synthetase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87VA4 3.94e-152 432 66 1 317 3 gshB Glutathione synthetase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P57612 4.51e-150 427 61 1 313 3 gshB Glutathione synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q88D35 1.52e-149 425 65 1 316 3 gshB Glutathione synthetase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8K931 8.03e-143 408 59 1 315 3 gshB Glutathione synthetase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9I697 1.69e-141 405 62 1 316 3 gshB Glutathione synthetase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8D335 1.12e-130 377 54 2 318 3 gshB Glutathione synthetase Wigglesworthia glossinidia brevipalpis
P59495 7.18e-125 363 52 2 317 3 gshB Glutathione synthetase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8P6P1 4.76e-123 358 57 1 307 3 gshB Glutathione synthetase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PHZ5 1.12e-121 355 57 1 307 3 gshB Glutathione synthetase Xanthomonas axonopodis pv. citri (strain 306)
Q83AL0 2.2e-116 341 51 1 312 3 gshB Glutathione synthetase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q87D42 4.39e-112 330 52 1 306 3 gshB Glutathione synthetase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q82V16 4.5e-111 328 51 2 320 3 gshB Glutathione synthetase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9PC29 4.68e-111 327 52 1 306 3 gshB Glutathione synthetase Xylella fastidiosa (strain 9a5c)
Q7NQ65 6.81e-107 317 51 1 312 3 gshB Glutathione synthetase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P58579 1.01e-106 317 49 1 317 3 gshB Glutathione synthetase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7W910 4.31e-100 300 50 1 293 3 gshB Glutathione synthetase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WKF5 4.31e-100 300 50 1 293 3 gshB Glutathione synthetase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VY62 1.45e-98 296 49 1 293 3 gshB Glutathione synthetase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9JTJ6 5e-97 292 46 2 313 3 gshB Glutathione synthetase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYJ3 6.62e-95 286 48 1 297 3 gshB Glutathione synthetase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q92SN3 3.96e-81 251 41 3 313 3 gshB Glutathione synthetase Rhizobium meliloti (strain 1021)
Q98DE8 9.05e-76 238 39 3 312 3 gshB Glutathione synthetase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9ABS9 1.54e-75 237 42 4 296 3 gshB Glutathione synthetase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q89WL0 2.73e-75 236 42 2 292 3 gshB Glutathione synthetase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8UII5 3.26e-74 234 38 3 315 3 gshB Glutathione synthetase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8FXW6 3.76e-74 233 40 3 312 3 gshb Glutathione synthetase Brucella suis biovar 1 (strain 1330)
O32463 6.31e-74 233 40 4 326 3 gshB Glutathione synthetase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8YE82 1.49e-73 232 40 3 312 3 gshB Glutathione synthetase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P61396 9.37e-72 227 40 3 312 3 gshB Glutathione synthetase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7U3W8 1.22e-71 227 42 2 288 3 gshB Glutathione synthetase Parasynechococcus marenigrum (strain WH8102)
Q8DKF1 2.18e-70 224 38 2 302 3 gshB Glutathione synthetase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7TVB0 2.74e-70 223 41 2 288 3 gshB Glutathione synthetase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P73493 4.85e-68 218 38 3 304 3 gshB Glutathione synthetase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7NF44 3.4e-66 213 40 2 298 3 gshB Glutathione synthetase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7TUG9 1.07e-64 209 40 3 294 3 gshB Glutathione synthetase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7TUK9 1.23e-63 206 39 2 288 3 gshB Glutathione synthetase Prochlorococcus marinus (strain MIT 9313)
P45480 2.6e-60 198 35 3 304 3 gshB Glutathione synthetase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P35667 5.35e-49 168 32 5 297 3 gshB Glutathione synthetase Anaplasma centrale
Q58037 1.32e-08 58 27 9 211 1 mptN Tetrahydromethanopterin:alpha-L-glutamate ligase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45241 2.58e-08 57 24 10 270 3 rimK Probable alpha-L-glutamate ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B0TTR5 4.23e-08 57 26 17 320 3 rimK Probable alpha-L-glutamate ligase Shewanella halifaxensis (strain HAW-EB4)
A5UEH4 2.52e-07 55 24 10 270 3 rimK Probable alpha-L-glutamate ligase Haemophilus influenzae (strain PittGG)
C5BQP1 2.93e-07 54 26 14 294 3 rimK Probable alpha-L-glutamate ligase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q87JS5 4.98e-07 53 26 10 231 3 rimK Probable alpha-L-glutamate ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7UNW8 5.58e-07 54 27 10 229 3 rimK Probable alpha-L-glutamate ligase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A0KFE0 1.73e-06 52 24 14 307 3 rimK Probable alpha-L-glutamate ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SSJ2 2.1e-06 52 24 14 307 3 rimK Probable alpha-L-glutamate ligase Aeromonas salmonicida (strain A449)
A8H4D4 3.34e-06 52 25 17 320 3 rimK Probable alpha-L-glutamate ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q9CMJ8 1.13e-05 50 31 5 132 3 rimK Probable alpha-L-glutamate ligase Pasteurella multocida (strain Pm70)
Q8Q0M5 2.31e-05 48 23 10 290 3 mptN Tetrahydromethanopterin:alpha-L-glutamate ligase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q5E743 4.07e-05 48 25 16 309 3 rimK Probable alpha-L-glutamate ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FBB1 4.62e-05 48 25 16 309 3 rimK Probable alpha-L-glutamate ligase Aliivibrio fischeri (strain MJ11)
B7VSX1 0.000151 46 25 8 207 3 rimK Probable alpha-L-glutamate ligase Vibrio atlanticus (strain LGP32)
B6EH18 0.000157 46 25 15 302 3 rimK Probable alpha-L-glutamate ligase Aliivibrio salmonicida (strain LFI1238)
C3LQ53 0.000175 46 25 18 328 3 rimK Probable alpha-L-glutamate ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KPT1 0.000175 46 25 18 328 3 rimK Probable alpha-L-glutamate ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5Z2 0.000175 46 25 18 328 3 rimK Probable alpha-L-glutamate ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B0UT76 0.000285 45 28 6 156 3 rimK Probable alpha-L-glutamate ligase Histophilus somni (strain 2336)
Q0I2X8 0.000309 45 28 6 156 3 rimK Probable alpha-L-glutamate ligase Histophilus somni (strain 129Pt)
Q113P2 0.000424 45 25 17 310 3 rimK Probable alpha-L-glutamate ligase Trichodesmium erythraeum (strain IMS101)
Q3A258 0.000569 44 26 8 203 3 rimK Probable alpha-L-glutamate ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6VV11 0.000595 44 25 8 207 3 rimK Probable alpha-L-glutamate ligase Marinomonas sp. (strain MWYL1)
C6BYK5 0.00078 44 24 8 225 3 rimK Probable alpha-L-glutamate ligase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01625
Feature type CDS
Gene gshB
Product glutathione synthase
Location 388974 - 389930 (strand: -1)
Length 957 (nucleotides) / 318 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2003
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02951 Prokaryotic glutathione synthetase, N-terminal domain
PF02955 Prokaryotic glutathione synthetase, ATP-grasp domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0189 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)
Translation, ribosomal structure and biogenesis (J)
Secondary metabolites biosynthesis, transport and catabolism (Q)		 EHJQ Glutathione synthase, LysX or RimK-type ligase, ATP-grasp superfamily

Kegg Ortholog Annotation(s)

Protein Sequence

MIKLGIVMDPISSIKIKKDTSFAMLLEAQRRGWEIHYMEMNDLYLNQGEARAHTRLLSVEENPEKWFEFGQEQDIALGSLDTILMRKDPPFDTEFIYATYILERAEDMGTLIVNKPQSLRDCNEKLFTAWFPSLTPNTLVTREAKHLRAFHEKHGDVIFKPLDGMGGASIFRLKKDDPNVGVIIETLTEHGHRFCMAQNFLPEIVDGDKRILVVDGEPVPYCLARIPAKGETRGNLAAGGRGEARPLTESDWAIARQVAPILKQKGLIFVGLDVIGDRLTEINVTSPTCAREIEAAYPEVSITGMLMDAIEARLNKKN

Flanking regions ( +/- flanking 50bp)

AATCACCGCTTTGCAGGTTCGGTTCGGCGATCTGGGATAAAGGAGAAATAATGATTAAATTAGGTATTGTGATGGATCCTATTTCATCCATCAAAATTAAAAAAGATACCAGCTTTGCCATGTTACTCGAAGCACAGCGCCGTGGTTGGGAAATCCATTATATGGAAATGAACGATCTTTATCTTAATCAAGGCGAAGCCCGTGCACACACACGTCTGTTAAGTGTGGAAGAAAACCCTGAAAAGTGGTTTGAATTTGGTCAAGAGCAAGATATTGCGTTAGGCTCCCTTGATACCATTTTAATGCGTAAAGATCCCCCATTCGATACCGAATTTATCTATGCTACCTATATTCTTGAACGTGCTGAAGATATGGGGACTTTAATTGTTAATAAACCACAAAGCTTACGTGATTGTAATGAAAAACTGTTTACAGCATGGTTCCCTTCATTAACGCCAAATACATTAGTCACTCGAGAAGCCAAACACCTTCGCGCTTTCCATGAAAAACATGGTGATGTGATTTTTAAACCACTTGACGGTATGGGTGGCGCCTCTATTTTCCGCCTGAAAAAAGATGATCCAAACGTCGGTGTTATTATCGAAACCTTAACAGAGCACGGTCACCGTTTCTGTATGGCACAGAATTTCTTACCAGAAATTGTTGATGGTGATAAACGTATTCTGGTAGTTGATGGAGAGCCGGTTCCTTATTGCTTAGCCCGTATCCCTGCCAAAGGGGAAACCCGTGGTAACTTAGCTGCAGGTGGCCGTGGAGAAGCGCGCCCATTAACAGAAAGCGATTGGGCAATTGCACGCCAAGTAGCACCTATCTTAAAACAAAAAGGCCTTATTTTTGTTGGATTAGATGTTATTGGTGATCGTTTAACGGAAATTAATGTTACAAGCCCAACTTGTGCTCGTGAGATTGAAGCAGCTTATCCTGAGGTTTCTATTACAGGTATGTTAATGGATGCTATTGAAGCTCGCCTTAACAAGAAAAACTAATTTTTAAACGATGTGTTTTAAGGTTTAAAAGTCTTTACCTAGCCCTTATA