Homologs in group_2437

Help

6 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19920 FBDBKF_19920 100.0 Morganella morganii S1 lexA SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)
EHELCC_07695 EHELCC_07695 100.0 Morganella morganii S2 lexA SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)
LHKJJB_06245 LHKJJB_06245 100.0 Morganella morganii S3 lexA SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)
HKOGLL_19100 HKOGLL_19100 100.0 Morganella morganii S5 lexA SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)
F4V73_RS02025 F4V73_RS02025 22.5 Morganella psychrotolerans - S24 family peptidase
F4V73_RS06245 F4V73_RS06245 59.8 Morganella psychrotolerans - S24 family peptidase

Distribution of the homologs in the orthogroup group_2437

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2437

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P03034 1.25e-54 178 41 3 230 1 cI Repressor protein cI Escherichia phage lambda
P69202 5.26e-44 150 39 3 206 1 C2 Repressor protein C2 Salmonella phage P22
Q79S39 1.95e-38 135 38 5 212 4 s087 HTH-type transcriptional regulator for conjugative element SXT Vibrio cholerae
Q8GJK1 1.95e-38 135 38 5 212 4 None HTH-type transcriptional regulator for conjugative element pMERPH Shewanella putrefaciens
Q79RI9 1.95e-38 135 38 5 212 4 ORF-96 HTH-type transcriptional regulator for conjugative element R391 Providencia rettgeri
P75974 1.13e-19 87 39 4 128 4 cohE Prophage repressor CohE Escherichia coli (strain K12)
Q83BT6 8.71e-10 60 28 1 113 1 CBU_1416 Uncharacterized HTH-type transcriptional regulator CBU_1416 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q0A9N9 3.54e-08 55 31 6 130 3 lexA LexA repressor Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q12ID6 1.17e-06 51 29 5 127 3 lexA LexA repressor Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P61609 2.34e-06 50 28 5 149 3 lexA2 LexA repressor 2 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q28R71 2.46e-06 50 29 4 114 3 lexA LexA repressor Jannaschia sp. (strain CCS1)
A9B5H8 5.98e-06 49 30 2 91 3 lexA LexA repressor Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A1SBC7 6.36e-06 48 30 5 133 3 lexA LexA repressor Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q605V8 7.35e-06 48 29 5 119 3 lexA LexA repressor Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q48AA9 9.48e-06 48 31 5 130 3 lexA LexA repressor Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1TQ93 1.02e-05 48 31 6 129 3 lexA LexA repressor Paracidovorax citrulli (strain AAC00-1)
A9BWH9 1.36e-05 48 31 5 129 3 lexA LexA repressor Delftia acidovorans (strain DSM 14801 / SPH-1)
A8F429 1.4e-05 47 32 4 125 3 lexA LexA repressor Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
C1DQZ4 1.54e-05 47 30 6 131 3 lexA LexA repressor Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q0APU7 1.82e-05 47 34 3 91 3 lexA LexA repressor Maricaulis maris (strain MCS10)
A1W897 2.1e-05 47 29 6 129 3 lexA LexA repressor Acidovorax sp. (strain JS42)
B9MI78 2.1e-05 47 29 6 129 3 lexA LexA repressor Acidovorax ebreus (strain TPSY)
Q044D8 2.93e-05 47 28 6 128 3 lexA LexA repressor Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P61608 3.81e-05 46 28 5 132 3 lexA1 LexA repressor 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
C5CKV7 3.92e-05 47 31 6 129 3 lexA LexA repressor Variovorax paradoxus (strain S110)
P61610 3.97e-05 46 28 6 128 3 lexA LexA repressor Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
O86948 4.98e-05 46 31 5 138 3 lexA LexA repressor Thermotoga neapolitana
Q03B55 5.22e-05 46 29 5 127 3 lexA LexA repressor Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WC17 5.22e-05 46 29 5 127 3 lexA LexA repressor Lacticaseibacillus casei (strain BL23)
Q39VQ1 5.62e-05 46 30 5 132 3 lexA LexA repressor Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P0A154 7.12e-05 45 30 4 126 3 lexA LexA repressor Pseudomonas putida
P0A153 7.12e-05 45 30 4 126 3 lexA1 LexA repressor 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O32506 8.28e-05 45 32 2 87 3 lexA LexA repressor Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A1SR67 9.29e-05 45 29 4 114 3 lexA LexA repressor Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B9K9N0 9.86e-05 45 31 5 137 3 lexA LexA repressor Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
C5D9K3 9.86e-05 45 28 6 129 3 lexA LexA repressor Geobacillus sp. (strain WCH70)
A6VMQ0 0.000173 44 29 5 141 3 lexA LexA repressor Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q8YHG1 0.000176 45 25 7 161 3 lexA LexA repressor Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8KT78 0.000196 44 31 3 95 3 lexA LexA repressor Pseudomonas chlororaphis
A4XSN5 0.000248 44 31 3 95 3 lexA LexA repressor Pseudomonas mendocina (strain ymp)
B8DG25 0.000401 43 27 5 126 3 lexA LexA repressor Listeria monocytogenes serotype 4a (strain HCC23)
Q720B9 0.000401 43 27 5 126 3 lexA LexA repressor Listeria monocytogenes serotype 4b (strain F2365)
C1L2K9 0.000401 43 27 5 126 3 lexA LexA repressor Listeria monocytogenes serotype 4b (strain CLIP80459)
B6IST2 0.000432 43 30 3 94 3 lexA LexA repressor Rhodospirillum centenum (strain ATCC 51521 / SW)
Q8Y7H7 0.000454 43 27 5 126 3 lexA LexA repressor Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q87ZB9 0.000765 42 32 2 77 3 lexA1 LexA repressor 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_08020
Feature type CDS
Gene lexA
Product SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)
Location 9406 - 10113 (strand: -1)
Length 708 (nucleotides) / 235 (amino acids)

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2437
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF00717 Peptidase S24-like
PF01381 Helix-turn-helix

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1974 Transcription (K)
Signal transduction mechanisms (T)		 KT SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)

Protein Sequence

MNEKRQLTTEQLADCRRLKALYESKKKELGITQQSIADILNISQGAVGHYLNGRNALNLQTASVFATQLNVPISDFSPSLAAEAQALSAAIDSNISGLRPYKPSPRYPLISWVQAGAWNEANEAYGLDQIDEWYESETHVQGAAFWLRVEGESMTAPTGKSVPDGSLILIDTGKDSENGSLVVAKLTDSNEATFKKLVIDGGNWYLKGLNPTWPAMKVNGDCKIIGVAVQMMMKL

Flanking regions ( +/- flanking 50bp)

GTCAATATCTTTAGTATTGACAAAAATTCTGATTTTGGTATTAATATTGTATGAATGAAAAACGACAACTGACGACAGAACAGCTGGCAGACTGCCGAAGACTGAAAGCTTTGTATGAGTCAAAGAAAAAAGAGCTGGGTATCACCCAACAGAGCATTGCTGACATACTGAATATCAGCCAGGGCGCCGTCGGTCACTATCTTAACGGCCGTAATGCATTGAATTTACAGACAGCAAGTGTGTTCGCCACGCAACTCAATGTCCCTATTTCTGATTTCAGTCCGTCTCTTGCCGCAGAGGCGCAGGCACTGAGTGCCGCTATTGACAGCAATATTTCCGGCCTTCGCCCTTACAAACCCTCCCCGAGATACCCGTTAATCAGCTGGGTACAGGCGGGTGCCTGGAATGAGGCGAATGAAGCTTACGGGCTGGATCAAATCGACGAATGGTATGAATCAGAAACCCATGTTCAGGGGGCCGCATTCTGGCTGAGAGTCGAAGGCGAATCCATGACCGCACCAACCGGCAAGAGTGTGCCTGACGGCTCTTTGATCCTGATCGACACCGGCAAAGATTCCGAAAATGGCAGCCTGGTCGTCGCAAAGCTGACGGATTCTAACGAAGCAACGTTCAAAAAACTGGTGATCGATGGCGGCAACTGGTATCTGAAAGGACTCAACCCGACGTGGCCGGCCATGAAAGTTAACGGTGACTGTAAAATTATCGGTGTTGCCGTTCAGATGATGATGAAACTGTAATCATCTCCTGCCGCCCTCCTGCCGGAGGGCATTTTACTGTTCACAGACAA