Homologs in group_1475

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09505 FBDBKF_09505 75.6 Morganella morganii S1 narL two-component system response regulator NarL
EHELCC_09905 EHELCC_09905 75.6 Morganella morganii S2 narL two-component system response regulator NarL
NLDBIP_19225 NLDBIP_19225 75.6 Morganella morganii S4 narL two-component system response regulator NarL
LHKJJB_19145 LHKJJB_19145 75.6 Morganella morganii S3 narL two-component system response regulator NarL
HKOGLL_18925 HKOGLL_18925 75.6 Morganella morganii S5 narL two-component system response regulator NarL
F4V73_RS10465 F4V73_RS10465 78.5 Morganella psychrotolerans narL two-component system response regulator NarL

Distribution of the homologs in the orthogroup group_1475

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1475

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AF31 3.12e-100 292 77 0 211 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 3.12e-100 292 77 0 211 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 3.12e-100 292 77 0 211 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 3.12e-100 292 77 0 211 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
P31802 4.9e-56 180 46 1 206 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P44845 2.89e-55 178 43 1 209 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54662 2.91e-39 138 35 3 226 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P13800 6.35e-39 137 34 2 224 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P55184 1.96e-37 132 34 2 207 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
O07528 8.92e-37 131 35 1 201 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P96686 1.37e-34 125 35 3 206 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P9WGM5 3.67e-34 124 36 2 210 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 3.67e-34 124 36 2 210 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32197 5.62e-34 124 37 3 208 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
Q1M7A0 1.67e-31 117 34 1 197 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P94439 2.18e-30 114 34 3 211 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
Q7A0I0 3.67e-29 111 33 5 207 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 3.67e-29 111 33 5 207 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 3.67e-29 111 33 5 207 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 3.67e-29 111 33 5 207 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 3.67e-29 111 33 5 207 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 3.67e-29 111 33 5 207 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7CQM5 8.98e-28 107 33 3 200 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WMF9 1.09e-27 107 32 1 204 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 1.09e-27 107 32 1 204 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6GE42 1.9e-27 107 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 1.9e-27 107 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A029 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 2.59e-27 106 30 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HLK6 8.43e-27 105 31 2 213 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7WZY4 1.01e-26 105 28 2 212 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q8CN75 1.22e-26 105 31 2 213 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q51373 8.37e-26 102 32 2 201 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P27667 3.43e-25 100 35 4 200 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4L8Q6 6.87e-25 100 29 2 212 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
O34723 8.99e-25 99 29 2 198 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
P0AGA9 2.87e-24 98 34 4 200 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 2.87e-24 98 34 4 200 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 2.87e-24 98 34 4 200 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 2.87e-24 98 34 4 200 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
O07019 5.77e-24 97 29 1 199 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
A8R3S7 1.29e-23 97 30 0 198 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
P0A4H2 1.73e-23 96 33 3 199 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 1.73e-23 96 33 3 199 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 1.73e-23 96 33 3 199 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0ACZ7 3.13e-22 93 27 5 209 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 3.13e-22 93 27 5 209 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 3.13e-22 93 27 5 209 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 3.13e-22 93 27 5 209 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
Q5HEP0 1.08e-21 91 33 5 207 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 1.08e-21 91 33 5 207 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
P95582 2.19e-21 91 30 2 201 3 gacA Response regulator GacA Pseudomonas viridiflava
Q52376 4.43e-21 90 29 2 201 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P56644 1.29e-20 89 29 3 209 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
Q8CNP9 2.48e-20 88 32 2 205 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 2.48e-20 88 32 2 205 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L7J5 2.61e-20 88 32 2 205 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
Q49YS9 2.87e-20 88 31 2 205 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P66797 7.03e-20 87 26 1 198 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 7.03e-20 87 26 1 198 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P0AED6 7.89e-20 87 26 1 198 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 7.89e-20 87 26 1 198 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P32967 1.61e-19 86 28 1 198 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P24908 8.61e-19 84 31 4 198 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4H5 3.62e-17 77 31 1 116 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 3.62e-17 77 31 1 116 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A8R3T0 9.39e-17 79 28 3 214 3 agmR Glycerol metabolism activator Pseudomonas putida
P26319 1.3e-16 78 26 3 200 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14204 3.21e-16 77 27 3 200 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
Q1XDE4 4.68e-16 77 29 6 200 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P29369 7.23e-16 76 28 3 214 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AEL8 1.04e-15 75 27 4 203 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.04e-15 75 27 4 203 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
P72781 1.98e-15 75 28 6 229 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P48359 4.54e-15 74 28 5 208 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P39486 1.13e-14 73 25 2 208 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P96602 1.73e-14 72 34 0 114 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q8KR08 9.69e-14 70 32 4 158 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q3LWR6 1.62e-13 70 27 6 204 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.62e-13 70 27 6 204 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.62e-13 70 27 6 204 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P15940 6.09e-13 68 26 7 212 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8DET1 6.15e-13 68 37 2 115 3 VV1_0503 Uncharacterized response regulatory protein VV1_0503 Vibrio vulnificus (strain CMCP6)
B0R4K1 6.17e-13 66 27 1 112 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q56312 7.29e-13 66 28 1 116 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9K998 1.69e-12 67 34 0 114 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P26487 1.99e-12 67 32 3 153 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P24072 2.94e-12 64 29 1 114 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q55890 3.15e-12 67 30 7 219 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1IQS9 4.48e-12 67 33 2 129 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
Q56127 7.05e-12 65 27 3 211 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
Q52883 1.18e-11 66 36 1 98 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
P69410 1.25e-11 65 26 3 211 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 1.25e-11 65 26 3 211 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 1.25e-11 65 26 3 211 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 1.25e-11 65 26 3 211 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 1.25e-11 65 26 3 211 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
P58663 1.26e-11 65 26 3 211 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q31S42 3.61e-11 64 28 7 224 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P51343 5.08e-11 63 30 8 201 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q7CQM8 5.27e-11 63 30 6 203 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0QTK2 5.55e-11 63 38 2 107 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8D4U6 7.22e-11 63 31 4 130 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
P9WGN1 7.3e-11 63 30 6 179 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 7.3e-11 63 30 6 179 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O58192 7.47e-11 64 30 3 130 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P94413 9.77e-11 62 26 4 176 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q87S86 1.09e-10 62 36 2 115 3 VP0538 Uncharacterized response regulatory protein VP0538 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KU36 1.42e-10 62 35 2 107 3 VC_0693 Uncharacterized response regulatory protein VC_0693 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P23221 1.42e-10 62 26 6 210 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O85128 1.47e-10 63 34 1 98 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
P29904 1.66e-10 62 29 5 191 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
Q54SP4 2.76e-10 63 28 4 173 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P28835 2.76e-10 61 34 3 120 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q93CB8 3.8e-10 60 40 3 97 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9CCJ2 4.24e-10 60 40 3 97 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P9WGM7 4.26e-10 60 40 3 97 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 4.26e-10 60 40 3 97 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 4.26e-10 60 40 3 97 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P52940 4.62e-10 61 33 1 119 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q9UYF3 5.38e-10 61 31 3 132 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q2KCH8 6.27e-10 61 32 1 98 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8FZ93 7.15e-10 60 34 2 113 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 7.15e-10 60 34 2 113 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 7.15e-10 60 34 2 113 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 7.15e-10 60 34 2 113 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 7.15e-10 60 34 2 113 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 7.15e-10 60 34 2 113 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 7.15e-10 60 34 2 113 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 7.15e-10 60 34 2 113 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
A6WZ81 7.44e-10 60 34 2 113 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P26275 8.06e-10 60 31 3 129 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFT5 8.82e-10 60 28 2 117 1 btsR Transcriptional regulatory protein BtsR Escherichia coli (strain K12)
P0AFT6 8.82e-10 60 28 2 117 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DUE6 8.82e-10 60 28 2 117 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O157:H7
P0DUE7 8.82e-10 60 28 2 117 4 btsR Transcriptional regulatory protein-like BtsR Enterobacteria phage VT1-Sakai
P59640 1.07e-09 60 28 2 117 3 btsR Transcriptional regulatory protein BtsR Shigella flexneri
P10958 1.08e-09 59 24 2 195 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
P35163 1.13e-09 59 25 7 214 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q1IRH0 1.38e-09 60 31 1 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
P58664 1.46e-09 59 26 3 202 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
Q9KL96 1.51e-09 59 31 3 116 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P43501 1.54e-09 57 30 3 126 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04942 1.6e-09 59 34 2 114 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P45709 1.62e-09 57 25 1 114 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
O78417 1.79e-09 58 23 2 163 3 ycf29 Probable transcriptional regulator ycf29 Guillardia theta
Q167K9 2.32e-09 59 31 5 149 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1D359 2.92e-09 59 32 2 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
P0A4H8 3.24e-09 58 29 4 204 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 3.24e-09 58 29 4 204 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7MBQ5 4.39e-09 58 32 1 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
Q8D4X6 4.81e-09 58 32 1 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
O05251 4.82e-09 58 32 0 124 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q8F6P9 5.46e-09 58 30 2 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 5.46e-09 58 30 2 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P76340 6.26e-09 57 29 6 203 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q88EW5 6.29e-09 58 33 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P9WGM3 6.53e-09 57 30 2 115 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 6.53e-09 57 30 2 115 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q0A9Z5 6.76e-09 58 32 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1CX06 6.98e-09 58 42 0 66 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Myxococcus xanthus (strain DK1622)
P13792 7.46e-09 57 33 0 96 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q2SBX9 7.76e-09 58 33 2 106 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Hahella chejuensis (strain KCTC 2396)
P37478 8.17e-09 57 33 1 95 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P52938 8.56e-09 57 25 4 172 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
P59969 9.17e-09 58 41 0 68 4 BQ2027_MB0914C Putative HTH-type transcriptional regulator Mb0914c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG0 9.17e-09 58 41 0 68 4 MT0914 Putative HTH-type transcriptional regulator MT0914 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8EQQ3 9.18e-09 57 27 0 117 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8Z5C1 9.44e-09 57 27 1 108 3 btsR Transcriptional regulatory protein BtsR Salmonella typhi
Q0ARY3 9.46e-09 58 39 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Maricaulis maris (strain MCS10)
O52262 9.77e-09 57 33 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudomonas putida
P9WMG1 9.97e-09 58 41 0 68 1 Rv0890c Putative HTH-type transcriptional regulator Rv0890c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8ZNN2 1.01e-08 57 27 1 108 3 btsR Transcriptional regulatory protein BtsR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q44006 1.03e-08 57 30 2 115 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5QZQ3 1.3e-08 57 32 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9WYN9 1.3e-08 57 33 2 103 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q50136 1.53e-08 56 28 5 187 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q65JK6 1.58e-08 57 30 2 135 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
L7N689 1.62e-08 56 31 1 113 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B8H358 1.74e-08 56 38 0 78 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 1.74e-08 56 38 0 78 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2ILG8 1.78e-08 57 38 1 95 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3ADA6 1.88e-08 57 31 1 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9I0I1 1.9e-08 56 30 7 205 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HV32 1.92e-08 56 25 5 204 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZBV2 1.96e-08 56 27 2 112 3 YPO3287 Uncharacterized response regulatory protein YPO3287/y0902/YP_0397 Yersinia pestis
Q2FQU2 2.13e-08 57 34 0 82 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q0AYL3 2.22e-08 57 28 2 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1MLG8 2.37e-08 56 31 1 98 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P52929 2.43e-08 55 28 1 125 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q15RF6 2.45e-08 56 31 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2LR65 2.67e-08 56 28 4 162 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
Q9KA55 2.69e-08 56 33 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5L0L0 2.84e-08 56 30 1 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
P9WGM1 3.5e-08 55 30 3 146 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 3.5e-08 55 30 3 146 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 3.5e-08 55 30 3 146 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P58253 3.57e-08 55 35 3 108 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O78428 4.13e-08 55 30 2 116 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q10WZ6 4.62e-08 55 33 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P62638 4.63e-08 55 32 3 131 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
O34903 4.79e-08 55 28 8 210 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P23620 4.84e-08 55 27 5 206 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47I43 4.96e-08 55 33 1 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
Q67P67 5.18e-08 55 33 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
P45606 5.28e-08 55 27 6 208 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0AFJ5 5.33e-08 55 27 6 208 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 5.33e-08 55 27 6 208 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q6LTM2 5.4e-08 55 31 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
Q39T95 5.46e-08 55 32 2 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q4KG36 6.37e-08 55 32 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q99U73 6.42e-08 54 27 5 178 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q8L9Y3 6.9e-08 55 29 2 119 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
A0PWB4 6.91e-08 54 31 1 113 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1SMR4 7.52e-08 55 33 1 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q48GG6 7.64e-08 55 31 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3KFZ6 8.12e-08 55 32 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain Pf0-1)
Q87K77 8.25e-08 54 33 3 103 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P45607 8.42e-08 54 33 2 115 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
O87717 8.85e-08 55 28 2 148 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O69730 9.22e-08 54 29 1 110 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7AKE4 9.29e-08 53 27 4 198 1 ramR Response regulator RamR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7D9K0 9.47e-08 54 30 3 141 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 9.47e-08 54 30 3 141 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9CD68 9.56e-08 54 31 1 113 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q9KQD5 1.02e-07 52 31 3 105 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.02e-07 52 31 3 105 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q1B3X8 1.03e-07 54 32 2 131 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.03e-07 54 32 2 131 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.03e-07 54 32 2 131 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q0HWY6 1.06e-07 55 31 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-7)
Q1MP86 1.1e-07 54 33 0 63 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Lawsonia intracellularis (strain PHE/MN1-00)
P0C001 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 1.17e-07 53 25 4 177 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 1.17e-07 53 25 4 177 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q2FMT2 1.3e-07 54 33 2 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q0HKN5 1.36e-07 54 31 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-4)
P37640 1.46e-07 53 24 5 207 1 yhjB Putative HTH-type transcriptional regulator YhjB Escherichia coli (strain K12)
Q884V3 1.46e-07 54 31 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5JF95 1.49e-07 54 27 2 129 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P52076 1.59e-07 53 26 8 217 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P0CL17 1.64e-07 53 27 3 157 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.64e-07 53 27 3 157 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q4ZQV7 1.67e-07 54 31 2 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. syringae (strain B728a)
P48259 1.82e-07 53 29 4 135 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q9HV27 1.84e-07 54 33 3 128 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62640 1.85e-07 54 31 1 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q1CZL0 1.85e-07 54 39 1 79 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Myxococcus xanthus (strain DK1622)
P0AEV3 2.05e-07 53 29 4 163 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 2.05e-07 53 29 4 163 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 2.05e-07 53 29 4 163 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q51455 2.13e-07 51 30 3 112 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1KHB7 2.15e-07 53 31 1 113 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 2.15e-07 53 31 1 113 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0DMK7 2.18e-07 53 29 2 114 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 2.18e-07 53 29 2 114 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q742C1 2.18e-07 53 31 1 113 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.18e-07 53 31 1 113 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P28257 2.5e-07 53 29 4 142 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q3IDZ3 2.54e-07 53 33 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas translucida (strain TAC 125)
Q8XBS3 2.61e-07 52 26 8 217 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P51358 2.64e-07 53 30 3 122 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1CWZ9 2.72e-07 53 37 1 96 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Myxococcus xanthus (strain DK1622)
O54294 2.75e-07 52 30 2 110 1 csgD Probable csgAB operon transcriptional regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4KHL8 2.76e-07 53 36 0 77 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
T2KMF4 2.88e-07 53 30 2 126 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
O87125 3.04e-07 53 32 2 106 1 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P66795 3.2e-07 52 26 8 213 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 3.2e-07 52 26 8 213 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q8TLG9 3.26e-07 53 28 2 102 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P9WGM9 3.36e-07 52 31 1 113 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 3.36e-07 52 31 1 113 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 3.36e-07 52 31 1 113 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q1XDC9 3.7e-07 52 30 3 122 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P52931 3.71e-07 52 23 1 121 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
E0X9C7 4.39e-07 53 28 3 158 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q3SIG0 4.54e-07 53 31 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thiobacillus denitrificans (strain ATCC 25259)
Q8RAZ3 4.54e-07 53 32 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5GYV8 4.6e-07 53 30 2 130 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P1V8 4.6e-07 53 30 2 130 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q0HIF6 5.03e-07 52 27 4 150 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
A0R3I8 5.18e-07 52 31 1 113 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P06534 5.22e-07 52 25 1 129 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q8KIY1 5.38e-07 53 27 3 158 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P69228 5.42e-07 52 25 5 217 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 5.42e-07 52 25 5 217 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q4UU97 5.54e-07 52 30 2 130 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8P9J7 5.54e-07 52 30 2 130 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P52941 5.67e-07 52 25 6 208 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q7A0U4 6.01e-07 52 25 7 210 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 6.01e-07 52 25 7 210 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 6.01e-07 52 25 7 210 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 6.01e-07 52 25 7 210 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 6.01e-07 52 25 7 210 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 6.01e-07 52 25 7 210 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 6.01e-07 52 25 7 210 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 6.01e-07 52 25 7 210 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
A5W4E3 6.08e-07 53 28 3 158 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3BUA2 6.26e-07 52 30 2 130 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PLB4 6.26e-07 52 30 2 130 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas axonopodis pv. citri (strain 306)
Q01473 6.32e-07 52 23 4 203 3 rcaC Protein RcaC Microchaete diplosiphon
P45605 6.41e-07 52 27 7 209 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
Q04803 6.49e-07 52 33 2 108 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q820K0 6.81e-07 52 31 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q39QJ2 7.39e-07 52 29 4 142 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2SFK0 7.49e-07 52 28 2 92 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q9KT84 7.59e-07 52 32 1 99 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1TEL7 7.74e-07 51 32 1 113 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P42421 9.33e-07 51 24 6 210 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q9F868 9.9e-07 51 30 2 114 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q30ZJ5 1e-06 52 39 0 66 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q49XM7 1.06e-06 51 36 1 82 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P38684 1.1e-06 51 31 2 113 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
Q21IQ9 1.13e-06 52 33 3 108 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9HUI2 1.19e-06 51 31 5 132 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62636 1.2e-06 51 31 1 102 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O31517 1.22e-06 51 25 1 115 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
O83639 1.24e-06 51 30 2 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q9I4F9 1.49e-06 50 30 2 119 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58357 1.59e-06 50 31 2 113 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q8ECD7 1.69e-06 51 29 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q46791 1.72e-06 49 28 2 140 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
P62637 1.74e-06 51 26 1 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9WY30 1.74e-06 51 32 5 104 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0HVI0 1.84e-06 51 26 4 150 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
P45785 1.91e-06 50 39 1 81 4 None Putative HTH-type transcriptional regulator in exeN 3'region (Fragment) Aeromonas salmonicida
Q9HWA4 2.04e-06 50 22 7 253 1 pprB Two-component response regulator PprB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L6C6 2.17e-06 50 27 6 174 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q3ADG9 2.17e-06 50 29 1 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2YC79 2.41e-06 50 28 1 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P52106 2.42e-06 50 30 2 109 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
Q21G20 2.42e-06 50 29 1 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1D225 2.6e-06 50 34 0 69 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Myxococcus xanthus (strain DK1622)
Q12PJ3 2.65e-06 50 34 0 66 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7N5T1 2.9e-06 50 27 4 148 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q05522 2.91e-06 50 30 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
Q8DB67 2.94e-06 50 30 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain CMCP6)
P62647 2.95e-06 50 28 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q4LAJ9 3e-06 50 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q7MIQ5 3.05e-06 50 30 2 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain YJ016)
Q7A7X9 3.19e-06 50 24 2 109 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain N315)
Q99X00 3.19e-06 50 24 2 109 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P94504 3.3e-06 50 28 3 118 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q46PH7 3.31e-06 50 29 1 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P36556 3.59e-06 49 25 6 211 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P31079 3.63e-06 49 30 2 114 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8XQ83 4.1e-06 50 31 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8PX96 4.21e-06 50 29 1 95 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P06628 4.25e-06 47 25 1 114 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P0A9Q4 4.38e-06 49 30 2 108 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 4.38e-06 49 30 2 108 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 4.38e-06 49 30 2 108 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 4.38e-06 49 30 2 108 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
Q53228 4.6e-06 48 28 2 140 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P45337 4.94e-06 49 25 5 203 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P62646 4.97e-06 50 31 0 79 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7A216 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 4.98e-06 49 33 1 84 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 4.98e-06 49 33 1 84 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 4.98e-06 49 33 1 84 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 4.98e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CQK0 5.23e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 5.23e-06 49 33 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q82Z76 5.32e-06 49 26 3 117 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
Q2RZD2 5.5e-06 49 28 1 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salinibacter ruber (strain DSM 13855 / M31)
Q24T61 5.97e-06 49 28 2 98 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
Q8EDD7 5.97e-06 49 26 2 115 3 SO_2823 Uncharacterized response regulatory protein SO_2823 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q44929 6.08e-06 49 28 2 114 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P42012 6.11e-06 49 22 2 149 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q97GZ3 6.35e-06 49 29 1 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2T8Y6 6.44e-06 49 31 1 96 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P52928 6.62e-06 49 24 2 125 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q2W2W9 6.7e-06 49 28 1 98 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P45189 6.93e-06 48 28 3 115 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39663 7.24e-06 48 24 6 227 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P54794 7.35e-06 48 40 1 57 4 moaR Monoamine regulon transcriptional regulator Klebsiella aerogenes
Q2T8Y5 7.41e-06 49 31 1 102 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q88AQ2 7.62e-06 49 29 2 123 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0A2D5 7.73e-06 47 31 3 110 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 7.73e-06 47 31 3 110 3 cheY Chemotaxis protein CheY Salmonella typhi
P71403 8.12e-06 47 30 3 111 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q8Q009 8.32e-06 49 27 2 102 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9ZM64 8.62e-06 47 30 3 111 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P0A4I4 9.2e-06 48 24 2 132 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 9.2e-06 48 24 2 132 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8NYJ9 9.74e-06 48 23 2 109 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 9.74e-06 48 23 2 109 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 9.74e-06 48 23 2 109 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2G1E1 9.74e-06 48 23 2 109 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 9.74e-06 48 23 2 109 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
Q5FQQ0 1.02e-05 48 30 1 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Gluconobacter oxydans (strain 621H)
Q2YV56 1.02e-05 48 23 2 109 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q46DT6 1.03e-05 48 28 1 95 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q9TLQ4 1.04e-05 48 29 4 117 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
O06978 1.05e-05 48 33 4 89 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q6GK93 1.06e-05 48 23 2 109 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
Q31HL9 1.22e-05 48 30 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q63PS2 1.22e-05 48 28 1 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain K96243)
Q0AWZ8 1.23e-05 48 37 0 66 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2IQS6 1.37e-05 48 32 0 77 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3KHF6 1.4e-05 48 32 0 77 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas fluorescens (strain Pf0-1)
Q1BRL2 1.42e-05 48 29 1 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
Q39S45 1.43e-05 48 36 0 60 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P24086 1.5e-05 46 35 1 91 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 1.5e-05 46 35 1 91 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q12YX1 1.52e-05 48 27 2 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q5E3S1 1.53e-05 48 29 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q06065 1.65e-05 48 25 1 108 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q4A160 1.67e-05 47 32 1 84 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q02540 1.71e-05 47 25 4 158 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q1LH11 1.72e-05 48 29 1 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P52936 1.76e-05 48 31 2 111 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q93P00 1.76e-05 46 30 2 103 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q2IQR9 1.86e-05 48 37 0 81 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8TUQ0 1.9e-05 48 29 1 95 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P23747 1.93e-05 48 30 2 118 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88RJ6 1.96e-05 48 29 2 119 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P37740 2e-05 47 26 5 208 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q2KCH7 2.09e-05 46 29 3 127 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KV65 2.11e-05 48 32 1 96 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Bordetella avium (strain 197N)
Q06239 2.25e-05 47 24 6 209 3 vanR Regulatory protein VanR Enterococcus faecium
Q085K9 2.48e-05 47 30 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shewanella frigidimarina (strain NCIMB 400)
P54884 2.91e-05 46 36 1 68 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
Q9APD9 2.96e-05 47 32 2 104 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q5HKE0 3e-05 47 33 1 60 3 SERP2406 Uncharacterized response regulatory protein SERP2406 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q39KQ1 3.08e-05 47 28 1 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9ZWS6 3.08e-05 46 30 3 116 1 ARR6 Two-component response regulator ARR6 Arabidopsis thaliana
Q9I6V9 3.12e-05 47 30 1 103 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1GZZ0 3.21e-05 47 25 3 139 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P46384 3.27e-05 45 28 4 141 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P21866 3.38e-05 47 34 2 116 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q13SY2 3.46e-05 47 29 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
A0A4P7TS68 3.51e-05 47 30 2 120 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 3.51e-05 47 30 2 120 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 3.51e-05 47 30 2 120 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 3.51e-05 47 30 2 120 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 3.51e-05 47 30 2 120 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 3.51e-05 47 30 2 120 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 3.51e-05 47 30 2 120 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 3.51e-05 47 30 2 120 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P0C0F6 3.54e-05 47 29 4 146 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q2RRX2 3.67e-05 47 29 2 102 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P0ACZ8 3.88e-05 46 34 0 88 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 3.88e-05 46 34 0 88 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 3.88e-05 46 34 0 88 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q52990 3.91e-05 46 27 5 172 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
P0C0F7 4.29e-05 47 29 4 146 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q87MK5 4.58e-05 47 30 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3IRR4 4.74e-05 47 30 5 123 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P0AE69 4.84e-05 45 30 3 110 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 4.84e-05 45 30 3 110 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 4.84e-05 45 30 3 110 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P96126 4.86e-05 45 26 2 111 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
A7N5N6 4.89e-05 47 39 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio campbellii (strain ATCC BAA-1116)
Q2SPQ1 5.1e-05 47 33 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
Q888V8 5.13e-05 47 28 5 150 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P52934 5.16e-05 46 25 1 115 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q8EF61 5.17e-05 47 28 2 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8EQW0 5.42e-05 46 27 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q07597 5.52e-05 46 31 3 129 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
Q87FQ5 5.77e-05 47 39 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9I4N3 5.78e-05 47 27 1 131 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZHD3 6.09e-05 46 30 0 88 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P9WGL9 6.17e-05 46 28 2 114 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 6.17e-05 46 28 2 114 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 6.17e-05 46 28 2 114 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P44918 6.31e-05 46 30 2 108 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A7N6S2 6.35e-05 47 36 1 71 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q485K0 6.35e-05 46 32 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1W0A5 6.43e-05 44 29 4 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 6.43e-05 44 29 4 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 6.43e-05 44 29 4 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9FAD7 6.77e-05 44 30 3 110 3 cheY Chemotaxis protein CheY Enterobacter cloacae
O29221 7.06e-05 46 26 8 225 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6AJV3 7.42e-05 46 29 7 160 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfotalea psychrophila (strain LSv54 / DSM 12343)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17750
Feature type CDS
Gene narL
Product two-component system response regulator NarL
Location 3895035 - 3895697 (strand: -1)
Length 663 (nucleotides) / 220 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1475
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07684 two-component system, NarL family, nitrate/nitrite response regulator NarL Two-component system -

Protein Sequence

MNNMGAVADKATILLIDDHPMLRNGVKQLLSLDTTLTVVGEAGDGIQGVKLAEELDPDLILLDLNMPGMNGFETLDQLRLRSLSGRIVVFSVSNYSDDLITALKRGADGYLLKDMEPEELLAALKQAAAGKMVVSPTLTPILAQSLREDRSESERDIDQLTPRERDILKLIAQELSNKMIARKLDITESTVKVHVKHLLKKMKLKSRVEVAVWVHQQRVD

Flanking regions ( +/- flanking 50bp)

TCCGTTAATCACTACCCATAAAGATCCTATCGAAAAGGGAGCAAATCATAATGAATAATATGGGAGCAGTCGCAGACAAAGCGACTATTTTATTAATTGATGATCACCCGATGTTACGCAATGGTGTGAAACAACTTTTAAGTCTTGATACAACATTAACTGTCGTTGGTGAAGCTGGCGATGGTATTCAAGGGGTAAAATTAGCTGAAGAGTTAGATCCTGATTTAATCCTACTCGATCTCAATATGCCGGGTATGAATGGTTTTGAAACACTCGATCAATTGCGATTACGATCGCTCTCTGGGCGGATCGTTGTGTTTAGTGTATCAAACTACAGTGATGATCTGATCACCGCCTTAAAACGAGGAGCGGATGGCTATCTCTTAAAAGACATGGAGCCAGAAGAGCTATTAGCCGCTTTAAAACAAGCAGCCGCAGGGAAAATGGTGGTTAGCCCAACATTAACCCCCATTTTAGCGCAGTCACTGCGAGAAGATCGTTCTGAAAGTGAGCGGGATATAGACCAACTCACCCCACGAGAGCGCGATATTTTAAAGCTGATAGCACAAGAGCTATCCAATAAGATGATCGCACGTAAACTCGATATTACTGAAAGTACCGTTAAAGTACATGTCAAACATCTACTCAAAAAGATGAAATTAAAATCTCGTGTTGAAGTCGCGGTTTGGGTTCATCAACAACGTGTGGATTAATCAAAATTGGGCACAATGGGTTGGTGAATATTCATTAACTCCACCAATTC