Homologs in group_175

Help

8 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09015 FBDBKF_09015 64.6 Morganella morganii S1 fimA Pilin (type 1 fimbrial protein)
EHELCC_10395 EHELCC_10395 64.6 Morganella morganii S2 fimA Pilin (type 1 fimbrial protein)
NLDBIP_10740 NLDBIP_10740 64.6 Morganella morganii S4 fimA Pilin (type 1 fimbrial protein)
LHKJJB_10615 LHKJJB_10615 64.6 Morganella morganii S3 fimA Pilin (type 1 fimbrial protein)
HKOGLL_13675 HKOGLL_13675 64.6 Morganella morganii S5 fimA Pilin (type 1 fimbrial protein)
F4V73_RS10955 F4V73_RS10955 64.2 Morganella psychrotolerans - fimbrial protein
PMI_RS01255 PMI_RS01255 56.1 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS09285 PMI_RS09285 31.8 Proteus mirabilis HI4320 - fimbrial protein

Distribution of the homologs in the orthogroup group_175

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_175

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P53521 3.21e-21 88 31 1 167 3 pmfF Putative minor fimbrial subunit PmfF Proteus mirabilis (strain HI4320)
Q03011 2.07e-17 78 32 3 181 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P76499 3.08e-12 65 26 4 174 2 yfcP Uncharacterized fimbrial-like protein YfcP Escherichia coli (strain K12)
P62532 6.01e-12 64 29 5 162 1 papK Fimbrial adapter PapK Escherichia coli
P62533 6.01e-12 64 29 5 162 3 papK Fimbrial adapter PapK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P13421 6.6e-12 63 28 4 181 1 smfA Fimbria A protein Serratia marcescens
P42191 1.67e-10 60 28 5 162 1 prsK Protein PrsK Escherichia coli
P39264 3.76e-09 56 27 6 160 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P75860 4.8e-09 56 26 6 183 2 ycbV Uncharacterized fimbrial-like protein YcbV Escherichia coli (strain K12)
Q04681 1.98e-08 54 23 2 152 1 pmfA Major fimbrial subunit Proteus mirabilis (strain HI4320)
P04127 2.39e-08 54 26 5 177 1 papA Pap fimbrial major pilin protein Escherichia coli
P04740 1.11e-07 52 27 7 193 3 KS71A KS71A fimbrillin Escherichia coli
P43660 1.48e-07 52 23 5 179 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37909 2.63e-07 51 22 5 186 1 ybgD Uncharacterized fimbrial-like protein YbgD Escherichia coli (strain K12)
P42184 2.86e-07 51 27 6 159 1 prsA PRS fimbrial major pilin protein (Fragment) Escherichia coli
P37926 2.1e-06 48 27 5 155 3 fimF Fimbrial-like protein FimF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P39834 3.88e-06 48 33 1 65 3 ygiL Uncharacterized fimbrial-like protein YgiL Escherichia coli (strain K12)
P21413 4.3e-06 48 25 4 158 3 fasA Fimbrial protein 987P Escherichia coli
Q8X5K5 6.09e-06 47 22 3 144 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P42185 1.07e-05 47 24 3 157 3 prsH PRS fimbrial minor pilin protein Escherichia coli
P07111 1.7e-05 46 24 3 157 1 papH PAP fimbrial minor pilin protein Escherichia coli
P12903 3.37e-05 45 26 6 152 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
P38052 4.73e-05 45 27 6 155 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
Q47223 7.1e-05 45 26 6 146 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
P37921 0.000103 44 24 8 184 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55223 0.000176 43 25 7 160 3 None Fimbrial subunit type 1 Salmonella typhimurium
P08189 0.000528 42 27 7 167 1 fimF Protein FimF Escherichia coli (strain K12)
P77288 0.000536 42 29 4 159 2 yfcV Uncharacterized fimbrial-like protein YfcV Escherichia coli (strain K12)
P37920 0.000674 42 23 8 184 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01305
Feature type CDS
Gene -
Product fimbrial protein
Location 317039 - 317587 (strand: 1)
Length 549 (nucleotides) / 182 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_175
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG042627 type 1 fimbrial protein VF1233 Adherence

Protein Sequence

MKIKTLSIRFILGLSVSIGLTSAAFAIPDNLYFHGILVDEPCTIKPGDETVVLDFGNIPDKNLYAYKRTPSKLFQLRLSECDLSIGKSVKITFKGEENQAMAGEGFLAISPGSQASGIAVGLESENGNALPINKETDKMSLTAGDTILNFYAFIQGEPDAIANKSIKRGPFSAIATFYLNYD

Flanking regions ( +/- flanking 50bp)

ATTTGAAGTCTCAGCCACCTTATTAGCAGAATACCAATAGGAGCGTTTTGATGAAAATAAAAACATTATCGATCCGGTTCATATTGGGTCTATCTGTATCCATAGGGTTAACTTCAGCGGCTTTTGCAATACCGGACAACCTCTATTTTCACGGCATATTAGTTGATGAGCCTTGTACCATAAAACCGGGTGATGAAACCGTGGTACTCGATTTTGGCAATATTCCTGATAAAAACCTTTATGCCTATAAAAGAACGCCAAGCAAGTTATTTCAATTACGTCTGTCAGAATGCGATCTCTCAATCGGTAAAAGCGTCAAAATAACCTTTAAAGGAGAGGAAAACCAAGCAATGGCAGGAGAAGGATTTTTGGCAATAAGTCCGGGCAGCCAAGCTTCTGGTATTGCGGTGGGATTAGAGTCTGAAAATGGTAATGCTCTACCTATAAATAAAGAAACAGACAAGATGTCATTAACTGCGGGTGACACTATTTTGAATTTTTATGCCTTTATTCAAGGTGAGCCGGATGCGATTGCGAATAAGTCGATTAAACGTGGTCCTTTTAGTGCAATAGCCACCTTCTATTTGAATTATGACTGATAATGAAGATTGAGGTTTTACATGTTTATATTTAAACGATTTCCGGCGAT