Homologs in group_1455

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08635 FBDBKF_08635 100.0 Morganella morganii S1 folP dihydropteroate synthase
EHELCC_12890 EHELCC_12890 100.0 Morganella morganii S2 folP dihydropteroate synthase
LHKJJB_13325 LHKJJB_13325 100.0 Morganella morganii S3 folP dihydropteroate synthase
HKOGLL_11705 HKOGLL_11705 100.0 Morganella morganii S5 folP dihydropteroate synthase
F4V73_RS09860 F4V73_RS09860 91.5 Morganella psychrotolerans folP dihydropteroate synthase
PMI_RS16990 PMI_RS16990 72.9 Proteus mirabilis HI4320 folP dihydropteroate synthase

Distribution of the homologs in the orthogroup group_1455

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1455

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AC15 3.75e-140 399 68 0 282 3 folP Dihydropteroate synthase Shigella flexneri
P0AC13 3.75e-140 399 68 0 282 1 folP Dihydropteroate synthase Escherichia coli (strain K12)
P0AC14 3.75e-140 399 68 0 282 3 folP Dihydropteroate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P43776 1.51e-114 333 57 0 272 3 folP-A Dihydropteroate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q51161 1.12e-75 235 51 7 269 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57696 5.55e-73 228 50 6 267 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup C
P73248 1.37e-72 227 47 2 257 3 folP Dihydropteroate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9JT70 2.65e-72 226 50 6 267 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P28822 5.52e-72 226 47 2 256 3 sul Dihydropteroate synthase Bacillus subtilis (strain 168)
P0DB09 1.3e-66 211 46 3 247 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB08 1.3e-66 211 46 3 247 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5XCA8 3.64e-66 210 46 3 247 1 folP Dihydropteroate synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8P152 4.93e-66 209 46 3 247 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0C0G1 5.44e-66 209 46 3 247 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M1
Q05621 1.15e-65 209 43 3 256 3 Cbei_0206 Dihydropteroate synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P0C0G0 1.83e-65 208 46 3 247 3 folP Dihydropteroate synthase Streptococcus pyogenes
P0C0X1 1.95e-63 204 41 5 274 1 folP1 Dihydropteroate synthase Mycobacterium leprae (strain TN)
Q9HS44 4.02e-56 196 48 2 257 3 folP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P9WND1 6.43e-56 184 42 4 270 1 folP1 Dihydropteroate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WND0 6.43e-56 184 42 4 270 3 folP1 Dihydropteroate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A579 6.43e-56 184 42 4 270 3 folP1 Dihydropteroate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
D4GW05 1.96e-53 189 47 2 257 3 folCP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q4LB35 2.17e-53 187 41 8 268 1 fol1 Folic acid synthesis protein fol1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1ENB6 1.07e-52 181 39 6 279 1 CytHPPK/DHPS Folate synthesis bifunctional protein Arabidopsis thaliana
P29251 1.2e-50 180 39 6 267 1 fol1 Folic acid synthesis protein fol1 Pneumocystis carinii
Q59919 6.59e-50 168 39 4 256 3 folP Dihydropteroate synthase Staphylococcus haemolyticus
O04862 6.68e-50 175 38 6 271 1 MitHPPK/DHPS Folate synthesis bifunctional protein, mitochondrial Pisum sativum
Q9SZV3 1.43e-49 174 38 5 272 2 MitHPPK/DHPS Folate synthesis bifunctional protein, mitochondrial Arabidopsis thaliana
Q8NXZ2 2.67e-44 154 39 4 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MW2)
Q5HRP0 4.44e-44 153 38 5 252 3 folP Dihydropteroate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P05382 4.51e-44 155 37 6 296 1 sulA Dihydropteroate synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P64142 7.01e-44 153 39 4 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain N315)
P64141 7.01e-44 153 39 4 252 1 folP Dihydropteroate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
P59655 8.55e-44 154 37 6 296 1 sulA Dihydropteroate synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
O05701 9.77e-44 152 38 4 252 1 folP Dihydropteroate synthase Staphylococcus aureus
Q6GJF7 9.77e-44 152 38 4 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MRSA252)
Q6GBX4 9.87e-44 152 39 4 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MSSA476)
Q5HIG1 1.9e-43 152 39 4 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain COL)
Q8CMT7 1.11e-42 150 38 5 252 3 folP Dihydropteroate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O25830 1.22e-41 150 33 5 262 1 folP Bifunctional dihydropteroate synthase/dihydropteroate reductase Helicobacter pylori (strain ATCC 700392 / 26695)
P0AC12 3.98e-35 130 34 5 261 3 sulII Dihydropteroate synthase type-2 Shigella flexneri
P0AC11 3.98e-35 130 34 5 261 1 sulII Dihydropteroate synthase type-2 Escherichia coli
P53848 1.86e-33 132 28 10 331 1 FOL1 Folic acid synthesis protein FOL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0C0X2 2.79e-30 118 34 4 259 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium leprae (strain TN)
Q821E2 1.09e-29 119 31 6 255 3 folKP Folate synthesis bifunctional protein Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q49184 1.35e-29 116 31 4 248 3 sulI Dihydropteroate synthase type-1 Mycolicibacterium fortuitum
P82602 1.45e-29 119 33 8 260 3 folKP Folate synthesis bifunctional protein Chlamydia muridarum (strain MoPn / Nigg)
P0C003 1.85e-29 115 31 4 248 3 sulI Dihydropteroate synthase type-1 Pseudomonas aeruginosa
P0C002 1.85e-29 115 31 4 248 1 sulI Dihydropteroate synthase type-1 Escherichia coli
P0C004 1.85e-29 115 31 4 248 3 sulI Dihydropteroate synthase type-1 Corynebacterium glutamicum
Q9Z7E8 2.16e-29 119 31 5 260 3 folKP Folate synthesis bifunctional protein Chlamydia pneumoniae
O84619 3.04e-25 107 31 9 261 3 folKP Folate synthesis bifunctional protein Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q54YD9 1.32e-24 106 41 3 142 3 fol1 Folic acid synthesis protein FOL1 Dictyostelium discoideum
Q54YD9 2.1e-15 79 35 2 116 3 fol1 Folic acid synthesis protein FOL1 Dictyostelium discoideum
P9WNC9 3.11e-21 94 32 4 259 1 folP2 Inactive dihydropteroate synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNC8 3.11e-21 94 32 4 259 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64140 3.11e-21 94 32 4 259 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_13230
Feature type CDS
Gene folP
Product dihydropteroate synthase
Location 53719 - 54567 (strand: -1)
Length 849 (nucleotides) / 282 (amino acids)
In genomic island -

Contig

Accession ZDB_528
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1455
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00809 Pterin binding enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0294 Coenzyme transport and metabolism (H) H Dihydropteroate synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00796 dihydropteroate synthase [EC:2.5.1.15] Folate biosynthesis
Metabolic pathways
Biosynthesis of cofactors
Tetrahydrofolate biosynthesis, GTP => THF

Protein Sequence

MKLTARGQTLSLATPQVMGILNVTPDSFSDGGTHNTPAKALEHARKMIAEGATIIDIGGESTRPGAAEVSPEQEAERVIPVVAAIARESDVWISVDTSKALVIREAANAGAHILNDIRSFSEPGALQAAAQSGLPVCVMHMQGEPRTMQQAPHYQNVVREVYTYLEAQVARCVAAGIEKNHIILDPGFGFGKTLAHNYQLLDKLDLFHNLGLPVLAGMSRKSMIGQLMDVPPDERVAGSVACAVIAAMKGAQIIRVHDVKETVQAMKVVEATRLAKETNDNE

Flanking regions ( +/- flanking 50bp)

CATTACAATCACATTACGATTGAAATAATAAACAGTAAGAAGGCCGGATTATGAAACTTACCGCACGCGGTCAGACACTTTCGCTGGCAACGCCGCAGGTCATGGGGATCCTCAATGTGACCCCGGATTCATTCTCAGACGGCGGTACACACAACACCCCCGCCAAAGCACTGGAACACGCCCGGAAAATGATTGCGGAAGGTGCGACGATCATTGATATCGGCGGTGAATCCACCCGTCCCGGAGCGGCGGAAGTCAGTCCGGAGCAGGAAGCGGAGCGGGTTATCCCGGTTGTGGCAGCGATTGCCCGTGAATCGGACGTCTGGATTTCAGTGGATACCTCAAAAGCACTGGTGATCCGCGAAGCCGCAAATGCAGGGGCTCATATTCTCAATGATATCCGCTCATTCAGTGAGCCGGGGGCATTACAGGCAGCGGCACAGAGCGGCCTGCCGGTTTGTGTGATGCATATGCAGGGGGAACCGCGTACCATGCAGCAGGCACCGCACTATCAGAATGTGGTACGCGAGGTGTATACGTATCTTGAAGCGCAGGTGGCACGTTGTGTGGCGGCCGGAATTGAAAAAAATCACATAATTCTCGATCCGGGCTTCGGTTTCGGAAAAACACTGGCGCATAATTATCAGTTATTGGATAAATTAGACCTGTTTCATAACCTGGGATTACCGGTTCTCGCCGGAATGTCACGAAAATCTATGATTGGCCAACTGATGGATGTTCCCCCGGATGAACGGGTTGCCGGCAGCGTGGCCTGTGCGGTGATTGCCGCGATGAAAGGTGCACAGATTATCCGTGTTCATGATGTGAAAGAAACTGTCCAGGCCATGAAAGTGGTGGAAGCAACCCGTTTAGCGAAGGAAACAAACGACAATGAGTGATCGCAAATACTTTGGTACTGATGGCATCCGCGGAAAAGTGGGTGACAGCC