Homologs in group_74

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10590 FBDBKF_10590 100.0 Morganella morganii S1 atoC acetoacetate metabolism transcriptional regulator AtoC
FBDBKF_12110 FBDBKF_12110 44.3 Morganella morganii S1 glnG nitrogen regulation protein NR(I)
EHELCC_14195 EHELCC_14195 44.3 Morganella morganii S2 glnG nitrogen regulation protein NR(I)
EHELCC_14925 EHELCC_14925 100.0 Morganella morganii S2 atoC acetoacetate metabolism transcriptional regulator AtoC
NLDBIP_14755 NLDBIP_14755 100.0 Morganella morganii S4 atoC acetoacetate metabolism transcriptional regulator AtoC
NLDBIP_15290 NLDBIP_15290 44.3 Morganella morganii S4 glnG nitrogen regulation protein NR(I)
LHKJJB_14590 LHKJJB_14590 100.0 Morganella morganii S3 atoC acetoacetate metabolism transcriptional regulator AtoC
LHKJJB_15320 LHKJJB_15320 44.3 Morganella morganii S3 glnG nitrogen regulation protein NR(I)
HKOGLL_14440 HKOGLL_14440 44.3 Morganella morganii S5 glnG nitrogen regulation protein NR(I)
F4V73_RS14300 F4V73_RS14300 89.8 Morganella psychrotolerans atoC acetoacetate metabolism transcriptional regulator AtoC
F4V73_RS14530 F4V73_RS14530 44.4 Morganella psychrotolerans glnG nitrogen regulation protein NR(I)
PMI_RS14255 PMI_RS14255 44.2 Proteus mirabilis HI4320 glnG nitrogen regulation protein NR(I)

Distribution of the homologs in the orthogroup group_74

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_74

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q06065 0.0 611 66 2 455 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P14375 2.23e-134 397 46 7 454 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q8X613 8.23e-134 395 45 7 462 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P25852 2.79e-131 389 44 5 449 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9APD9 3.11e-131 389 45 5 455 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q8Z333 4.59e-131 389 44 5 449 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P28787 1.89e-125 375 44 6 472 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P03029 1.04e-122 368 42 5 468 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P0AFB8 1.91e-122 368 43 6 470 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.91e-122 368 43 6 470 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P41789 1.07e-121 366 42 6 470 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q00934 3.72e-112 340 40 2 454 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I4N3 3e-110 337 41 5 477 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10577 1.31e-108 333 38 5 477 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q9KT84 2.89e-105 323 38 6 453 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9HU19 3.24e-105 323 40 3 454 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C5S5 3.73e-103 318 39 5 453 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 3.73e-103 318 39 5 453 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P45671 5.92e-103 318 39 10 482 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q87MX7 1.01e-102 317 38 6 455 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q04848 1.62e-102 317 37 3 474 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q7MM78 1.54e-101 313 38 7 456 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1.54e-101 313 38 7 456 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q88RJ6 4.45e-101 312 38 4 453 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P27713 9.96e-101 314 45 4 369 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q88AQ2 1.19e-100 311 39 4 458 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0AFU5 1.55e-100 311 41 1 382 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 1.55e-100 311 41 1 382 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P10576 9.53e-100 310 37 6 477 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P12626 1.93e-98 308 47 1 334 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P12627 7.59e-98 306 48 1 327 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P23747 1.51e-97 303 42 1 376 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10046 6.14e-96 299 37 4 451 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P17899 2.22e-95 298 43 6 395 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P13632 4.07e-93 292 35 1 452 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q04849 5.19e-92 289 34 6 461 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P29267 2.65e-91 288 36 9 488 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P71229 2.5e-89 288 55 1 258 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P09570 3.55e-89 284 45 6 337 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P03027 7.01e-88 281 48 3 314 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 7.16e-88 280 47 4 327 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P54929 3.18e-86 279 52 2 262 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 5.14e-86 278 56 1 242 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54930 7.25e-86 275 47 5 313 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P19323 1.56e-85 279 45 3 322 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
G3XCV0 1.05e-83 269 37 12 496 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P05407 2.64e-83 270 43 6 350 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3K999 7.64e-83 263 44 3 319 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
E1WAA4 4.05e-82 270 45 4 324 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P31908 4.85e-82 264 37 11 484 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0CL46 8.55e-82 269 45 4 324 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q53206 1.41e-81 266 41 7 354 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P24426 1.78e-81 258 53 1 225 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
O85057 1.06e-80 263 44 6 324 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q845S7 1.33e-80 257 44 4 313 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P38022 2.2e-80 259 40 4 328 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
O25408 2.27e-80 256 38 5 386 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P0CY94 3.21e-80 262 51 1 242 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
D5ARW9 3.35e-80 262 51 1 242 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q4UL27 9.08e-79 255 33 10 458 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q43965 1.13e-78 258 40 4 347 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P06519 1.36e-78 258 42 2 318 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P09133 1.67e-78 259 54 2 247 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A8ANR6 5.61e-78 254 45 1 298 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0PWN2 1.64e-77 253 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5FSZ0 1.73e-77 253 46 3 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
Q9ZCY9 1.86e-77 252 32 10 457 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q68WH4 2.09e-77 252 32 10 458 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8Z4C6 1.44e-76 251 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.44e-76 251 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.44e-76 251 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.44e-76 251 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
Q5PF20 1.6e-76 251 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDG4 1.62e-76 250 46 4 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5F363 2.55e-76 250 45 3 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
Q8ZMJ8 8.75e-76 249 45 3 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 8.75e-76 249 45 3 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q46802 1.68e-75 250 44 5 313 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P09828 1.77e-75 248 47 2 252 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P54529 2.1e-75 252 39 8 374 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
A9MFX7 2.11e-75 248 45 2 302 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TF23 2.4e-75 248 45 3 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
Q1RJS1 2.47e-75 246 31 6 456 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q8D4F9 2.49e-75 248 41 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
Q01265 3.06e-75 240 42 3 285 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P37013 3.49e-75 247 44 4 307 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 3.49e-75 247 44 4 307 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 3.49e-75 247 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B5Z370 5.94e-75 246 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 5.94e-75 246 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P26047 7.02e-75 249 40 5 343 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
A4WDR5 1.22e-74 246 45 5 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
P54931 1.29e-74 248 48 1 242 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7MFY9 1.33e-74 246 39 7 367 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
B6I695 1.87e-74 245 45 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B4T3B0 2.03e-74 245 45 3 301 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B7UHC1 2.15e-74 245 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FEN6 2.17e-74 245 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MZ04 2.29e-74 245 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
P59402 2.68e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 2.68e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q32CL9 2.8e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
B7LEC0 2.92e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
A7ZQD8 3.39e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R7Z1 3.69e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 3.69e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 3.69e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LQ27 5.12e-74 244 45 5 306 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
P03028 5.57e-74 245 44 5 327 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
Q3YYF5 5.94e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B7M9E6 6.75e-74 244 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
B1IUX0 7.75e-74 243 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 8.17e-74 243 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
A8A3I6 8.62e-74 243 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
Q0TEH1 9.28e-74 243 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N6T9 2.68e-73 242 44 4 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q6D8R9 2.81e-73 242 44 5 303 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7NSI9 8.25e-73 241 44 5 306 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LW25 2.33e-72 239 44 5 306 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q92HC2 6.13e-72 238 32 12 459 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A4STH5 2.01e-71 237 42 2 306 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
A6TCX4 4.26e-71 236 43 2 297 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q9ZIB7 2.06e-70 235 38 4 325 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P74839 2.78e-70 235 40 7 338 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O31551 3.82e-70 236 35 4 384 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
B5XVA2 5.16e-70 234 44 2 297 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
A0KEJ0 2.1e-69 232 41 3 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P37344 8.08e-69 225 42 6 319 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P77743 1.84e-68 230 41 8 335 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
Q5E3W8 8.73e-68 228 40 2 304 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
A8GG93 1.88e-67 227 42 3 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
Q9KN48 1.02e-66 226 36 6 364 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O87455 5.54e-66 223 41 4 294 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P07604 2.75e-65 221 37 4 321 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
Q9K4U8 3.73e-64 218 36 5 377 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O54426 1.26e-63 217 35 5 347 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
Q9K4V0 8.81e-63 214 41 3 291 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0A2D7 8.89e-63 214 36 5 335 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 8.89e-63 214 36 5 335 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P37931 1.25e-60 203 40 4 290 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P28614 6.89e-59 207 38 8 309 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P26316 7.62e-57 193 36 4 298 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P26408 4.5e-55 194 30 8 476 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P37930 1.15e-53 185 37 4 290 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P36219 4.54e-51 179 35 3 300 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P09432 4.9e-51 182 29 10 480 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P44694 1.41e-48 172 37 4 292 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P38035 4.17e-43 162 32 10 359 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P54156 5e-37 141 38 5 236 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P45512 1.11e-36 145 29 4 328 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 4.69e-35 141 31 5 300 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P06184 1.96e-32 130 25 8 414 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55610 3.22e-32 132 28 4 336 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O78428 2.71e-20 93 43 1 116 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P51358 6.95e-20 92 40 1 116 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
P06628 7.84e-20 88 36 0 118 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P48259 9.02e-20 91 40 1 119 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P28835 1.21e-19 91 39 1 116 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q1XDC9 1.37e-19 91 39 1 116 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P28257 1.68e-19 91 39 1 116 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q9TLQ4 9.4e-19 89 40 1 119 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
D0ZLR9 9.45e-19 93 33 9 218 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
A1TEL7 1.32e-18 88 38 0 107 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
L7N689 1.73e-18 88 33 2 162 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1KHB7 3.25e-18 87 37 0 109 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 3.25e-18 87 37 0 109 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O69730 3.59e-18 87 38 0 106 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0R3I8 4.74e-18 86 35 0 109 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q742C1 5.12e-18 86 31 1 158 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 5.12e-18 86 31 1 158 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A0PWB4 5.48e-18 86 34 4 161 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P9WGM9 6.34e-18 85 37 0 109 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 6.34e-18 85 37 0 109 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 6.34e-18 85 37 0 109 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
O34903 8.63e-18 85 36 0 122 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P52942 9.57e-18 82 34 0 118 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q1B3X8 1.26e-17 85 37 0 107 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.26e-17 85 37 0 107 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.26e-17 85 37 0 107 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q9AE24 2.35e-17 84 33 0 116 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P0A4I0 2.57e-17 84 40 0 107 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2.57e-17 84 40 0 107 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q9CD68 2.72e-17 84 32 1 152 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P13792 1.32e-16 82 35 0 120 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q7A1J1 6.61e-16 80 37 1 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 6.61e-16 80 37 1 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 6.61e-16 80 37 1 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 6.61e-16 80 37 1 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 6.61e-16 80 37 1 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 6.61e-16 80 37 1 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 6.61e-16 80 37 1 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 6.61e-16 80 37 1 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 6.61e-16 80 37 1 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 6.61e-16 80 37 1 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P24072 8.81e-16 76 35 1 105 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q47456 8.91e-16 79 38 0 107 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P23914 1.24e-15 83 32 4 159 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
Q8CQ17 1.46e-15 79 36 1 109 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 1.46e-15 79 36 1 109 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L6C6 2.61e-15 78 32 1 125 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q2FWH6 8.78e-15 77 29 1 127 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8DPL7 9.24e-15 77 36 1 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 9.24e-15 77 36 1 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 9.24e-15 77 36 1 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q49XM7 1.01e-14 76 32 1 121 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGM1 1.53e-14 76 38 0 93 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.53e-14 76 38 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.53e-14 76 38 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23620 1.8e-14 75 37 1 108 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q31S42 2.01e-14 76 32 1 109 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4A160 2.61e-14 75 34 2 134 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q56312 3.13e-14 72 34 1 103 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7A216 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 3.44e-14 75 37 1 107 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 3.44e-14 75 37 1 107 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 3.44e-14 75 37 1 107 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 3.44e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CQK0 3.54e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 3.54e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4LAJ9 4.71e-14 75 37 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P0CL17 5.74e-14 74 36 1 127 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 5.74e-14 74 36 1 127 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P37478 6.23e-14 74 34 1 118 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q7D9K0 6.53e-14 74 35 0 107 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 6.53e-14 74 35 0 107 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P54443 6.6e-14 74 32 2 125 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q10WZ6 8.84e-14 75 40 4 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q99U73 8.84e-14 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q50136 8.9e-14 73 37 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P0C001 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 1.02e-13 73 30 1 126 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 1.02e-13 73 30 1 126 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P52931 1.09e-13 73 31 3 150 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q55890 1.37e-13 73 31 1 109 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P21866 1.95e-13 72 36 1 115 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
A0QTK2 1.98e-13 73 37 1 102 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45337 3.48e-13 72 32 0 107 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q93CB8 3.76e-13 72 36 1 102 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 3.92e-13 72 36 1 102 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 3.92e-13 72 36 1 102 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 3.92e-13 72 36 1 102 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZEP4 3.97e-13 72 39 1 102 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CCJ2 4.18e-13 72 36 1 102 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P9WGN1 5.65e-13 71 32 2 127 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 5.65e-13 71 32 2 127 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4H5 8.03e-13 68 36 1 103 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 8.03e-13 68 36 1 103 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P23221 1.18e-12 70 32 1 125 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9KL96 1.29e-12 71 47 3 80 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45709 1.35e-12 67 36 2 119 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q02540 1.47e-12 70 33 3 139 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
P42508 1.79e-12 69 34 2 107 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P94413 1.93e-12 70 31 1 102 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q01473 2.02e-12 72 33 3 150 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 6.72e-06 52 26 2 119 3 rcaC Protein RcaC Microchaete diplosiphon
P10958 2.42e-12 69 32 2 116 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
B8GZM2 3.37e-12 71 30 3 143 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 3.37e-12 71 30 3 143 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P9WGL9 3.41e-12 69 33 3 163 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 3.41e-12 69 33 3 163 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 3.41e-12 69 33 3 163 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P42421 3.42e-12 69 34 2 126 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P52941 3.51e-12 69 34 2 111 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P50350 3.74e-12 69 31 2 110 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P96126 3.96e-12 67 33 2 120 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
Q44006 4.46e-12 68 33 1 122 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P35163 5.51e-12 68 32 2 120 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q82EB1 5.62e-12 68 37 1 102 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O31432 5.85e-12 68 33 3 119 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q8Z7H2 6.54e-12 68 32 0 107 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q07783 6.81e-12 68 30 2 112 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P0DM78 6.92e-12 68 32 0 107 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 6.92e-12 68 32 0 107 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 6.92e-12 68 32 0 107 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 6.92e-12 68 32 0 107 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 6.92e-12 68 32 0 107 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P50351 6.94e-12 68 31 2 110 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9F868 6.96e-12 68 38 1 106 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9HV32 7.18e-12 68 33 2 132 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACZ8 7.97e-12 68 32 0 107 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 7.97e-12 68 32 0 107 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 7.97e-12 68 32 0 107 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P52936 1.08e-11 68 34 3 129 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P43501 1.36e-11 65 38 1 105 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1SMR4 1.57e-11 69 40 3 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P06534 1.99e-11 67 35 3 113 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q9I4F9 2.59e-11 66 31 0 108 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q57QC3 2.75e-11 66 31 0 107 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q83RR0 3.24e-11 66 31 0 107 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 3.24e-11 66 31 0 107 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23836 3.33e-11 66 31 0 107 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q9I0I1 3.33e-11 66 31 0 116 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42244 3.45e-11 66 32 2 131 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q7A0U4 3.69e-11 66 30 1 118 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 3.69e-11 66 30 1 118 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 3.69e-11 66 30 1 118 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 3.69e-11 66 30 1 118 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 3.69e-11 66 30 1 118 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 3.69e-11 66 30 1 118 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 3.69e-11 66 30 1 118 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 3.69e-11 66 30 1 118 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P0DMK7 5.07e-11 65 36 1 107 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 5.07e-11 65 36 1 107 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P0A4I4 5.7e-11 66 34 2 111 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 5.7e-11 66 34 2 111 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O06978 5.96e-11 65 32 1 105 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
O82868 6.1e-11 64 32 0 106 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q04942 7.58e-11 65 29 2 146 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q04803 8.57e-11 66 37 1 113 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O05251 9.72e-11 65 32 3 133 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q8EQW0 1.06e-10 66 32 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q47744 1.06e-10 64 30 2 115 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q1IRH0 1.09e-10 66 40 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q65JK6 1.15e-10 66 34 6 132 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8X738 1.28e-10 64 31 0 107 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q8XBS3 1.49e-10 64 32 0 107 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P0AEV3 1.49e-10 65 33 1 116 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.49e-10 65 33 1 116 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.49e-10 65 33 1 116 3 rssB Regulator of RpoS Escherichia coli O157:H7
P96602 1.52e-10 64 27 3 143 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P51586 1.56e-10 62 34 1 122 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P52932 1.59e-10 64 36 5 115 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q8RAZ3 1.65e-10 66 29 8 192 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P33112 1.74e-10 64 29 3 142 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
P52928 2.09e-10 64 34 2 111 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
P45607 2.12e-10 63 32 1 109 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P52940 2.13e-10 64 34 3 116 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q97GZ3 2.25e-10 65 25 7 203 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9K998 2.25e-10 63 30 4 140 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O32192 2.35e-10 63 33 1 119 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P0AFJ5 2.49e-10 63 32 1 109 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 2.49e-10 63 32 1 109 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P45606 2.66e-10 63 32 1 109 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P66795 2.85e-10 63 32 1 118 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 2.85e-10 63 32 1 118 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q8KR08 3.03e-10 63 27 0 135 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q67P67 3.35e-10 65 33 3 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8CN92 4.15e-10 63 32 4 136 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7NSI8 4.21e-10 64 33 5 134 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q30RX5 4.48e-10 64 37 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q52990 4.54e-10 63 33 2 110 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q5HLN2 4.77e-10 63 32 4 136 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P58253 4.96e-10 63 36 3 107 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P52934 5.05e-10 63 33 2 112 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q8D0P1 5.36e-10 60 35 2 111 3 cheY Chemotaxis protein CheY Yersinia pestis
Q9KA55 5.63e-10 64 33 3 130 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KQD5 5.92e-10 60 34 2 117 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 5.92e-10 60 34 2 117 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q0AWZ8 6.17e-10 64 41 4 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q3ADG9 6.51e-10 63 31 7 154 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q70FH0 7.02e-10 62 37 0 108 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
A0A0H3GGB5 7.07e-10 62 39 2 107 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q12YX1 7.18e-10 63 35 5 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
P52076 7.73e-10 62 31 0 107 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q2RRX2 7.76e-10 63 35 3 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P52929 7.95e-10 62 32 2 107 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q1D359 8.1e-10 63 38 3 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
Q07597 1.04e-09 62 30 1 108 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
P36556 1.09e-09 62 28 1 152 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8D4U6 1.24e-09 62 37 4 116 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
P52938 1.29e-09 62 30 3 108 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q9ZHD3 1.45e-09 61 30 0 107 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P0AE90 1.46e-09 61 39 2 107 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 1.46e-09 61 39 2 107 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 1.46e-09 61 39 2 107 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
O31517 1.52e-09 63 27 1 107 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
Q5A4X5 1.58e-09 63 32 3 131 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5HPC3 1.71e-09 61 30 1 125 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q54YZ9 1.84e-09 63 38 1 97 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P39663 1.85e-09 61 31 1 116 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1XDE4 1.86e-09 61 27 1 126 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P45605 1.9e-09 61 31 1 109 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P0A4H8 2.07e-09 61 32 1 116 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.07e-09 61 32 1 116 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0C5S3 2.22e-09 60 31 1 113 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
Q9UYF3 2.34e-09 62 31 5 135 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q1IQS9 2.99e-09 62 38 5 116 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
Q0AYL3 3.39e-09 62 32 3 129 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q9WYN9 3.41e-09 62 30 3 155 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P40138 3.49e-09 62 29 5 175 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
O07528 3.5e-09 60 33 1 109 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
O29221 3.5e-09 62 35 7 128 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6UEL7 3.5e-09 59 31 1 113 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q9WY30 3.76e-09 62 31 1 115 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P9WGM3 3.87e-09 60 32 7 143 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 3.87e-09 60 32 7 143 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P76340 4.01e-09 60 29 1 107 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q3LWR6 4.56e-09 60 23 0 142 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 4.56e-09 60 23 0 142 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 4.56e-09 60 23 0 142 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
O25918 4.61e-09 59 29 1 114 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q5JF95 4.72e-09 61 31 4 135 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P26275 4.76e-09 60 37 4 123 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q93P00 5.68e-09 57 34 2 114 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
B0R4K1 5.72e-09 57 35 3 106 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q8CP82 6.3e-09 59 29 1 125 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q53228 6.9e-09 58 30 2 107 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q49ZT8 6.93e-09 59 30 2 135 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8KIY1 7.2e-09 62 31 3 135 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q47I43 7.28e-09 60 34 3 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
Q9KM23 7.46e-09 59 35 2 106 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P32040 7.62e-09 59 31 3 115 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P38889 8.58e-09 61 30 0 119 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08368 8.67e-09 59 27 1 136 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q24T61 8.87e-09 60 38 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
Q5V0B3 1.03e-08 60 33 5 126 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q8GP20 1.08e-08 58 35 4 116 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P94504 1.15e-08 58 28 2 125 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P72253 1.23e-08 60 31 2 112 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
Q52883 1.26e-08 60 35 3 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q05522 1.43e-08 60 26 8 195 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
O85128 1.51e-08 60 34 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
A0A4P7TS68 1.76e-08 58 27 0 122 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.76e-08 58 27 0 122 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.76e-08 58 27 0 122 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.76e-08 58 27 0 122 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.76e-08 58 27 0 122 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.76e-08 58 27 0 122 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.76e-08 58 27 0 122 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.76e-08 58 27 0 122 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P0A4I2 1.85e-08 58 33 0 107 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 1.85e-08 58 33 0 107 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q87K77 1.86e-08 58 32 4 118 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P48027 1.86e-08 60 31 1 113 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P13800 2.13e-08 58 37 0 79 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P62646 2.14e-08 59 33 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P37740 2.26e-08 57 35 2 108 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q4L8L9 2.32e-08 58 30 1 116 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q9ZM64 2.44e-08 55 30 3 106 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
E0X9C7 2.54e-08 60 30 3 135 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
O49397 2.79e-08 59 30 2 110 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
P0AE69 2.81e-08 55 32 2 117 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 2.81e-08 55 32 2 117 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 2.81e-08 55 32 2 117 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P54884 2.88e-08 57 33 3 128 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P69228 2.95e-08 57 26 2 133 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 2.95e-08 57 26 2 133 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9K621 3.08e-08 57 26 1 103 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8FGP6 3.21e-08 55 32 2 117 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2KCH8 3.3e-08 58 33 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q44929 3.34e-08 57 31 2 125 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P44895 3.37e-08 57 39 2 107 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q56128 3.5e-08 59 33 0 107 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q4UU85 3.67e-08 58 30 2 128 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P55184 3.69e-08 57 34 1 85 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
P96686 3.97e-08 57 31 2 102 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q3ADA6 4.07e-08 58 34 3 113 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P30843 4.11e-08 57 32 1 115 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
A5W4E3 4.2e-08 59 30 3 135 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P39486 4.35e-08 57 36 0 68 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q2RZD2 4.59e-08 58 33 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salinibacter ruber (strain DSM 13855 / M31)
Q39T95 4.6e-08 58 30 6 141 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2SBX9 4.62e-08 58 31 5 124 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Hahella chejuensis (strain KCTC 2396)
A6QJK3 4.63e-08 57 29 1 116 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 4.63e-08 57 29 1 116 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P0A2D5 4.87e-08 55 31 2 117 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 4.87e-08 55 31 2 117 3 cheY Chemotaxis protein CheY Salmonella typhi
Q9FAD7 4.96e-08 55 32 2 117 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P42012 5.25e-08 57 30 3 113 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
P58662 5.79e-08 58 33 0 107 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3A5A8 5.9e-08 58 25 7 190 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2T8Y6 6.03e-08 58 33 5 133 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P46384 6.47e-08 54 28 1 109 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q167K9 6.48e-08 58 26 10 222 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5A599 6.49e-08 58 29 6 163 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0AFT5 6.54e-08 57 30 8 178 1 btsR Transcriptional regulatory protein BtsR Escherichia coli (strain K12)
P0AFT6 6.54e-08 57 30 8 178 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DUE6 6.54e-08 57 30 8 178 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O157:H7
P0DUE7 6.54e-08 57 30 8 178 4 btsR Transcriptional regulatory protein-like BtsR Enterobacteria phage VT1-Sakai
T2KMF4 7.08e-08 58 29 2 117 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q8ZBV2 7.36e-08 56 37 6 117 3 YPO3287 Uncharacterized response regulatory protein YPO3287/y0902/YP_0397 Yersinia pestis
O58192 7.55e-08 57 30 5 132 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2YIF7 7.69e-08 54 29 1 117 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
P0DMC5 7.71e-08 58 33 0 107 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
A1W0A5 7.76e-08 54 29 3 106 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 7.76e-08 54 29 3 106 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 7.76e-08 54 29 3 106 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P59640 8.24e-08 56 30 8 178 3 btsR Transcriptional regulatory protein BtsR Shigella flexneri
Q6AJV3 9.38e-08 57 28 6 185 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P58357 9.39e-08 56 33 3 109 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
P71403 9.73e-08 53 29 3 106 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P54662 9.87e-08 56 28 1 115 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P15940 1.03e-07 56 28 0 106 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1MP86 1.03e-07 57 37 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Lawsonia intracellularis (strain PHE/MN1-00)
Q2ILG8 1.04e-07 57 32 3 109 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q9KS59 1.05e-07 57 31 4 108 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_13210
Feature type CDS
Gene atoC
Product acetoacetate metabolism transcriptional regulator AtoC
Location 61235 - 62620 (strand: -1)
Length 1386 (nucleotides) / 461 (amino acids)

Contig

Accession ZDB_691
Length 141725 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_74
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2204 Signal transduction mechanisms (T) T DNA-binding transcriptional response regulator, NtrC family, contains REC, AAA-type ATPase, and a Fis-type DNA-binding domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07714 two-component system, NtrC family, response regulator AtoC Two-component system -

Protein Sequence

MITHKSYRLLIVDDEKNLCRMLQTAFSIDGHETRVAEDGEAALISFVQDKPDVVLMDIRMPKLDGIEALKRMRELNPEVPVILMTAYAAVETAVDALRLGAFDYVIKPFDLTELKLLISRALQLQEMKQEINLLHRELSDSYQWGRVLTRNPKMMEICRDIAKVSRSQATVLITGESGTGKEVVARAIHYNSERANGPFIKVNCGALPGSLLESELFGHEKGAFTGAQVQRQGLFERASGGTLLLDEVGEMPADLQVKLLRVVQEKEFERVGGSKTIRVDIRIIAATNRDMHERVREGHFRQDLFYRLNVIHLNLPPLRERPEDVGLLASHFLQKFSQENNRDIVELAPETLALLMNYQWPGNVREISNVIERAVIMSTGYVIFPEDLPEQLLAQVRSQPVALIPVMQEPGLNLKENIKAYEKELIISALAEFQNNKTHTASALGISRRALMYKLQEYDIE

Flanking regions ( +/- flanking 50bp)

TCATGGAACGACGTTCACCATAACGTTGCCGATAACGCAGGGTAAGAAAAATGATTACACATAAATCGTACCGGCTTCTGATAGTTGATGATGAAAAGAATCTCTGCCGGATGTTACAGACCGCCTTTTCTATTGATGGTCATGAAACCCGGGTGGCGGAGGACGGCGAGGCGGCACTGATAAGCTTTGTGCAGGATAAACCGGATGTGGTACTGATGGATATCCGTATGCCGAAACTGGACGGCATTGAGGCCCTCAAACGGATGCGGGAGCTGAACCCGGAAGTGCCGGTCATTCTGATGACCGCCTATGCCGCTGTGGAAACCGCAGTGGACGCGCTGCGTCTCGGGGCGTTTGATTATGTGATAAAGCCCTTTGACCTGACGGAGCTGAAACTGCTTATCTCCCGTGCATTACAGTTGCAGGAGATGAAACAGGAAATCAATCTGCTGCACCGCGAACTGAGCGACAGCTACCAGTGGGGACGGGTGCTGACCCGTAACCCGAAAATGATGGAAATCTGCCGTGATATCGCCAAAGTCTCGCGCAGCCAGGCGACGGTGCTTATCACCGGGGAAAGCGGCACCGGGAAGGAAGTGGTGGCACGGGCGATCCATTACAACAGCGAAAGGGCCAACGGCCCCTTTATTAAAGTGAACTGCGGGGCGCTGCCCGGCTCGCTGCTGGAAAGTGAGCTGTTCGGCCATGAAAAGGGCGCATTTACCGGGGCGCAGGTACAGCGTCAGGGATTATTTGAACGCGCCAGCGGCGGAACATTGCTGCTTGATGAAGTCGGTGAAATGCCGGCGGATTTACAGGTGAAACTGCTGCGGGTGGTGCAGGAGAAAGAATTTGAGCGCGTCGGCGGCAGTAAAACCATCCGCGTGGATATCCGCATTATTGCCGCGACCAACCGCGATATGCATGAACGGGTGCGGGAAGGGCATTTCCGCCAGGATCTGTTTTACCGTCTCAATGTTATTCATCTGAACCTGCCGCCGCTGCGTGAGCGGCCGGAGGATGTGGGTTTGCTGGCCTCCCATTTTCTGCAGAAATTCAGTCAGGAAAATAACCGCGATATTGTCGAGCTGGCACCGGAAACCCTGGCATTACTGATGAACTACCAGTGGCCGGGCAATGTACGGGAGATTTCCAACGTGATTGAACGGGCAGTCATTATGAGCACCGGTTATGTGATTTTCCCGGAAGATTTGCCGGAGCAGTTACTGGCACAGGTCCGCAGCCAGCCGGTGGCACTGATTCCGGTCATGCAGGAGCCGGGGCTGAACCTGAAAGAGAATATTAAAGCTTACGAGAAAGAGCTGATTATTTCCGCCCTGGCAGAATTTCAGAATAACAAAACCCATACCGCCTCTGCGCTGGGGATCAGCCGCCGGGCATTAATGTATAAATTGCAGGAATACGATATTGAATAATTAATAATAATTTTATAAAAATAATTTTAAAAAGCACGGTGAAAATAAAT