Homologs in group_1475

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09505 FBDBKF_09505 91.4 Morganella morganii S1 narL two-component system response regulator NarL
EHELCC_09905 EHELCC_09905 91.4 Morganella morganii S2 narL two-component system response regulator NarL
NLDBIP_19225 NLDBIP_19225 91.4 Morganella morganii S4 narL two-component system response regulator NarL
LHKJJB_19145 LHKJJB_19145 91.4 Morganella morganii S3 narL two-component system response regulator NarL
HKOGLL_18925 HKOGLL_18925 91.4 Morganella morganii S5 narL two-component system response regulator NarL
PMI_RS17750 PMI_RS17750 78.5 Proteus mirabilis HI4320 narL two-component system response regulator NarL

Distribution of the homologs in the orthogroup group_1475

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1475

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AF31 1.5e-96 284 77 0 208 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 1.5e-96 284 77 0 208 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 1.5e-96 284 77 0 208 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 1.5e-96 284 77 0 208 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
P31802 2.91e-57 184 45 1 210 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P44845 3.55e-54 176 43 2 207 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54662 1.54e-40 142 34 2 222 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
O07528 4.46e-40 140 36 3 209 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P13800 5.38e-39 137 32 3 225 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q1M7A0 3.3e-37 132 36 2 194 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P55184 4.19e-37 132 34 2 206 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
Q7A0I0 3.32e-35 127 37 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 3.32e-35 127 37 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 3.32e-35 127 37 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 3.32e-35 127 37 5 208 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 3.32e-35 127 37 5 208 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 3.32e-35 127 37 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WGM5 3.96e-35 127 37 1 205 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 3.96e-35 127 37 1 205 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32197 9.61e-35 126 40 5 205 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P94439 3.22e-31 117 35 2 208 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
P96686 3.96e-31 117 34 4 211 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P9WMF9 3.53e-29 112 31 1 207 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 3.53e-29 112 31 1 207 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P27667 2.78e-28 109 35 2 200 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGA9 4.99e-28 108 36 3 200 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 4.99e-28 108 36 3 200 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 4.99e-28 108 36 3 200 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 4.99e-28 108 36 3 200 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
Q7CQM5 1.3e-27 107 32 2 197 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34723 1.97e-27 107 31 3 199 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
O07019 1.66e-26 104 33 4 202 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
Q5HEP0 3.15e-26 104 37 5 208 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 3.15e-26 104 37 5 208 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CNP9 6.08e-26 103 34 2 206 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 6.08e-26 103 34 2 206 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L7J5 7.59e-26 103 34 2 206 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
Q51373 7.08e-25 100 29 1 206 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49YS9 7.08e-25 100 35 4 211 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7WZY4 9.07e-25 100 28 3 211 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q4L8Q6 1.64e-24 99 29 2 210 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q6GE42 1.66e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 1.66e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
P56644 2.22e-24 99 29 1 204 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
Q7A029 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 3.12e-24 99 29 3 211 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8R3S7 3.23e-24 99 31 0 197 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
Q5HLK6 4.37e-24 99 30 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN75 5.87e-24 98 30 3 212 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0AED6 1.94e-22 94 27 2 198 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 1.94e-22 94 27 2 198 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 1.07e-21 92 26 2 198 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 1.07e-21 92 26 2 198 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P0ACZ7 1.65e-21 91 27 6 209 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 1.65e-21 91 27 6 209 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 1.65e-21 91 27 6 209 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 1.65e-21 91 27 6 209 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
P0A4H2 3.14e-20 88 32 4 198 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 3.14e-20 88 32 4 198 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 3.14e-20 88 32 4 198 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q52376 1.2e-19 87 29 4 209 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P95582 1.3e-19 87 29 4 209 3 gacA Response regulator GacA Pseudomonas viridiflava
P32967 4.29e-19 85 29 4 200 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P24908 2.54e-18 83 29 3 200 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P72781 1.19e-17 82 28 5 228 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P26319 1.97e-17 80 27 5 202 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8R3T0 6.19e-17 79 29 4 215 3 agmR Glycerol metabolism activator Pseudomonas putida
P29369 7.42e-16 77 28 4 215 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AEL8 9.59e-16 76 27 4 202 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 9.59e-16 76 27 4 202 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
Q3LWR6 2.33e-15 75 34 5 154 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 2.33e-15 75 34 5 154 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 2.33e-15 75 34 5 154 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q56312 6.39e-15 72 29 1 116 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8KR08 1.09e-14 73 35 6 151 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P96602 1.81e-14 73 33 0 119 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P14204 9.84e-14 71 28 6 208 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
Q1IQS9 2.7e-13 71 28 4 184 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
Q1XDE4 3.71e-13 69 32 4 171 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P0A4H5 4.08e-13 67 27 1 116 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 4.08e-13 67 27 1 116 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P48359 5.21e-13 68 29 3 163 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
L7N689 5.25e-13 69 31 6 184 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B0R4K1 7.77e-13 66 30 1 101 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P58664 8.22e-13 68 27 3 198 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
Q7CQM8 8.88e-13 68 31 5 200 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HWA4 8.48e-12 66 25 9 263 1 pprB Two-component response regulator PprB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39486 9.69e-12 65 29 0 124 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q1IRH0 1.05e-11 67 35 1 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q5L0L0 1.19e-11 66 33 1 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
P94413 2.67e-11 64 29 6 178 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q2FQU2 4.61e-11 65 36 0 85 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
O69730 6.23e-11 63 30 6 175 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P37640 7.7e-11 62 27 7 207 1 yhjB Putative HTH-type transcriptional regulator YhjB Escherichia coli (strain K12)
P62646 8.01e-11 64 37 0 79 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9K998 8.48e-11 63 30 0 114 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P24072 9.88e-11 60 27 1 114 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P43501 1.29e-10 60 31 3 126 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1D359 1.3e-10 63 30 3 151 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
P10958 1.55e-10 62 27 4 198 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
A1SMR4 2.25e-10 63 30 2 153 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q9KL96 2.31e-10 62 34 3 110 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q15RF6 2.83e-10 62 35 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8DET1 3.07e-10 61 35 2 109 3 VV1_0503 Uncharacterized response regulatory protein VV1_0503 Vibrio vulnificus (strain CMCP6)
Q9WYN9 3.09e-10 62 34 1 102 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0A9Z5 4.39e-10 62 34 4 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9KA55 4.42e-10 62 33 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q46791 4.71e-10 59 30 2 139 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
Q52883 5.19e-10 62 33 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q8ZBV2 5.62e-10 60 27 3 156 3 YPO3287 Uncharacterized response regulatory protein YPO3287/y0902/YP_0397 Yersinia pestis
O85128 6.14e-10 61 33 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9UYF3 6.43e-10 61 32 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
P26487 6.64e-10 60 30 2 152 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q21IQ9 6.82e-10 61 35 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q55890 7.48e-10 60 29 8 222 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8D4U6 7.51e-10 60 28 3 146 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
P9WGM3 7.77e-10 60 27 2 132 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 7.77e-10 60 27 2 132 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P29904 8.01e-10 60 29 6 190 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
Q10WZ6 8.25e-10 61 33 1 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
O83639 1.01e-09 61 42 0 64 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
O58192 1.05e-09 61 31 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q56127 1.07e-09 60 26 3 199 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
Q8F6P9 1.37e-09 60 31 2 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 1.37e-09 60 31 2 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q88EW5 1.37e-09 60 33 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7A0U4 1.44e-09 60 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.44e-09 60 27 9 211 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.44e-09 60 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.44e-09 60 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.44e-09 60 27 9 211 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.44e-09 60 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.44e-09 60 27 9 211 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.44e-09 60 27 9 211 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P26275 1.66e-09 59 29 3 135 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P69410 1.67e-09 59 25 3 199 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 1.67e-09 59 25 3 199 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 1.67e-09 59 25 3 199 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 1.67e-09 59 25 3 199 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 1.67e-09 59 25 3 199 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
P58663 1.77e-09 59 25 3 199 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A4H8 1.85e-09 59 29 7 211 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 1.85e-09 59 29 7 211 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8FZ93 2.16e-09 59 35 2 109 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 2.16e-09 59 35 2 109 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 2.16e-09 59 35 2 109 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 2.16e-09 59 35 2 109 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 2.16e-09 59 35 2 109 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 2.16e-09 59 35 2 109 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 2.16e-09 59 35 2 109 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 2.16e-09 59 35 2 109 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
A6WZ81 2.2e-09 59 35 2 109 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P35163 2.25e-09 59 27 7 217 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P0AFT5 2.29e-09 59 29 2 117 1 btsR Transcriptional regulatory protein BtsR Escherichia coli (strain K12)
P0AFT6 2.29e-09 59 29 2 117 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DUE6 2.29e-09 59 29 2 117 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O157:H7
P0DUE7 2.29e-09 59 29 2 117 4 btsR Transcriptional regulatory protein-like BtsR Enterobacteria phage VT1-Sakai
O52262 2.34e-09 60 33 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudomonas putida
O54294 2.73e-09 58 33 2 111 1 csgD Probable csgAB operon transcriptional regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P59640 2.76e-09 58 29 2 117 3 btsR Transcriptional regulatory protein BtsR Shigella flexneri
P52106 3.01e-09 58 36 3 108 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
Q2ILG8 3.53e-09 59 37 1 95 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8TLG9 3.62e-09 59 28 2 102 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q3KFZ6 3.77e-09 59 33 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain Pf0-1)
Q2KCH8 3.77e-09 59 31 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9KU36 5.78e-09 58 33 2 107 3 VC_0693 Uncharacterized response regulatory protein VC_0693 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P62640 7.42e-09 58 35 1 101 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q87S86 7.64e-09 57 31 3 133 3 VP0538 Uncharacterized response regulatory protein VP0538 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8Z5C1 7.65e-09 57 29 2 117 3 btsR Transcriptional regulatory protein BtsR Salmonella typhi
Q8ZNN2 8.19e-09 57 29 2 117 3 btsR Transcriptional regulatory protein BtsR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Q009 8.2e-09 58 31 3 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P9WGN1 1.02e-08 57 29 7 179 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.02e-08 57 29 7 179 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P51343 1.03e-08 57 30 5 181 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q8XBS3 1.05e-08 57 28 8 207 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q9KT84 1.2e-08 58 37 0 85 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q65JK6 1.3e-08 57 31 2 135 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q39T95 1.31e-08 57 34 2 111 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2LR65 1.52e-08 57 26 3 175 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
Q3SVA1 1.6e-08 57 30 1 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P52931 1.63e-08 56 28 1 118 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q48GG6 2.55e-08 57 32 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3ADA6 2.8e-08 57 31 2 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0AYL3 2.89e-08 57 28 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P38684 3.07e-08 55 33 2 116 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
Q46DT6 3.35e-08 56 30 1 95 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q1CZL0 3.38e-08 56 32 0 91 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Myxococcus xanthus (strain DK1622)
Q24T61 3.5e-08 56 33 1 74 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
P66795 3.5e-08 55 27 9 213 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 3.5e-08 55 27 9 213 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q99U73 3.52e-08 55 28 5 173 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q6LTM2 3.81e-08 56 33 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
Q2SBX9 3.88e-08 56 32 3 107 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Hahella chejuensis (strain KCTC 2396)
Q4ZQV7 4.75e-08 56 32 2 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. syringae (strain B728a)
Q884V3 4.83e-08 56 32 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B8H358 5.32e-08 55 36 0 77 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 5.32e-08 55 36 0 77 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5QZQ3 5.51e-08 56 32 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P52934 5.64e-08 55 30 1 115 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
P23221 5.65e-08 55 27 8 216 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0C001 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 6.09e-08 55 26 4 176 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 6.09e-08 55 26 4 176 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P0ACZ8 6.85e-08 55 29 6 178 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 6.85e-08 55 29 6 178 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 6.85e-08 55 29 6 178 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q1MLG8 7.07e-08 55 30 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9HV32 7.12e-08 54 26 8 210 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58357 7.98e-08 54 33 2 116 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
P06534 8.28e-08 55 27 1 125 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q31S42 8.97e-08 54 36 2 115 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5JF95 9.09e-08 55 30 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q97GZ3 9.49e-08 55 30 1 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O29221 1e-07 55 32 4 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q05522 1.09e-07 55 32 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
O87125 1.11e-07 55 32 2 106 1 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PX96 1.19e-07 55 31 1 95 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P96126 1.33e-07 52 26 2 115 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
Q67P67 1.44e-07 54 32 3 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
P13792 1.49e-07 53 35 0 79 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q1CX06 1.54e-07 54 33 1 110 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Myxococcus xanthus (strain DK1622)
P45709 1.56e-07 52 25 1 112 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q4KG36 1.62e-07 54 31 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P76340 1.67e-07 53 28 8 201 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q8TUQ0 1.7e-07 54 30 1 95 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q49XM7 1.85e-07 53 28 6 173 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P54794 1.9e-07 53 43 1 57 4 moaR Monoamine regulon transcriptional regulator Klebsiella aerogenes
Q93CB8 1.9e-07 53 30 6 176 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q44006 1.98e-07 53 30 2 115 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P39663 1.99e-07 53 26 8 221 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q06065 2.01e-07 54 28 2 117 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P28835 2.1e-07 53 32 3 117 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P9WGM7 2.2e-07 53 30 6 176 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 2.2e-07 53 30 6 176 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 2.2e-07 53 30 6 176 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P11470 2.21e-07 50 43 0 57 1 gerE Spore germination protein GerE Bacillus subtilis (strain 168)
P51586 2.26e-07 52 30 2 118 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
A0QTK2 2.3e-07 53 33 2 107 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O05251 2.69e-07 53 30 0 123 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q7AKE4 3.03e-07 52 26 5 199 1 ramR Response regulator RamR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O34903 3.22e-07 53 29 7 176 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q3ADG9 3.3e-07 53 27 1 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P32040 3.33e-07 53 24 5 223 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9CCJ2 3.56e-07 52 36 1 77 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q2W2W9 4.26e-07 53 32 2 97 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P21866 4.52e-07 52 31 6 180 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P0CL17 4.57e-07 52 26 4 172 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 4.57e-07 52 26 4 172 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q82Z76 4.84e-07 52 27 3 118 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
P36556 4.85e-07 52 26 8 218 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52076 5.45e-07 52 27 8 208 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P59969 5.58e-07 53 42 0 52 4 BQ2027_MB0914C Putative HTH-type transcriptional regulator Mb0914c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG0 5.58e-07 53 42 0 52 4 MT0914 Putative HTH-type transcriptional regulator MT0914 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P42012 6.2e-07 52 25 2 121 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q8EQQ3 6.44e-07 52 24 1 135 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P9WMG1 7.99e-07 53 42 0 52 1 Rv0890c Putative HTH-type transcriptional regulator Rv0890c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZHD3 9.79e-07 51 34 0 88 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P52929 1.06e-06 51 28 1 125 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q4L6C6 1.1e-06 51 29 7 172 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q87MX7 1.11e-06 52 32 0 85 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0C5S5 1.13e-06 52 32 0 85 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.13e-06 52 32 0 85 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q5FQQ0 1.14e-06 52 30 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Gluconobacter oxydans (strain 621H)
Q47I43 1.34e-06 52 31 2 86 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
Q6AJV3 1.39e-06 52 28 5 182 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P52941 1.48e-06 51 27 1 121 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P15940 1.51e-06 51 24 7 212 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8EQW0 1.54e-06 51 28 1 101 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3IDZ3 1.55e-06 51 34 0 63 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas translucida (strain TAC 125)
P23620 1.75e-06 50 27 8 211 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37478 1.79e-06 50 29 4 142 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
O78417 1.81e-06 50 21 4 162 3 ycf29 Probable transcriptional regulator ycf29 Guillardia theta
P0A4I4 2.22e-06 50 25 2 128 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 2.22e-06 50 25 2 128 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0HWY6 2.31e-06 51 29 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-7)
Q0AWZ8 2.31e-06 51 24 5 174 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q7MM78 2.35e-06 51 32 0 85 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 2.35e-06 51 32 0 85 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P30843 2.37e-06 50 29 6 165 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q12PJ3 2.76e-06 50 29 2 108 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q93P00 3e-06 48 31 2 103 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q0HKN5 3.07e-06 50 29 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-4)
Q04942 3.24e-06 50 30 2 105 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2SFK0 3.29e-06 50 31 2 92 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P52928 3.33e-06 50 25 1 118 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q5E3S1 3.39e-06 50 28 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1QI44 3.54e-06 50 28 1 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9K621 3.62e-06 50 30 4 115 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
T2KMF4 3.64e-06 51 29 3 125 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q20YL8 3.89e-06 50 31 1 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodopseudomonas palustris (strain BisB18)
Q8D4X6 4.26e-06 50 29 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
Q7MBQ5 4.39e-06 50 29 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
A1TEL7 4.42e-06 49 30 2 117 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q01473 4.45e-06 50 26 5 172 3 rcaC Protein RcaC Microchaete diplosiphon
P45337 4.77e-06 49 24 4 203 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DPL7 4.82e-06 49 32 2 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 4.82e-06 49 32 2 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 4.82e-06 49 32 2 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
O78428 4.96e-06 49 27 2 120 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q2FMT2 5.15e-06 50 31 1 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q47456 5.2e-06 49 31 0 82 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
Q1CWZ9 5.31e-06 50 34 1 102 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Myxococcus xanthus (strain DK1622)
O34534 5.5e-06 49 23 5 196 1 citT Transcriptional regulatory protein CitT Bacillus subtilis (strain 168)
Q12YX1 6.31e-06 49 27 2 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q2RRX2 6.58e-06 49 35 1 64 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P62636 6.8e-06 49 30 1 102 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q81JL3 7.04e-06 49 28 2 112 3 lytT Sensory transduction protein LytT Bacillus anthracis
Q2RZD2 7.1e-06 49 27 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salinibacter ruber (strain DSM 13855 / M31)
Q2IQS6 7.12e-06 49 30 0 75 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q9I0I1 7.5e-06 48 33 2 112 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52688 7.67e-06 48 29 0 117 1 citB Transcriptional regulatory protein CitB Klebsiella pneumoniae
P94504 7.75e-06 48 27 2 115 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q30ZJ5 8.02e-06 49 31 1 96 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8DB67 8.06e-06 49 31 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain CMCP6)
Q4KHL8 8.31e-06 49 32 0 77 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P52932 8.38e-06 48 26 1 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q7MIQ5 8.6e-06 49 31 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain YJ016)
P51358 8.76e-06 48 30 3 119 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q87MK5 8.82e-06 49 32 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P52940 8.93e-06 49 29 1 120 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
O87717 9.01e-06 49 30 1 72 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q814J1 9.08e-06 48 28 2 112 4 lytT Sensory transduction protein LytT Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8ECD7 9.31e-06 49 28 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7D9K0 9.8e-06 48 27 2 139 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 9.8e-06 48 27 2 139 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q085K9 1.02e-05 49 33 0 60 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shewanella frigidimarina (strain NCIMB 400)
Q2RX18 1.02e-05 49 25 1 116 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P62638 1.06e-05 49 28 3 128 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q0ARY3 1.08e-05 49 36 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Maricaulis maris (strain MCS10)
P0A2D5 1.09e-05 47 31 2 103 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 1.09e-05 47 31 2 103 3 cheY Chemotaxis protein CheY Salmonella typhi
Q7A1J1 1.14e-05 48 26 3 112 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.14e-05 48 26 3 112 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.14e-05 48 26 3 112 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.14e-05 48 26 3 112 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.14e-05 48 26 3 112 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.14e-05 48 26 3 112 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.14e-05 48 26 3 112 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.14e-05 48 26 3 112 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.14e-05 48 26 3 112 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.14e-05 48 26 3 112 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q87K77 1.14e-05 48 29 2 103 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N5N6 1.26e-05 49 43 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio campbellii (strain ATCC BAA-1116)
Q485K0 1.28e-05 48 32 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q87FQ5 1.29e-05 49 43 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1XDC9 1.29e-05 48 30 3 119 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q1MP86 1.33e-05 48 26 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Lawsonia intracellularis (strain PHE/MN1-00)
Q2IT50 1.37e-05 48 30 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain HaA2)
Q50136 1.46e-05 48 27 7 196 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q132U2 1.47e-05 48 30 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain BisB5)
P62637 1.47e-05 48 28 0 64 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P72253 1.48e-05 48 29 1 119 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P0AEV3 1.71e-05 48 30 1 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.71e-05 48 30 1 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.71e-05 48 30 1 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q21G20 2.1e-05 48 33 0 66 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A0A0N8YGA2 2.12e-05 47 39 0 53 2 anoR Transcriptional activator protein AnoR Acinetobacter nosocomialis
Q7MG94 2.13e-05 48 26 3 141 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain YJ016)
Q8D4P3 2.13e-05 48 26 3 141 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain CMCP6)
Q2RKH8 2.38e-05 48 34 0 69 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P48259 2.77e-05 47 29 3 117 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q2WAJ8 3e-05 47 28 2 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q3KHF6 3.05e-05 47 31 0 77 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas fluorescens (strain Pf0-1)
P0AEF7 3.05e-05 47 30 1 123 3 dpiA Transcriptional regulatory protein DpiA Shigella flexneri
P0AEF4 3.05e-05 47 30 1 123 1 dpiA Transcriptional regulatory protein DpiA Escherichia coli (strain K12)
P0AEF5 3.05e-05 47 30 1 123 3 dpiA Transcriptional regulatory protein DpiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEF6 3.05e-05 47 30 1 123 3 dpiA Transcriptional regulatory protein DpiA Escherichia coli O157:H7
Q9KNF3 3.07e-05 48 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q54SP4 3.17e-05 48 24 4 170 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P58253 3.2e-05 47 29 3 123 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8EDD7 3.25e-05 47 26 2 115 3 SO_2823 Uncharacterized response regulatory protein SO_2823 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q886S8 3.25e-05 47 37 0 61 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9I6V9 3.3e-05 47 29 1 105 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P74126 3.33e-05 48 27 3 136 3 sll1879 Ycf55-like protein Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O31517 3.67e-05 47 27 1 118 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
Q53228 3.68e-05 46 28 1 112 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q311M8 4.22e-05 47 30 0 63 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1B3X8 4.4e-05 47 30 3 135 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 4.4e-05 47 30 3 135 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 4.4e-05 47 30 3 135 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P24086 4.63e-05 45 30 2 113 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 4.63e-05 45 30 2 113 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q48F23 4.66e-05 47 35 0 62 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8RAZ3 4.7e-05 47 29 0 82 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1JHZ0 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664J3 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGR4 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pestis (strain Pestoides F)
Q8ZJI2 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pestis
B2K5W2 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2L4 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNW4 4.71e-05 47 45 0 51 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P28257 4.72e-05 47 30 3 117 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q4ZWW3 4.88e-05 47 30 1 96 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. syringae (strain B728a)
P07026 4.89e-05 46 37 1 59 1 sdiA Regulatory protein SdiA Escherichia coli (strain K12)
Q820K0 5.17e-05 47 30 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2YC79 5.34e-05 47 25 0 77 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P0A4I0 5.99e-05 46 33 0 84 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 5.99e-05 46 33 0 84 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P62644 6.11e-05 47 28 1 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P0AE69 6.25e-05 45 29 2 103 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 6.25e-05 45 29 2 103 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 6.25e-05 45 29 2 103 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
B2J4Q8 6.34e-05 47 32 1 96 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P31079 6.43e-05 46 31 3 116 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9FAD7 6.56e-05 45 28 2 103 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q8FGP6 7.03e-05 44 29 2 103 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7N976 7.04e-05 47 43 0 51 3 malT HTH-type transcriptional regulator MalT Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P46384 7.4e-05 44 28 4 118 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28787 7.48e-05 47 25 1 117 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q9KQD8 7.61e-05 46 29 2 108 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9TLQ4 8.26e-05 46 28 3 110 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P52936 8.4e-05 46 28 3 122 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8D0P1 8.47e-05 44 29 2 103 3 cheY Chemotaxis protein CheY Yersinia pestis
Q88MS5 9.48e-05 46 35 0 62 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P45606 9.53e-05 45 25 6 166 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P52938 0.0001 45 25 1 122 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
P45607 0.000103 45 25 6 166 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q98PD1 0.000103 46 33 1 96 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P0AFJ5 0.00011 45 25 6 166 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 0.00011 45 25 6 166 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q9KQD5 0.000114 44 29 3 105 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 0.000114 44 29 3 105 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q49ZT8 0.000115 45 25 7 218 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q54Q69 0.000117 46 29 3 116 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q39S45 0.000119 45 31 0 60 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P0DMK7 0.000129 45 29 2 113 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 0.000129 45 29 2 113 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q4UU97 0.000134 45 28 3 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8P9J7 0.000134 45 28 3 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q06239 0.000136 45 23 6 209 3 vanR Regulatory protein VanR Enterococcus faecium
P0DM78 0.000144 45 27 3 114 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 0.000144 45 27 3 114 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 0.000144 45 27 3 114 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 0.000144 45 27 3 114 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 0.000144 45 27 3 114 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8AQX2 0.000147 46 41 0 51 3 malT HTH-type transcriptional regulator MalT Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8Z7H2 0.000148 45 27 3 114 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q3A5A8 0.000153 45 38 3 71 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6TF41 0.000154 46 43 0 51 3 malT HTH-type transcriptional regulator MalT Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P45605 0.000155 45 23 6 167 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
Q56128 0.000157 46 30 3 133 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P42421 0.000163 45 24 7 166 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P71403 0.000165 43 28 4 114 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
B5XTR7 0.000166 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Klebsiella pneumoniae (strain 342)
Q0VKZ4 0.000175 45 33 1 69 2 alkS HTH-type transcriptional regulator AlkS Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8KLS5 0.000177 45 30 1 92 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Cereibacter sphaeroides
A4WFK6 0.000178 45 41 0 51 3 malT HTH-type transcriptional regulator MalT Enterobacter sp. (strain 638)
P58662 0.000191 45 30 2 117 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGM1 0.000195 45 29 5 154 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 0.000195 45 29 5 154 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 0.000195 45 29 5 154 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q3SIG0 0.000197 45 29 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thiobacillus denitrificans (strain ATCC 25259)
Q46751 0.000199 45 33 1 71 3 carR Transcriptional activator protein CarR Pectobacterium carotovorum subsp. carotovorum
Q3J1W3 0.000201 45 30 1 92 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q39QJ2 0.000202 45 28 2 105 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q52990 0.000203 44 27 6 174 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q04803 0.000224 45 30 4 118 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A7ME76 0.00023 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Cronobacter sakazakii (strain ATCC BAA-894)
Q70FH0 0.000231 44 26 6 176 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P42244 0.000243 44 30 6 153 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q8CQK0 0.000256 44 29 5 143 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 0.000256 44 29 5 143 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1W0A5 0.000281 43 27 3 111 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 0.000281 43 27 3 111 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 0.000281 43 27 3 111 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P45671 0.000283 45 31 2 120 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q9ZM64 0.000294 42 28 5 117 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q2FWH6 0.000335 44 27 6 162 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q1GZZ0 0.000337 44 26 5 145 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q57QC3 0.000366 43 26 3 114 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q51455 0.000372 42 26 2 110 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1KHB7 0.000376 43 30 2 114 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 0.000376 43 30 2 114 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23836 0.000396 43 23 1 113 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q742C1 0.000415 43 30 2 114 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 0.000415 43 30 2 114 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q8XQ83 0.000416 44 28 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9L4M7 0.000417 44 32 1 71 3 alkS HTH-type transcriptional regulator AlkS Pseudomonas putida
Q31HL9 0.000425 44 30 0 63 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8X738 0.000435 43 25 3 114 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q89T55 0.000448 44 26 1 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q83RR0 0.000451 43 25 3 114 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 0.000451 43 25 3 114 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39048 0.000455 44 33 3 74 2 patA Protein PatA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9HUI2 0.00049 43 30 3 112 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10465
Feature type CDS
Gene narL
Product two-component system response regulator NarL
Location 210742 - 211455 (strand: 1)
Length 714 (nucleotides) / 237 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1475
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07684 two-component system, NarL family, nitrate/nitrite response regulator NarL Two-component system -

Protein Sequence

MNNNAAARLSAGEIILSDPDEPGDVSSPATILLIDDHPMLRNGVKQLISLEPSLKVAGEAGNGRDGIALAETLDPDLILLDLNMPDMNGFETLDILRQKSLSGRIVVFSVSNYREDLITALRRGADGYLLKDMEPEELLVALRQAAAGKMVVSPALTEVLAGALREVRSEGEPDINSLTPRERDILRLIAQGQPNKMIARKLDITESTVKVHVKNLMKKMKVKSRVEAAVWVLQQNK

Flanking regions ( +/- flanking 50bp)

GGGCATACAACTATAAAAATAAATGAAGATTATTCAGGAGCAAGGTAAACATGAACAATAATGCAGCGGCACGTCTTTCTGCCGGTGAGATAATATTGAGTGACCCGGATGAGCCGGGCGATGTCTCCTCACCCGCCACTATTTTGCTGATTGATGATCATCCGATGCTGCGCAATGGCGTCAAACAGCTGATAAGCCTGGAGCCGTCACTGAAGGTTGCCGGTGAAGCCGGAAACGGGCGGGATGGGATCGCGCTGGCTGAAACACTCGATCCTGATCTTATCCTGCTGGATCTGAATATGCCGGACATGAACGGCTTTGAAACGCTGGATATTCTGCGGCAAAAATCGCTGTCCGGGCGCATTGTGGTGTTTAGTGTATCCAATTACCGCGAAGATTTGATAACGGCCCTGCGGCGCGGGGCGGATGGATATCTGCTCAAAGATATGGAGCCGGAAGAGTTGCTGGTGGCTCTCAGGCAGGCGGCTGCGGGGAAAATGGTGGTTTCCCCTGCACTGACAGAAGTGCTGGCGGGCGCACTGCGGGAAGTGCGCAGTGAGGGGGAGCCGGATATAAACAGTCTGACACCGCGTGAGCGCGATATTCTCAGGCTGATAGCGCAGGGGCAGCCGAATAAAATGATCGCCCGCAAGCTGGATATTACGGAGAGTACTGTAAAAGTACATGTGAAGAATCTGATGAAAAAGATGAAAGTGAAGTCGAGGGTGGAAGCGGCTGTGTGGGTGTTGCAGCAGAACAAATGATTTTGCGGAAGATTCTTTGTTTTTAGGCGCAGTACTTTGCTGTTATATAT