Homologs in group_387

Help

7 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20045 FBDBKF_20045 100.0 Morganella morganii S1 sfmF fimbria assembly protein
EHELCC_03485 EHELCC_03485 100.0 Morganella morganii S2 sfmF fimbria assembly protein
LHKJJB_09315 LHKJJB_09315 100.0 Morganella morganii S3 sfmF fimbria assembly protein
HKOGLL_09660 HKOGLL_09660 100.0 Morganella morganii S5 sfmF fimbria assembly protein
F4V73_RS01665 F4V73_RS01665 76.8 Morganella psychrotolerans sfmF fimbria assembly protein
F4V73_RS09370 F4V73_RS09370 24.1 Morganella psychrotolerans - fimbrial protein
F4V73_RS12590 F4V73_RS12590 33.1 Morganella psychrotolerans - fimbrial protein

Distribution of the homologs in the orthogroup group_387

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_387

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37926 3.86e-39 134 42 3 173 3 fimF Fimbrial-like protein FimF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P38052 8.55e-37 128 40 4 174 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
P37920 2.33e-21 89 36 5 153 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi
P55223 8.46e-21 87 35 4 152 3 None Fimbrial subunit type 1 Salmonella typhimurium
P43660 9.7e-21 87 31 3 181 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37921 3.63e-20 85 34 4 152 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P39264 4.25e-19 82 30 1 148 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P12730 5.36e-16 74 29 5 179 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0ABW5 8.62e-16 74 32 4 161 2 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli (strain K12)
P0ABW6 8.62e-16 74 32 4 161 3 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli O157:H7
Q8X5K5 1.56e-15 73 30 5 181 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P62605 1.5e-14 70 29 4 179 3 pilC Type-1 fimbrial protein, C chain Escherichia coli
P62606 1.5e-14 70 29 4 179 3 pilC Type-1 fimbrial protein, C chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P08189 1.7e-13 68 30 4 172 1 fimF Protein FimF Escherichia coli (strain K12)
P13429 3.8e-13 67 30 6 168 1 sfaG S-fimbrial protein subunit SfaG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P77789 8.2e-13 66 27 4 170 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
P75860 9.82e-10 58 31 4 151 2 ycbV Uncharacterized fimbrial-like protein YcbV Escherichia coli (strain K12)
P12903 1.37e-08 55 28 6 185 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
Q47223 1.87e-08 54 30 4 151 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
Q08456 1.5e-07 52 27 5 173 5 fimI Putative fimbrin-like protein FimI Salmonella typhi
P37922 3.36e-07 51 27 5 173 3 fimI Fimbrin-like protein FimI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P12266 8.39e-07 50 29 4 151 1 None Fimbrial subunit type 1 Klebsiella pneumoniae
P22595 2.08e-06 48 26 4 155 3 fimA Type-1 fimbrial protein subunit Serratia marcescens
P04128 5.8e-06 47 32 7 153 1 fimA Type-1 fimbrial protein, A chain Escherichia coli (strain K12)
P75859 6.39e-06 47 24 6 180 2 ycbU Uncharacterized fimbrial-like protein YcbU Escherichia coli (strain K12)
P42913 2.57e-05 46 34 4 86 2 yraH Uncharacterized fimbrial-like protein YraH Escherichia coli (strain K12)
Q8X5L0 3.68e-05 45 27 5 158 2 lpfE Probable fimbrial subunit LpfE Escherichia coli O157:H7
P45989 6.2e-05 45 23 6 210 3 hifA Major fimbrial subunit Haemophilus influenzae
P14212 6.44e-05 45 23 6 210 1 hifA Major fimbrial subunit Haemophilus influenzae
P43664 9.3e-05 44 25 7 178 3 lpfE Protein LpfE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P39834 0.000707 42 25 4 176 3 ygiL Uncharacterized fimbrial-like protein YgiL Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_03485
Feature type CDS
Gene sfmF
Product fimbria assembly protein
Location 5983 - 6516 (strand: 1)
Length 534 (nucleotides) / 177 (amino acids)
In genomic island -

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_387
Orthogroup size 8
N. genomes 6

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07355 fimbrial-like protein - -

Protein Sequence

MKKHIKQALLPLLCGSLLIHSAAAYELGRVNIELSGEIVAYSCGVEVSQANKKVELGRWALKNFRAAGDKTQSMPFSFQLQNCPPSSAVTFVFSGKKDKQDSSLLAINEGASAAGSVAVEILDSQKNRLPVETKSPKIAMDINGNGQAQFYANYIATGNRPTPGIADADATFMITYD

Flanking regions ( +/- flanking 50bp)

TTCCAATCCCGCGGTTATTTACGCGTTGACTACGAATAACAGGCACGGCAATGAAGAAACACATTAAACAGGCTCTGCTCCCCCTGCTTTGCGGTAGTCTGCTGATCCATTCAGCCGCCGCTTATGAACTCGGCCGGGTCAATATTGAGTTGTCCGGTGAAATTGTCGCTTACAGTTGCGGGGTCGAAGTTTCCCAGGCAAATAAAAAAGTCGAACTGGGGCGCTGGGCACTGAAAAATTTCCGCGCCGCCGGTGATAAAACACAATCCATGCCGTTCAGTTTTCAGTTACAGAATTGTCCGCCCTCTTCTGCCGTCACCTTTGTCTTCAGCGGTAAGAAAGATAAGCAGGACAGCTCACTGCTGGCAATAAATGAGGGAGCAAGTGCTGCAGGCTCTGTGGCGGTGGAGATCCTCGACAGTCAGAAAAACCGGCTGCCGGTGGAAACCAAAAGCCCGAAAATTGCCATGGATATTAACGGCAACGGTCAGGCACAATTTTATGCCAACTATATTGCCACCGGAAACCGCCCGACACCCGGCATCGCTGACGCGGATGCTACTTTTATGATTACCTACGACTAATCACGCTATATTTCATCCGGGGTATTTCCGTCTCTGCAAAATAACCGCAG