Homologs in group_281

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09040 FBDBKF_09040 78.9 Morganella morganii S1 fimA Pilin (type 1 fimbrial protein)
EHELCC_10370 EHELCC_10370 78.9 Morganella morganii S2 fimA Pilin (type 1 fimbrial protein)
NLDBIP_10715 NLDBIP_10715 78.9 Morganella morganii S4 fimA Pilin (type 1 fimbrial protein)
LHKJJB_10640 LHKJJB_10640 78.9 Morganella morganii S3 fimA Pilin (type 1 fimbrial protein)
HKOGLL_13700 HKOGLL_13700 78.9 Morganella morganii S5 fimA Pilin (type 1 fimbrial protein)
PMI_RS01280 PMI_RS01280 47.0 Proteus mirabilis HI4320 mrpB MR/P fimbria assembly terminator MrpB
PMI_RS10950 PMI_RS10950 23.0 Proteus mirabilis HI4320 - fimbrial protein

Distribution of the homologs in the orthogroup group_281

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_281

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P07111 6.58e-20 85 30 1 150 1 papH PAP fimbrial minor pilin protein Escherichia coli
P42185 1.26e-19 85 30 1 150 3 prsH PRS fimbrial minor pilin protein Escherichia coli
Q03011 5.97e-11 61 28 3 153 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P13421 3.93e-09 56 24 4 184 1 smfA Fimbria A protein Serratia marcescens
Q8X582 1.56e-05 46 31 3 91 1 elfA Laminin-binding fimbrial subunit ElfA Escherichia coli O157:H7
Q8X5K5 2.52e-05 46 25 3 155 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P75855 3.74e-05 45 31 3 91 1 elfA Fimbrial subunit ElfA Escherichia coli (strain K12)
P42184 0.000147 43 24 5 153 1 prsA PRS fimbrial major pilin protein (Fragment) Escherichia coli
P04127 0.000258 43 24 3 154 1 papA Pap fimbrial major pilin protein Escherichia coli
P04740 0.000889 42 25 10 199 3 KS71A KS71A fimbrillin Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10930
Feature type CDS
Gene -
Product type 1 fimbrial protein
Location 327519 - 328076 (strand: 1)
Length 558 (nucleotides) / 185 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_281
Orthogroup size 8
N. genomes 7

Actions

Genomic region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Protein Sequence

MGSNVMTRWLLIIVVCFSAQVPAGETKQDAKTSLRFGAVQMQGSILEPVCTISTASREQVVMLSDVSVPMLRDEGQGPADHFWIRLAECTVLPVKGQNIERSRFLVTFEGAEQDGHFQLTGSGKGASLSVSDLNGHEVVPGQPLPPADIDPDNMALRYQARLVKNSDELQSGYFRAILGFKLEYY

Flanking regions ( +/- flanking 50bp)

ACGGAAGACCTGTGCCGGTTTTTAATTGTGCGCGTTTAGCGGAGACGGAAATGGGTAGCAACGTAATGACCCGGTGGCTGCTGATAATTGTTGTGTGTTTTTCTGCTCAGGTACCGGCGGGTGAAACCAAACAAGATGCAAAAACCAGCCTGCGGTTCGGTGCGGTTCAGATGCAGGGCTCAATTCTGGAGCCGGTTTGTACTATCTCAACAGCCAGCCGTGAACAAGTGGTGATGTTATCTGATGTCTCTGTGCCAATGCTGCGTGATGAGGGACAAGGGCCTGCGGATCATTTCTGGATCAGGCTGGCGGAATGCACAGTCCTGCCGGTGAAAGGACAGAATATTGAACGTTCCCGGTTTCTGGTGACCTTTGAGGGCGCGGAACAGGATGGTCATTTTCAGCTGACAGGTTCTGGCAAAGGGGCGTCTTTATCTGTTTCTGATCTTAACGGACATGAAGTTGTTCCGGGTCAACCCTTACCACCCGCAGATATTGATCCCGATAATATGGCGCTGCGCTATCAGGCGCGTCTGGTCAAAAACAGTGATGAACTTCAGTCCGGTTATTTCCGGGCAATATTGGGTTTCAAGCTGGAATATTATTAAACCGAGCTGATTGGATCCACTATGGTAATTCCGCTGAGTACCGGCCCGCG