Homologs in group_1475

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09505 FBDBKF_09505 100.0 Morganella morganii S1 narL two-component system response regulator NarL
EHELCC_09905 EHELCC_09905 100.0 Morganella morganii S2 narL two-component system response regulator NarL
NLDBIP_19225 NLDBIP_19225 100.0 Morganella morganii S4 narL two-component system response regulator NarL
HKOGLL_18925 HKOGLL_18925 100.0 Morganella morganii S5 narL two-component system response regulator NarL
F4V73_RS10465 F4V73_RS10465 91.4 Morganella psychrotolerans narL two-component system response regulator NarL
PMI_RS17750 PMI_RS17750 75.6 Proteus mirabilis HI4320 narL two-component system response regulator NarL

Distribution of the homologs in the orthogroup group_1475

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1475

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AF31 4.41e-95 280 76 0 209 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 4.41e-95 280 76 0 209 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 4.41e-95 280 76 0 209 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 4.41e-95 280 76 0 209 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
P31802 8.1e-58 185 45 1 211 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P44845 1.28e-50 166 41 3 207 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54662 5.48e-43 148 35 3 220 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P55184 7.15e-40 139 37 4 208 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
O07528 1.88e-39 138 37 3 205 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P13800 9.12e-38 134 32 1 219 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q1M7A0 3.14e-36 130 35 1 194 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O32197 4.04e-34 124 37 3 208 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P9WGM5 4.56e-34 124 36 1 206 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 4.56e-34 124 36 1 206 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7A0I0 7e-33 121 36 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 7e-33 121 36 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 7e-33 121 36 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 7e-33 121 36 5 208 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 7e-33 121 36 5 208 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 7e-33 121 36 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P96686 1.07e-31 118 34 3 206 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P94439 1.82e-30 115 33 2 208 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
P9WMF9 6.75e-30 114 32 3 207 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 6.75e-30 114 32 3 207 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P27667 3.62e-28 108 35 3 200 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGA9 6.23e-28 108 35 3 200 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 6.23e-28 108 35 3 200 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 6.23e-28 108 35 3 200 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 6.23e-28 108 35 3 200 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
Q7CQM5 2.57e-27 107 31 2 197 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q51373 8.22e-27 105 32 3 206 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O07019 1.12e-26 105 33 4 202 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
O34723 3e-26 103 30 2 199 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q4L8Q6 6.61e-26 103 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q7WZY4 6.97e-26 103 30 4 213 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q6GE42 4.03e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 4.03e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A029 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 4.78e-25 101 31 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HEP0 7.41e-25 100 36 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 7.41e-25 100 36 5 208 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CNP9 7.89e-25 100 36 5 208 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 7.89e-25 100 36 5 208 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L7J5 1.41e-24 99 34 2 205 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
Q5HLK6 1.97e-24 99 31 4 214 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN75 2.31e-24 99 31 4 214 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P56644 5.31e-24 98 29 2 203 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
Q49YS9 1.38e-23 97 34 4 210 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A8R3S7 2.17e-23 96 30 0 197 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
P0A4H2 3.09e-22 93 33 3 198 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 3.09e-22 93 33 3 198 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 3.09e-22 93 33 3 198 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0ACZ7 4.21e-22 93 26 5 208 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 4.21e-22 93 26 5 208 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 4.21e-22 93 26 5 208 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 4.21e-22 93 26 5 208 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
P0AED6 7.35e-22 92 26 1 197 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 7.35e-22 92 26 1 197 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 7.35e-22 92 26 1 197 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 7.35e-22 92 26 1 197 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P95582 4.74e-21 90 29 4 208 3 gacA Response regulator GacA Pseudomonas viridiflava
Q52376 5.54e-21 90 29 4 208 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P24908 6.67e-21 90 32 3 200 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P32967 6.01e-20 87 27 4 208 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
A8R3T0 2.8e-16 78 28 4 215 3 agmR Glycerol metabolism activator Pseudomonas putida
P72781 2.91e-16 78 28 5 227 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P96602 9.93e-16 76 34 0 119 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P29369 1.31e-15 76 29 4 217 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KR08 1.48e-15 75 36 6 151 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q3LWR6 2.04e-15 75 34 5 154 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 2.04e-15 75 34 5 154 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 2.04e-15 75 34 5 154 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P0AEL8 5.33e-15 74 26 4 202 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 5.33e-15 74 26 4 202 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
Q56312 6.88e-15 71 29 3 117 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P26319 1.3e-14 73 25 5 204 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A4H5 2.05e-13 67 28 1 116 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 2.05e-13 67 28 1 116 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P39486 2.63e-13 70 31 0 124 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q1IRH0 1.04e-12 69 39 1 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q1IQS9 1.15e-12 69 28 4 183 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
P58664 1.35e-12 67 27 3 198 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
B0R4K1 2.57e-12 65 29 1 101 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q5L0L0 2.65e-12 68 34 1 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
P14204 3.21e-12 67 28 7 208 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
Q1XDE4 5.07e-12 66 32 4 171 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P48359 5.43e-12 66 29 3 162 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q9K998 6.37e-12 66 31 0 114 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P10958 8.03e-12 65 28 4 199 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
P37640 1.15e-11 65 36 1 100 1 yhjB Putative HTH-type transcriptional regulator YhjB Escherichia coli (strain K12)
Q0A9Z5 1.26e-11 66 37 4 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q21IQ9 5.95e-11 64 35 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8DET1 7.35e-11 63 36 2 109 3 VV1_0503 Uncharacterized response regulatory protein VV1_0503 Vibrio vulnificus (strain CMCP6)
P0A4H8 7.7e-11 63 31 7 211 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 7.7e-11 63 31 7 211 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q15RF6 7.91e-11 64 34 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9HWA4 8.84e-11 63 23 8 259 1 pprB Two-component response regulator PprB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52883 1.07e-10 63 34 3 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q9KL96 1.37e-10 62 33 3 110 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
L7N689 1.41e-10 62 29 5 184 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O85128 1.44e-10 63 36 2 85 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2FQU2 1.72e-10 63 37 2 86 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
P62646 2.09e-10 63 39 0 79 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8D4U6 2.19e-10 62 30 3 146 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
P0AFT5 2.23e-10 62 31 3 117 1 btsR Transcriptional regulatory protein BtsR Escherichia coli (strain K12)
P0AFT6 2.23e-10 62 31 3 117 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DUE6 2.23e-10 62 31 3 117 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O157:H7
P0DUE7 2.23e-10 62 31 3 117 4 btsR Transcriptional regulatory protein-like BtsR Enterobacteria phage VT1-Sakai
O83639 2.34e-10 63 37 0 79 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
P29904 2.35e-10 61 28 6 193 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
Q2ILG8 2.95e-10 62 40 2 96 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
P59640 3.09e-10 61 31 3 117 3 btsR Transcriptional regulatory protein BtsR Shigella flexneri
Q88EW5 4.19e-10 62 35 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P45709 4.47e-10 58 29 3 115 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
P43501 5.32e-10 58 30 2 120 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KA55 5.5e-10 62 32 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O52262 6.52e-10 61 35 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudomonas putida
Q1D359 6.69e-10 61 33 2 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
P24072 7.37e-10 58 25 1 114 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q8Z5C1 7.91e-10 60 32 3 117 3 btsR Transcriptional regulatory protein BtsR Salmonella typhi
Q8ZNN2 8.48e-10 60 32 3 117 3 btsR Transcriptional regulatory protein BtsR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3KFZ6 8.65e-10 61 35 3 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain Pf0-1)
Q8Q009 9.38e-10 61 32 4 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P9WGM3 9.4e-10 59 29 3 131 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 9.4e-10 59 29 3 131 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q46791 1.01e-09 58 30 2 139 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
Q65JK6 1.2e-09 60 33 4 136 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q67P67 1.45e-09 60 35 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8TLG9 1.47e-09 60 29 3 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A1SMR4 1.61e-09 60 34 1 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P26487 1.62e-09 59 30 2 152 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8ZBV2 1.71e-09 59 28 3 156 3 YPO3287 Uncharacterized response regulatory protein YPO3287/y0902/YP_0397 Yersinia pestis
Q55890 1.89e-09 59 36 2 115 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51586 1.98e-09 57 32 2 118 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q10WZ6 2.06e-09 60 34 1 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q3ADA6 2.15e-09 60 33 3 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q48GG6 2.17e-09 60 34 3 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87S86 2.23e-09 59 32 3 133 3 VP0538 Uncharacterized response regulatory protein VP0538 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8F6P9 2.34e-09 60 32 2 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 2.34e-09 60 32 2 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
O58192 2.42e-09 60 31 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9UYF3 2.49e-09 60 31 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q24T61 2.49e-09 60 33 1 78 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
Q2KCH8 2.77e-09 59 32 3 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7AKE4 2.85e-09 58 27 5 201 1 ramR Response regulator RamR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7CQM8 3.25e-09 58 30 5 200 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q884V3 3.45e-09 59 34 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2SBX9 3.67e-09 59 34 3 107 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Hahella chejuensis (strain KCTC 2396)
Q4ZQV7 3.69e-09 59 34 3 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. syringae (strain B728a)
Q56127 3.71e-09 58 26 3 203 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
Q9KU36 4.24e-09 58 34 2 107 3 VC_0693 Uncharacterized response regulatory protein VC_0693 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P26275 5.64e-09 58 31 5 138 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O54294 5.71e-09 57 32 1 110 1 csgD Probable csgAB operon transcriptional regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q39T95 5.81e-09 58 35 2 111 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P69410 6.42e-09 57 26 3 203 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 6.42e-09 57 26 3 203 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 6.42e-09 57 26 3 203 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 6.42e-09 57 26 3 203 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 6.42e-09 57 26 3 203 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
P58663 6.81e-09 57 26 3 203 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A0U4 7.66e-09 57 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 7.66e-09 57 27 9 211 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 7.66e-09 57 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 7.66e-09 57 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 7.66e-09 57 27 9 211 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 7.66e-09 57 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 7.66e-09 57 27 9 211 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 7.66e-09 57 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9WYN9 1.02e-08 58 30 3 126 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P52106 1.16e-08 57 34 2 108 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
O69730 1.16e-08 57 32 2 115 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P51343 1.38e-08 56 30 4 180 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P54794 1.47e-08 56 44 2 65 4 moaR Monoamine regulon transcriptional regulator Klebsiella aerogenes
Q3SVA1 1.71e-08 57 31 1 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8FZ93 1.74e-08 56 32 1 109 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 1.74e-08 56 32 1 109 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 1.74e-08 56 32 1 109 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 1.74e-08 56 32 1 109 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 1.74e-08 56 32 1 109 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 1.74e-08 56 32 1 109 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 1.74e-08 56 32 1 109 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 1.74e-08 56 32 1 109 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
O87125 1.78e-08 57 34 3 107 1 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6WZ81 1.88e-08 56 32 1 109 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q82Z76 2.2e-08 56 29 5 121 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
P52931 2.48e-08 55 28 3 120 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
P35163 2.7e-08 56 26 8 218 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P9WGN1 3.53e-08 55 32 2 115 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 3.53e-08 55 32 2 115 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4KG36 3.84e-08 56 33 3 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P94413 3.93e-08 55 27 7 180 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q06065 4.82e-08 56 29 1 115 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q0AYL3 4.87e-08 56 29 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q46DT6 6.37e-08 55 31 1 95 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q31S42 7.66e-08 55 35 2 115 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1CX06 8.63e-08 55 36 1 110 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Myxococcus xanthus (strain DK1622)
P52934 9.03e-08 54 30 1 115 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q1MLG8 1.07e-07 55 31 3 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P96126 1.2e-07 52 27 2 116 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
P45337 1.22e-07 53 26 6 208 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P62640 1.3e-07 55 34 2 102 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8PX96 1.32e-07 54 32 1 95 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P06534 1.46e-07 54 27 1 125 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q6LTM2 1.62e-07 54 31 3 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
O29221 1.67e-07 54 33 4 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7MBQ5 1.82e-07 54 32 3 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
Q8D4X6 1.96e-07 54 32 3 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
P11470 2e-07 50 43 0 57 1 gerE Spore germination protein GerE Bacillus subtilis (strain 168)
P23221 2.08e-07 53 26 5 202 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q99U73 2.4e-07 53 27 5 179 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q2W2W9 2.53e-07 53 33 1 96 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P39663 2.69e-07 53 31 4 131 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P76340 2.94e-07 53 28 7 201 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q8EQQ3 3.15e-07 53 23 3 179 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P38684 3.31e-07 52 31 2 116 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
A0QTK2 3.51e-07 52 33 3 108 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8TUQ0 4.39e-07 53 31 1 95 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5JF95 4.46e-07 53 29 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P52941 4.51e-07 52 27 2 122 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P0C001 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 4.68e-07 52 26 4 176 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 4.68e-07 52 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q7D9K0 5.06e-07 52 30 3 149 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 5.06e-07 52 30 3 149 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5QZQ3 5.31e-07 53 29 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q97GZ3 5.94e-07 52 29 1 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q12PJ3 6.78e-07 52 29 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q9HV32 6.86e-07 52 26 7 207 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8H358 7.25e-07 52 33 0 77 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 7.25e-07 52 33 0 77 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P28835 7.54e-07 52 29 3 117 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q8EQW0 7.82e-07 52 31 3 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O05251 8.38e-07 52 30 0 123 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q5E3S1 8.47e-07 52 30 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q47I43 8.55e-07 52 31 2 86 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
Q21G20 8.6e-07 52 34 1 75 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9KT84 8.74e-07 52 34 0 85 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P66795 9.08e-07 51 28 9 213 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 9.08e-07 51 28 9 213 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q5FQQ0 9.76e-07 52 30 1 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Gluconobacter oxydans (strain 621H)
Q04942 9.94e-07 51 32 4 112 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q05522 1.01e-06 52 32 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
Q2LR65 1.06e-06 52 26 5 177 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
Q12YX1 1.08e-06 52 28 3 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q6AJV3 1.17e-06 52 36 4 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P52929 1.22e-06 51 28 1 121 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
T2KMF4 1.25e-06 52 29 3 125 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q7A1J1 1.33e-06 51 33 1 81 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.33e-06 51 33 1 81 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.33e-06 51 33 1 81 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.33e-06 51 33 1 81 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.33e-06 51 33 1 81 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.33e-06 51 33 1 81 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.33e-06 51 33 1 81 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.33e-06 51 33 1 81 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.33e-06 51 33 1 81 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.33e-06 51 33 1 81 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q0HWY6 1.49e-06 51 28 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-7)
P0AEV3 1.67e-06 51 31 1 107 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.67e-06 51 31 1 107 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.67e-06 51 31 1 107 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q3IDZ3 1.69e-06 51 31 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas translucida (strain TAC 125)
Q132U2 1.69e-06 51 31 2 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain BisB5)
Q44006 1.76e-06 50 30 2 115 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0HKN5 1.82e-06 51 28 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-4)
P58357 1.91e-06 50 31 2 116 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q2RRX2 1.95e-06 51 36 2 73 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q1QI44 1.98e-06 51 30 1 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q93CB8 2e-06 50 35 2 78 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 2.01e-06 50 35 2 78 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 2.01e-06 50 35 2 78 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 2.01e-06 50 35 2 78 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CCJ2 2.02e-06 50 35 2 78 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q4KHL8 2.1e-06 51 32 1 96 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9I0I1 2.23e-06 50 34 2 112 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O87717 2.26e-06 51 31 1 72 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2SFK0 2.67e-06 50 33 3 93 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P13792 2.75e-06 50 31 0 79 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q2RZD2 2.86e-06 50 29 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salinibacter ruber (strain DSM 13855 / M31)
Q085K9 2.94e-06 50 28 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shewanella frigidimarina (strain NCIMB 400)
P0A4I4 2.95e-06 50 25 2 128 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 2.95e-06 50 25 2 128 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P62636 2.97e-06 50 30 1 101 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O34903 3.05e-06 50 29 6 176 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q4L6C6 3.22e-06 50 27 6 172 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P62638 3.26e-06 50 28 2 127 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P37478 3.37e-06 50 29 1 99 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
A1TEL7 3.7e-06 50 26 6 218 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P52928 3.87e-06 50 26 3 123 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q87K77 3.89e-06 50 29 2 103 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DPL7 4.04e-06 49 31 2 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 4.04e-06 49 31 2 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 4.04e-06 49 31 2 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q49XM7 4.16e-06 49 28 6 173 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8XBS3 4.16e-06 49 29 8 207 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
O78417 4.72e-06 49 20 4 165 3 ycf29 Probable transcriptional regulator ycf29 Guillardia theta
P42012 5.06e-06 49 23 2 121 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q47456 5.37e-06 49 32 0 82 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
Q1CZL0 5.66e-06 50 38 0 62 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Myxococcus xanthus (strain DK1622)
Q8ECD7 5.84e-06 50 28 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3SIG0 5.89e-06 50 32 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thiobacillus denitrificans (strain ATCC 25259)
Q87MK5 5.91e-06 50 31 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0ARY3 5.95e-06 50 35 2 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Maricaulis maris (strain MCS10)
A7N5N6 6.39e-06 50 43 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio campbellii (strain ATCC BAA-1116)
Q87FQ5 6.51e-06 50 43 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q20YL8 6.61e-06 49 31 1 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodopseudomonas palustris (strain BisB18)
Q485K0 7.69e-06 49 31 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q54SP4 7.73e-06 50 25 4 163 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
O78428 8.19e-06 48 27 2 120 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P0C5S5 8.69e-06 49 30 0 85 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 8.69e-06 49 30 0 85 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P52940 8.94e-06 48 29 3 123 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q1CWZ9 8.96e-06 49 36 1 100 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Myxococcus xanthus (strain DK1622)
Q7MG94 8.98e-06 49 29 2 113 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain YJ016)
Q8D4P3 8.98e-06 49 29 2 113 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain CMCP6)
P52932 9.01e-06 48 26 1 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q2IT50 9.12e-06 49 32 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain HaA2)
Q3ADG9 9.16e-06 49 25 1 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3KHF6 9.17e-06 49 31 1 96 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas fluorescens (strain Pf0-1)
P0ACZ8 9.21e-06 48 28 7 179 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 9.21e-06 48 28 7 179 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 9.21e-06 48 28 7 179 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q93P00 9.49e-06 47 31 2 103 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P07026 1.01e-05 48 30 3 120 1 sdiA Regulatory protein SdiA Escherichia coli (strain K12)
Q87MX7 1.03e-05 49 30 0 85 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q886S8 1.07e-05 48 32 1 96 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2YC79 1.09e-05 48 30 0 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q9ZHD3 1.14e-05 48 32 1 98 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P51358 1.26e-05 48 29 3 117 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q2FMT2 1.29e-05 48 32 3 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q4ZWW3 1.39e-05 48 31 1 96 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. syringae (strain B728a)
Q98PD1 1.44e-05 48 35 1 96 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P36556 1.45e-05 48 26 8 217 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P62637 1.5e-05 48 25 1 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P58253 1.51e-05 48 31 3 106 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q01473 1.52e-05 48 27 3 118 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 5.44e-05 47 25 5 172 3 rcaC Protein RcaC Microchaete diplosiphon
Q1MP86 1.56e-05 48 27 0 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Lawsonia intracellularis (strain PHE/MN1-00)
Q48F23 1.6e-05 48 31 1 96 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q311M8 1.66e-05 48 30 0 63 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q9KNF3 1.66e-05 48 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0AWZ8 1.68e-05 48 24 5 174 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1XDC9 1.7e-05 48 29 3 117 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P0A2D5 1.88e-05 46 30 2 103 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 1.88e-05 46 30 2 103 3 cheY Chemotaxis protein CheY Salmonella typhi
Q9KQD8 1.91e-05 48 30 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q39QJ2 1.92e-05 48 28 1 104 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q820K0 2e-05 48 31 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9FAD7 2.05e-05 46 30 2 103 3 cheY Chemotaxis protein CheY Enterobacter cloacae
A0A0N8YGA2 2.07e-05 47 32 2 77 2 anoR Transcriptional activator protein AnoR Acinetobacter nosocomialis
Q0VKZ4 2.19e-05 48 36 1 69 2 alkS HTH-type transcriptional regulator AlkS Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q30ZJ5 2.42e-05 48 33 1 72 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7MIQ5 2.59e-05 48 30 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain YJ016)
P59969 2.59e-05 48 38 0 52 4 BQ2027_MB0914C Putative HTH-type transcriptional regulator Mb0914c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG0 2.59e-05 48 38 0 52 4 MT0914 Putative HTH-type transcriptional regulator MT0914 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8DB67 2.64e-05 48 30 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain CMCP6)
O34534 2.67e-05 47 24 7 196 1 citT Transcriptional regulatory protein CitT Bacillus subtilis (strain 168)
B1JHZ0 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664J3 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGR4 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pestis (strain Pestoides F)
Q8ZJI2 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pestis
B2K5W2 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2L4 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNW4 2.75e-05 48 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P31079 2.75e-05 47 31 3 116 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q1GZZ0 2.8e-05 47 28 5 145 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P32040 3.08e-05 47 27 2 128 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q2RX18 3.1e-05 47 26 1 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7MM78 3.24e-05 47 30 0 85 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 3.24e-05 47 30 0 85 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P0AE69 3.42e-05 45 29 2 103 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 3.42e-05 45 29 2 103 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 3.42e-05 45 29 2 103 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P9WMG1 3.64e-05 47 38 0 52 1 Rv0890c Putative HTH-type transcriptional regulator Rv0890c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8FGP6 3.67e-05 45 29 2 103 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P21866 3.79e-05 47 33 2 117 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P23620 3.82e-05 47 30 2 116 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7N976 3.82e-05 47 39 1 61 3 malT HTH-type transcriptional regulator MalT Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q49ZT8 3.87e-05 47 25 8 220 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2RKH8 3.89e-05 47 36 0 69 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P15940 4.14e-05 47 23 4 204 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q81JL3 4.25e-05 47 25 2 112 3 lytT Sensory transduction protein LytT Bacillus anthracis
Q31HL9 4.29e-05 47 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P62644 4.54e-05 47 30 1 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q88MS5 4.93e-05 47 30 1 96 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P48259 5.08e-05 46 28 2 113 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q814J1 5.42e-05 46 25 2 112 4 lytT Sensory transduction protein LytT Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q39S45 5.46e-05 47 29 2 93 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
O30919 5.54e-05 46 38 1 59 3 solR Transcriptional activator protein SolR Ralstonia solanacearum
Q8EDD7 6.14e-05 46 26 2 115 3 SO_2823 Uncharacterized response regulatory protein SO_2823 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P52936 6.38e-05 46 27 3 122 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P37740 6.82e-05 45 27 7 201 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q9K621 7.54e-05 46 27 4 115 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q167K9 7.79e-05 46 29 3 125 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q54Q69 8.22e-05 47 27 3 116 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q8D0P1 8.62e-05 44 30 2 103 3 cheY Chemotaxis protein CheY Yersinia pestis
B2J4Q8 8.83e-05 46 30 1 96 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A6TF41 8.86e-05 46 43 0 51 3 malT HTH-type transcriptional regulator MalT Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XTR7 9.11e-05 46 43 0 51 3 malT HTH-type transcriptional regulator MalT Klebsiella pneumoniae (strain 342)
Q1B3X8 9.39e-05 45 30 3 138 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 9.39e-05 45 30 3 138 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 9.39e-05 45 30 3 138 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P62647 9.49e-05 46 26 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
P52938 0.000116 45 23 1 122 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q9TLQ4 0.000116 45 27 4 112 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q51455 0.000119 43 27 3 113 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O87940 0.000121 45 23 4 204 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
Q3A5A8 0.000122 45 38 3 71 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
O31517 0.000124 45 26 1 115 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
Q8CQK0 0.000125 45 27 4 129 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 0.000125 45 27 4 129 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P52688 0.000131 45 28 0 117 1 citB Transcriptional regulatory protein CitB Klebsiella pneumoniae
Q9HV27 0.000136 45 37 2 87 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4UU97 0.000139 45 30 3 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8P9J7 0.000139 45 30 3 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A7ME76 0.00014 46 43 0 51 3 malT HTH-type transcriptional regulator MalT Cronobacter sakazakii (strain ATCC BAA-894)
Q39KQ1 0.00014 45 30 3 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9HXT8 0.00015 45 27 1 96 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4UU85 0.000152 45 27 4 159 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P24086 0.000154 43 30 2 113 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 0.000154 43 30 2 113 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2T8Y5 0.000157 45 31 1 102 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9KQD5 0.000167 43 29 3 105 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 0.000167 43 29 3 105 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P52076 0.000171 45 27 8 208 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q8RAZ3 0.000183 45 31 0 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P28257 0.000183 45 28 3 117 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q53228 0.000186 44 29 1 117 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P0CL17 0.000192 44 26 4 172 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 0.000192 44 26 4 172 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q04803 0.000198 45 33 4 109 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2SPQ1 0.000204 45 31 5 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
P45605 0.000205 44 33 1 71 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
A1W0A5 0.000205 43 27 4 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 0.000205 43 27 4 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 0.000205 43 27 4 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P72253 0.000207 45 26 2 134 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P0DMK7 0.000213 44 29 2 113 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 0.000213 44 29 2 113 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q9L4M7 0.000216 45 37 0 53 3 alkS HTH-type transcriptional regulator AlkS Pseudomonas putida
Q50136 0.000216 44 26 6 197 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q9ZM64 0.000222 43 27 4 114 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q2KV65 0.000227 45 30 1 96 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Bordetella avium (strain 197N)
P28787 0.00023 45 26 1 116 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q55169 0.000232 43 31 3 116 1 rcp1 Response regulator Rcp1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2W5V5 0.000237 45 29 2 97 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q13SY2 0.000259 45 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
Q46PH7 0.000262 45 27 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P06993 0.000262 45 41 0 51 1 malT HTH-type transcriptional regulator MalT Escherichia coli (strain K12)
B1IP47 0.000262 45 41 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A5M7 0.000262 45 41 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O9:H4 (strain HS)
B1X764 0.000262 45 41 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain K12 / DH10B)
C4ZVX0 0.000262 45 41 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain K12 / MC4100 / BW2952)
Q8KIY1 0.000265 45 28 4 154 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q1BRL2 0.000268 45 30 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
Q95PI2 0.000276 45 20 3 137 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q8CQ17 0.00028 44 25 2 112 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 0.00028 44 25 2 112 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0PWB4 0.000282 44 30 2 113 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P55629 0.000283 44 35 0 56 3 NGR_a01900 Putative HTH-type transcriptional regulator y4qH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q4LAJ9 0.000283 44 27 4 129 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P71403 0.000303 42 27 4 114 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P18769 0.000309 45 32 3 104 1 frzE Gliding motility regulatory protein Myxococcus xanthus
P46384 0.000319 43 26 2 115 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7LSC1 0.00032 45 41 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q46V28 0.000321 44 34 1 79 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0HIF6 0.00033 44 28 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
Q3YWK7 0.000332 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Shigella sonnei (strain Ss046)
Q9I6V9 0.000335 44 27 1 105 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0SZP7 0.000338 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Shigella flexneri serotype 5b (strain 8401)
O34951 0.000347 44 22 7 166 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q1R5L6 0.000351 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain UTI89 / UPEC)
Q0TC49 0.000351 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGU2 0.000351 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O1:K1 / APEC
B7MDP4 0.000351 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O45:K1 (strain S88 / ExPEC)
Q31VL4 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Shigella boydii serotype 4 (strain Sb227)
B1LI79 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain SMS-3-5 / SECEC)
B6I2Y2 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain SE11)
B7NE23 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8CXX5 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7M2H9 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O8 (strain IAI1)
B7N1J6 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O81 (strain ED1a)
B7NMI3 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YTW9 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X701 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O157:H7
B7L4U8 0.000357 45 43 1 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain 55989 / EAEC)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_19145
Feature type CDS
Gene narL
Product two-component system response regulator NarL
Location 19174 - 19875 (strand: -1)
Length 702 (nucleotides) / 233 (amino acids)

Contig

Accession ZDB_388
Length 22068 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1475
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07684 two-component system, NarL family, nitrate/nitrite response regulator NarL Two-component system -

Protein Sequence

MTNRILSAGEIILSDPDEAADPASPSTILLIDDHPMLRNGVRQLISMEPSLTVAGEAGNGRDGIALAESLDPDLILLDLNMPEMNGFETLDILRRKPLSGRVVVFSVSNYREDLITALRRGADGYLLKDMEPEELLVALRQAAAGKMVVSPALTEVLAGALREVRSDDEPDINSLTTRERDILKLIAQGQPNKMIARKLDITESTVKVHVKNLMKKMKVKSRVEAAVWVLQNK

Flanking regions ( +/- flanking 50bp)

CCAATACAACTATAAGAATAAATGAAGACGATTCAGGAGCAAGGTAAACAATGACGAACAGAATACTTTCGGCCGGAGAGATTATACTCAGTGATCCGGATGAAGCCGCTGACCCGGCCTCTCCCTCCACGATCCTGCTGATAGACGATCACCCGATGCTGCGTAACGGCGTCAGGCAATTAATCAGCATGGAGCCGTCACTGACTGTGGCCGGTGAAGCCGGGAATGGCCGCGACGGCATTGCGCTGGCGGAATCACTCGATCCGGATCTGATTCTGCTGGATCTGAATATGCCGGAAATGAACGGCTTTGAAACCCTGGATATTCTGCGGCGCAAACCGCTCTCCGGCCGGGTGGTGGTGTTCAGTGTGTCCAACTACCGGGAAGATCTGATTACGGCACTGCGCCGCGGGGCGGACGGCTATCTGCTCAAGGATATGGAGCCGGAAGAGCTGCTGGTGGCACTGCGTCAGGCGGCCGCCGGTAAAATGGTGGTCTCCCCGGCACTGACCGAAGTGCTGGCAGGCGCGCTGCGTGAGGTGCGCAGTGATGATGAGCCGGATATCAACAGCCTTACCACGCGTGAGCGCGATATACTGAAACTGATTGCTCAGGGGCAGCCGAATAAAATGATCGCCCGTAAACTGGATATCACGGAAAGCACGGTAAAAGTGCATGTGAAAAACCTGATGAAAAAAATGAAGGTAAAATCACGGGTAGAAGCAGCGGTATGGGTGTTGCAGAACAAATAGTACCGGTATCCGGCCTCTCTGTATAAAGGAACAGATTATGATTATTGCAG