Homologs in group_1455

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08635 FBDBKF_08635 72.9 Morganella morganii S1 folP dihydropteroate synthase
EHELCC_12890 EHELCC_12890 72.9 Morganella morganii S2 folP dihydropteroate synthase
NLDBIP_13230 NLDBIP_13230 72.9 Morganella morganii S4 folP dihydropteroate synthase
LHKJJB_13325 LHKJJB_13325 72.9 Morganella morganii S3 folP dihydropteroate synthase
HKOGLL_11705 HKOGLL_11705 72.9 Morganella morganii S5 folP dihydropteroate synthase
F4V73_RS09860 F4V73_RS09860 72.5 Morganella psychrotolerans folP dihydropteroate synthase

Distribution of the homologs in the orthogroup group_1455

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1455

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AC15 3.56e-154 434 73 0 279 3 folP Dihydropteroate synthase Shigella flexneri
P0AC13 3.56e-154 434 73 0 279 1 folP Dihydropteroate synthase Escherichia coli (strain K12)
P0AC14 3.56e-154 434 73 0 279 3 folP Dihydropteroate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P43776 3.77e-115 335 58 0 275 3 folP-A Dihydropteroate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P73248 1.45e-73 229 46 2 257 3 folP Dihydropteroate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q51161 5.32e-72 226 50 9 273 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P28822 4.96e-70 220 45 3 259 3 sul Dihydropteroate synthase Bacillus subtilis (strain 168)
P57696 8.27e-69 217 48 8 271 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup C
Q05621 8.58e-69 217 43 4 266 3 Cbei_0206 Dihydropteroate synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q9JT70 1.87e-68 216 47 6 268 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P0DB09 2.18e-66 211 42 3 256 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB08 2.18e-66 211 42 3 256 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8P152 2.77e-66 210 42 3 266 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCA8 4.82e-66 209 42 3 256 1 folP Dihydropteroate synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0C0G1 6.59e-66 209 42 3 256 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M1
P0C0G0 1.67e-64 206 43 3 247 3 folP Dihydropteroate synthase Streptococcus pyogenes
P0C0X1 6.56e-61 197 38 4 279 1 folP1 Dihydropteroate synthase Mycobacterium leprae (strain TN)
P9WND1 1.17e-56 186 39 5 270 1 folP1 Dihydropteroate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WND0 1.17e-56 186 39 5 270 3 folP1 Dihydropteroate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A579 1.17e-56 186 39 5 270 3 folP1 Dihydropteroate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9HS44 1.19e-55 194 44 2 261 3 folP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
D4GW05 2.95e-55 194 46 2 256 3 folCP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q4LB35 1.88e-54 190 42 6 252 1 fol1 Folic acid synthesis protein fol1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1ENB6 1.55e-53 184 39 7 280 1 CytHPPK/DHPS Folate synthesis bifunctional protein Arabidopsis thaliana
O04862 8.89e-53 182 39 5 278 1 MitHPPK/DHPS Folate synthesis bifunctional protein, mitochondrial Pisum sativum
Q9SZV3 1.13e-52 183 38 5 280 2 MitHPPK/DHPS Folate synthesis bifunctional protein, mitochondrial Arabidopsis thaliana
P29251 2.73e-51 182 39 6 263 1 fol1 Folic acid synthesis protein fol1 Pneumocystis carinii
Q59919 1.84e-49 167 36 6 270 3 folP Dihydropteroate synthase Staphylococcus haemolyticus
Q8NXZ2 6.38e-46 158 38 6 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MW2)
P64142 7.57e-46 158 38 6 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain N315)
P64141 7.57e-46 158 38 6 252 1 folP Dihydropteroate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GBX4 2.57e-45 156 38 6 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MSSA476)
O05701 2.8e-45 156 38 6 252 1 folP Dihydropteroate synthase Staphylococcus aureus
Q6GJF7 2.8e-45 156 38 6 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MRSA252)
P59655 3.54e-45 157 38 5 293 1 sulA Dihydropteroate synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5HIG1 6.32e-45 155 38 6 252 3 folP Dihydropteroate synthase Staphylococcus aureus (strain COL)
P05382 1.07e-44 156 38 5 293 1 sulA Dihydropteroate synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5HRP0 1.63e-43 152 36 5 252 3 folP Dihydropteroate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O25830 1.65e-42 152 34 7 263 1 folP Bifunctional dihydropteroate synthase/dihydropteroate reductase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8CMT7 3.47e-42 149 36 5 252 3 folP Dihydropteroate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0C0X2 1.46e-35 132 33 4 277 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium leprae (strain TN)
P0AC12 1.02e-33 126 32 3 258 3 sulII Dihydropteroate synthase type-2 Shigella flexneri
P0AC11 1.02e-33 126 32 3 258 1 sulII Dihydropteroate synthase type-2 Escherichia coli
P53848 6.68e-32 127 29 10 328 1 FOL1 Folic acid synthesis protein FOL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Z7E8 1.59e-30 121 31 6 263 3 folKP Folate synthesis bifunctional protein Chlamydia pneumoniae
P82602 1.13e-29 119 33 9 260 3 folKP Folate synthesis bifunctional protein Chlamydia muridarum (strain MoPn / Nigg)
P9WNC9 3.92e-29 115 34 5 271 1 folP2 Inactive dihydropteroate synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNC8 3.92e-29 115 34 5 271 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64140 3.92e-29 115 34 5 271 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q821E2 1.16e-27 114 30 8 267 3 folKP Folate synthesis bifunctional protein Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q54YD9 9.07e-26 109 41 2 136 3 fol1 Folic acid synthesis protein FOL1 Dictyostelium discoideum
Q54YD9 4.33e-16 81 36 2 110 3 fol1 Folic acid synthesis protein FOL1 Dictyostelium discoideum
O84619 2.21e-24 104 31 9 263 3 folKP Folate synthesis bifunctional protein Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q49184 2.27e-23 99 26 5 247 3 sulI Dihydropteroate synthase type-1 Mycolicibacterium fortuitum
P0C003 2.27e-23 99 26 5 247 3 sulI Dihydropteroate synthase type-1 Pseudomonas aeruginosa
P0C002 2.27e-23 99 26 5 247 1 sulI Dihydropteroate synthase type-1 Escherichia coli
P0C004 2.27e-23 99 26 5 247 3 sulI Dihydropteroate synthase type-1 Corynebacterium glutamicum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16990
Feature type CDS
Gene folP
Product dihydropteroate synthase
Location 3739528 - 3740370 (strand: 1)
Length 843 (nucleotides) / 280 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1455
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00809 Pterin binding enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0294 Coenzyme transport and metabolism (H) H Dihydropteroate synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00796 dihydropteroate synthase [EC:2.5.1.15] Folate biosynthesis
Metabolic pathways
Biosynthesis of cofactors
Tetrahydrofolate biosynthesis, GTP => THF

Protein Sequence

MKLIARGRELNLSSPQVMGILNVTPDSFSDGGTHNSLNDAINHAAKLIAEGASIIDIGGESTRPGASDVSVDEELHRVIPVVEAIQQRFDVWISVDTSKAQVITESAQAGASIINDIRSLTEPGALQAAAKTGLPVCIMHMQGLPKTMQHSPQYKNVMIEVDAFLAENIQRCIDAGIEKNQIILDPGFGFGKNLAHNYQLLAHLSDFHHFGLPILAGMSRKSMVGQLLNVPPQERVAGSVACAVIAAMQGAQIIRVHDVKETVDAMKVVQATLSAKENNE

Flanking regions ( +/- flanking 50bp)

AAATACAAACCCCAGGCTTTCTGGGGTTTTTTTATATAGGTATCAACGAAATGAAATTAATTGCCAGAGGAAGAGAGCTTAATTTATCTTCACCCCAAGTGATGGGCATTTTAAATGTGACGCCAGATTCATTTTCTGATGGCGGAACGCATAACTCTCTTAATGATGCTATTAACCACGCCGCTAAACTTATTGCTGAAGGGGCTTCTATCATCGATATCGGTGGTGAATCAACAAGGCCGGGTGCCAGTGATGTTTCTGTCGATGAAGAATTACATCGTGTTATTCCTGTGGTCGAAGCTATCCAGCAACGTTTTGATGTGTGGATTTCTGTTGATACATCCAAAGCACAAGTGATCACGGAGTCCGCTCAAGCGGGTGCCTCTATTATCAATGATATACGTTCACTTACCGAACCTGGAGCACTTCAGGCGGCTGCAAAAACGGGGTTACCTGTTTGTATTATGCATATGCAAGGTTTACCTAAAACAATGCAACATTCGCCGCAGTATAAGAATGTGATGATAGAAGTTGATGCTTTTCTGGCAGAGAATATTCAACGTTGTATTGATGCTGGTATCGAGAAAAATCAAATTATTCTTGATCCAGGCTTCGGCTTTGGTAAAAATTTAGCGCATAATTATCAATTATTAGCACATCTAAGTGATTTTCATCACTTTGGTTTACCGATACTCGCCGGAATGTCACGTAAATCAATGGTAGGGCAGTTACTCAATGTTCCGCCACAAGAGCGTGTTGCTGGTAGTGTTGCTTGCGCAGTTATTGCTGCAATGCAAGGGGCACAAATTATTCGTGTACACGATGTTAAAGAGACTGTAGATGCGATGAAAGTCGTGCAGGCGACTCTTTCTGCAAAGGAAAATAATGAATGAGCGAACGTAAATACTTTGGAACAGACGGTATCCGTGGAAAAGTAGGTGAC