Homologs in group_281

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09040 FBDBKF_09040 100.0 Morganella morganii S1 fimA Pilin (type 1 fimbrial protein)
EHELCC_10370 EHELCC_10370 100.0 Morganella morganii S2 fimA Pilin (type 1 fimbrial protein)
NLDBIP_10715 NLDBIP_10715 100.0 Morganella morganii S4 fimA Pilin (type 1 fimbrial protein)
HKOGLL_13700 HKOGLL_13700 100.0 Morganella morganii S5 fimA Pilin (type 1 fimbrial protein)
F4V73_RS10930 F4V73_RS10930 78.9 Morganella psychrotolerans - type 1 fimbrial protein
PMI_RS01280 PMI_RS01280 50.8 Proteus mirabilis HI4320 mrpB MR/P fimbria assembly terminator MrpB
PMI_RS10950 PMI_RS10950 24.7 Proteus mirabilis HI4320 - fimbrial protein

Distribution of the homologs in the orthogroup group_281

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_281

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P42185 3.86e-22 91 33 1 150 3 prsH PRS fimbrial minor pilin protein Escherichia coli
P07111 5.91e-22 90 33 1 150 1 papH PAP fimbrial minor pilin protein Escherichia coli
Q03011 7.49e-09 55 27 3 154 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P13421 1.16e-06 49 26 4 180 1 smfA Fimbria A protein Serratia marcescens
Q8X5K5 4.78e-05 45 25 3 155 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P43660 6.67e-05 45 26 6 158 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X582 9.41e-05 44 25 9 189 1 elfA Laminin-binding fimbrial subunit ElfA Escherichia coli O157:H7
P77789 0.000104 44 29 7 158 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
P75855 0.000146 43 25 9 189 1 elfA Fimbrial subunit ElfA Escherichia coli (strain K12)
P12730 0.000659 42 28 1 81 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P04740 0.000678 42 24 8 194 3 KS71A KS71A fimbrillin Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_10640
Feature type CDS
Gene fimA
Product Pilin (type 1 fimbrial protein)
Location 90441 - 90998 (strand: -1)
Length 558 (nucleotides) / 185 (amino acids)
In genomic island -

Contig

Accession ZDB_367
Length 191445 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_281
Orthogroup size 8
N. genomes 7

Actions

Genomic region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Protein Sequence

MVSRIIPQGVLITIVCFSSYTAAGETKQDAKTSLRFGAVQMQGTILEPVCTISTASREQAVALTDVSVPQLRDEGQGPADYFWIRLAECTVQPVKGGAADNLRFRVTFEGAEQDGRFQLTGSGKGASLSISDRNGNEAVPGKPLPPADIDLNNMALRYQARLVKNSDELQSGYYRATVGFKLEYY

Flanking regions ( +/- flanking 50bp)

GGGATGAACCGTGCCGCTTTTCAGTTGCGTGCGTTCAGCGGAGGCAGGAAATGGTGAGCAGAATCATCCCTCAGGGAGTGCTGATAACAATAGTGTGTTTTTCCTCTTATACAGCGGCAGGTGAAACGAAACAGGATGCAAAAACCAGTCTGCGTTTCGGTGCGGTACAGATGCAGGGCACGATCCTCGAGCCGGTCTGCACTATTTCCACCGCCAGCCGTGAGCAGGCCGTGGCGCTGACCGATGTTTCTGTTCCGCAGTTGCGTGATGAAGGGCAGGGACCCGCAGACTACTTCTGGATCAGGCTGGCGGAATGCACCGTGCAGCCGGTGAAAGGCGGTGCGGCGGATAATCTCCGTTTCCGGGTCACGTTTGAGGGGGCTGAACAGGACGGACGTTTTCAGCTGACCGGCTCCGGCAAAGGGGCTTCCTTATCGATTTCAGACCGCAACGGGAATGAGGCGGTTCCCGGCAAACCCTTACCGCCCGCAGATATTGATCTCAATAATATGGCGCTGCGATATCAGGCGCGTCTCGTGAAAAACAGTGATGAACTTCAGTCCGGTTATTACCGGGCAACAGTGGGTTTCAAGCTGGAATATTATTAAACCGAGCTGACTGGATCCATTATGGTAATTCCGCTGAGTACCGTCTCCCG