Homologs in group_68

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10590 FBDBKF_10590 44.3 Morganella morganii S1 atoC acetoacetate metabolism transcriptional regulator AtoC
FBDBKF_12110 FBDBKF_12110 100.0 Morganella morganii S1 glnG nitrogen regulation protein NR(I)
EHELCC_14925 EHELCC_14925 44.3 Morganella morganii S2 atoC acetoacetate metabolism transcriptional regulator AtoC
NLDBIP_14755 NLDBIP_14755 44.3 Morganella morganii S4 atoC acetoacetate metabolism transcriptional regulator AtoC
NLDBIP_15290 NLDBIP_15290 100.0 Morganella morganii S4 glnG nitrogen regulation protein NR(I)
LHKJJB_14590 LHKJJB_14590 44.3 Morganella morganii S3 atoC acetoacetate metabolism transcriptional regulator AtoC
LHKJJB_15320 LHKJJB_15320 100.0 Morganella morganii S3 glnG nitrogen regulation protein NR(I)
HKOGLL_13210 HKOGLL_13210 44.3 Morganella morganii S5 atoC acetoacetate metabolism transcriptional regulator AtoC
HKOGLL_14440 HKOGLL_14440 100.0 Morganella morganii S5 glnG nitrogen regulation protein NR(I)
F4V73_RS14300 F4V73_RS14300 44.8 Morganella psychrotolerans atoC acetoacetate metabolism transcriptional regulator AtoC
F4V73_RS14530 F4V73_RS14530 86.6 Morganella psychrotolerans glnG nitrogen regulation protein NR(I)
PMI_RS14255 PMI_RS14255 73.7 Proteus mirabilis HI4320 glnG nitrogen regulation protein NR(I)

Distribution of the homologs in the orthogroup group_68

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_68

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P28787 0.0 719 73 1 476 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P0AFB8 0.0 699 72 2 475 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 0.0 699 72 2 475 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P41789 0.0 697 72 3 475 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P03029 0.0 694 72 3 478 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P10577 4.82e-138 409 45 8 488 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q04848 2.95e-131 391 45 9 486 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P45671 4.6e-131 391 46 4 476 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P10576 1.67e-127 382 43 4 478 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q06065 1.1e-117 356 40 4 476 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q9APD9 9.93e-109 332 41 2 464 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P25852 1.04e-108 332 41 4 464 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 7.57e-107 328 41 4 466 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P14375 1.42e-104 322 40 3 464 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q8X613 4.57e-104 320 40 5 466 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q9I4N3 1.46e-99 310 40 9 491 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFU5 1.31e-96 301 43 2 373 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 1.31e-96 301 43 2 373 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q00934 8.79e-96 299 38 5 475 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C5S5 1.85e-95 299 37 5 468 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.85e-95 299 37 5 468 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q87MX7 7.23e-95 297 37 4 468 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KT84 2.15e-94 296 41 1 384 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9HU19 4.98e-94 295 38 5 477 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7MM78 2.05e-91 288 41 1 380 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 2.05e-91 288 41 1 380 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P13632 8.54e-91 287 42 1 363 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q04849 4.48e-88 280 35 6 474 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P23747 4.76e-88 280 41 3 384 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88RJ6 2.69e-84 270 41 2 378 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88AQ2 1.73e-83 268 40 2 378 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P10046 2.89e-83 267 41 1 361 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P17899 5.54e-82 264 37 7 450 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P24426 1.41e-78 252 41 4 346 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P12627 5.89e-78 255 43 4 332 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P12626 5.94e-78 256 41 3 337 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P09570 2.49e-76 251 53 1 232 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P29267 5.41e-76 249 33 8 497 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O25408 1.84e-75 244 35 6 382 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P27713 2.08e-74 247 51 1 243 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P26047 3.33e-74 248 41 4 335 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q845S7 9.51e-74 240 42 2 313 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P71229 1.77e-73 248 52 0 227 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
Q46802 2.6e-73 245 41 6 345 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
D5ARW9 5.95e-73 244 46 3 292 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 5.95e-73 244 46 3 292 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
P54930 6.26e-73 242 52 1 232 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P30667 6.81e-73 245 39 6 388 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54929 1.28e-72 244 40 7 382 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P09133 1.73e-72 243 46 1 269 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P03027 3.21e-72 241 51 1 237 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 3.42e-72 240 51 1 237 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P0CL46 4.69e-72 244 43 6 338 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q53206 5.85e-72 241 42 3 325 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
E1WAA4 1.95e-71 243 42 4 338 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P05407 2.68e-71 239 51 2 245 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P54931 3.6e-71 239 46 2 258 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3K999 3.9e-71 233 42 4 313 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q43965 4.1e-71 238 39 4 348 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q4UL27 4.76e-71 236 29 8 476 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P19323 2.61e-70 239 53 0 224 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
Q1RJS1 2.65e-70 234 30 8 477 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P06519 1.91e-69 234 40 3 332 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P09432 2.02e-69 231 34 13 490 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
G3XCV0 2.92e-69 232 40 6 367 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZCY9 3.38e-69 231 29 8 476 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q68WH4 1.49e-68 229 28 8 476 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q6D8R9 6.35e-68 229 40 4 350 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4STH5 9.31e-68 228 49 0 236 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q92HC2 1.63e-67 227 30 9 477 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
O87455 3.33e-67 228 37 7 405 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0KEJ0 5.11e-67 226 49 0 236 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A9MFX7 1.71e-66 225 39 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F363 2.44e-65 222 39 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
Q01265 4.09e-65 215 39 4 279 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q5E3W8 4.26e-65 221 48 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FSZ0 6.15e-65 221 39 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P28614 8.83e-65 224 42 7 346 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P74839 8.94e-65 221 40 7 350 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4C6 1.2e-64 220 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.2e-64 220 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.2e-64 220 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.2e-64 220 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
Q5PF20 1.24e-64 220 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDG4 1.32e-64 220 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4TF23 2.48e-64 219 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
A8ANR6 2.67e-64 219 40 2 334 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TCX4 3.02e-64 219 48 2 250 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8ZMJ8 3.66e-64 219 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 3.66e-64 219 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
C0PWN2 4.02e-64 219 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
A4WDR5 7.77e-64 218 40 3 334 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
P77743 8.29e-64 218 38 11 402 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
O54426 1.92e-63 217 40 9 349 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
Q7MFY9 4.15e-63 216 45 1 248 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q8D4F9 4.47e-63 216 39 6 346 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
B5XVA2 4.8e-63 216 47 2 249 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
B4T3B0 4.93e-63 216 38 3 360 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
P03028 3.75e-62 214 48 2 245 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
A8GG93 3.93e-62 213 45 1 252 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B6I695 6.2e-62 213 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
Q9ZIB7 8.47e-62 213 39 8 354 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
A7ZQD8 9.83e-62 212 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
P07604 1.04e-61 213 40 10 352 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
B7LW25 1.24e-61 212 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P09828 1.37e-61 212 44 1 247 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
Q1R7Z1 1.56e-61 212 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 1.56e-61 212 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 1.56e-61 212 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LEC0 1.73e-61 212 48 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
O31551 2.09e-61 214 34 9 450 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
B7NSI9 2.98e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7N6T9 3.34e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7MZ04 3.79e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
O85057 3.83e-61 212 37 7 342 1 None Limonene hydroxylase Geobacillus stearothermophilus
B7UHC1 3.99e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TEH1 4.03e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FEN6 4.12e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YYF5 4.3e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
A8A3I6 4.62e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B1IUX0 5.02e-61 211 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M9E6 5.24e-61 210 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q31X73 5.46e-61 210 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B1LQ27 5.52e-61 210 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
P0A2D7 1.44e-60 209 40 9 341 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.44e-60 209 40 9 341 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P59402 2.34e-60 209 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 2.34e-60 209 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
B5Z370 2.59e-60 209 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 2.59e-60 209 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
Q32CL9 2.7e-60 208 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
P37013 3.26e-60 208 47 0 232 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 3.26e-60 208 47 0 232 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 3.26e-60 208 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
P31908 9.44e-60 206 32 6 491 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9K4U8 3.03e-58 203 46 0 224 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P37344 1.1e-57 196 45 2 235 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P38022 5.16e-57 199 35 4 335 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
P54529 7.2e-56 201 36 7 349 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q9KN48 2.09e-55 196 44 1 238 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9K4V0 1.79e-53 191 39 2 333 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P26316 7.36e-50 175 34 4 338 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P37931 1.87e-48 171 42 2 226 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P37930 4.86e-46 166 34 5 312 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P36219 4.14e-45 163 42 1 208 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P44694 2.27e-44 161 39 2 228 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P26408 5.41e-44 164 29 12 499 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P76016 2.02e-36 145 30 4 317 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P54156 2.6e-34 134 33 5 253 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P38035 3.08e-33 135 35 4 254 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 3.95e-31 130 29 4 317 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P06184 1.32e-26 114 24 7 454 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23221 3.97e-22 97 37 1 137 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P55610 1.05e-20 99 27 7 334 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A0R3I8 1.19e-16 82 38 0 106 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
D0ZLR9 1.75e-16 86 30 11 266 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 2.01e-16 85 29 8 251 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
A0PWB4 3.6e-16 81 36 2 135 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1TEL7 4.08e-16 80 37 0 108 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q742C1 1.15e-15 79 37 0 106 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.15e-15 79 37 0 106 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A1KHB7 1.22e-15 79 37 0 106 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.22e-15 79 37 0 106 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1B3X8 1.77e-15 79 36 0 108 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.77e-15 79 36 0 108 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.77e-15 79 36 0 108 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P06628 1.81e-15 76 34 0 119 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P9WGM9 2.07e-15 79 37 0 106 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 2.07e-15 79 37 0 106 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 2.07e-15 79 37 0 106 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P26487 4.26e-15 77 36 7 171 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P52942 4.56e-15 75 34 0 107 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q3LWR6 6.32e-15 77 33 0 115 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 6.32e-15 77 33 0 115 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 6.32e-15 77 33 0 115 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q2FWH6 8.05e-15 77 33 1 107 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
P28835 1.03e-14 77 34 1 106 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q9CD68 1.13e-14 76 35 0 106 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P36556 1.88e-14 75 36 0 106 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O78428 2.71e-14 76 37 1 102 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q8KR08 3.12e-14 75 33 0 119 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P15940 3.47e-14 75 34 2 124 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P10958 5.56e-14 74 34 0 121 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
O69730 2.03e-13 73 32 0 111 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q47456 3.45e-13 72 30 0 121 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P45337 3.49e-13 72 33 1 128 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P13792 4.95e-13 72 31 0 102 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P48259 5.11e-13 72 35 1 102 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P30843 6.51e-13 71 35 0 106 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q1XDC9 1.67e-12 70 32 1 105 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
O34903 2.04e-12 70 30 0 119 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q70FH0 2.13e-12 70 40 0 102 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P51358 2.13e-12 70 32 1 105 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q7D9K0 2.39e-12 70 31 0 106 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 2.39e-12 70 31 0 106 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0CL17 2.68e-12 69 33 0 106 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 2.68e-12 69 33 0 106 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q51455 3.25e-12 67 38 2 105 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28257 5.05e-12 69 32 1 102 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q82EB1 5.36e-12 68 33 2 112 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9ZEP4 8.62e-12 68 33 2 112 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A4P7TS68 8.94e-12 68 33 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 8.94e-12 68 33 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 8.94e-12 68 33 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 8.94e-12 68 33 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 8.94e-12 68 33 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 8.94e-12 68 33 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 8.94e-12 68 33 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 8.94e-12 68 33 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P23620 9.02e-12 68 33 1 103 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q93P00 1.09e-11 65 38 3 107 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
L7N689 1.14e-11 68 31 1 116 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O31432 1.16e-11 67 30 2 122 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q4L8L9 1.41e-11 67 33 1 119 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
P72781 1.48e-11 67 32 5 159 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q04942 1.56e-11 67 32 1 101 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8DPL7 1.6e-11 67 29 3 149 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 1.6e-11 67 29 3 149 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 1.6e-11 67 29 3 149 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8D0P1 1.79e-11 64 38 3 107 3 cheY Chemotaxis protein CheY Yersinia pestis
Q49ZT8 2.49e-11 67 32 1 115 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8FGP6 2.58e-11 64 39 3 107 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O87940 3.01e-11 66 32 0 119 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
O25918 3.29e-11 66 32 2 116 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q9TLQ4 4.36e-11 66 23 5 208 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P0A2D5 4.62e-11 63 38 3 107 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 4.62e-11 63 38 3 107 3 cheY Chemotaxis protein CheY Salmonella typhi
Q4A160 4.66e-11 66 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQK0 4.66e-11 66 30 2 131 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 4.66e-11 66 30 2 131 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7CQM8 4.69e-11 65 32 0 114 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4LAJ9 4.93e-11 66 28 2 153 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P31079 5.47e-11 66 32 1 105 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q7A216 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 5.95e-11 65 30 1 121 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 5.95e-11 65 30 1 121 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 5.95e-11 65 30 1 121 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 5.95e-11 65 30 1 121 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WGM3 6.02e-11 65 32 4 125 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 6.02e-11 65 32 4 125 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AE69 6.55e-11 63 38 3 107 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 6.55e-11 63 38 3 107 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 6.55e-11 63 38 3 107 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P37478 8.19e-11 65 30 6 156 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q9ZWJ9 8.66e-11 68 39 2 107 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
P0C5S3 1.08e-10 64 31 0 105 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
G3XCY6 1.38e-10 65 37 1 103 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI2 1.45e-10 65 32 4 135 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O49397 1.63e-10 67 37 2 108 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
A6UEL7 1.69e-10 63 31 0 105 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
O05251 2.03e-10 64 33 3 123 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q8XBS3 2.08e-10 63 34 0 102 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P62598 2.32e-10 66 37 2 108 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P96602 2.33e-10 63 22 5 184 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P0A4H5 2.33e-10 61 31 2 117 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 2.33e-10 61 31 2 117 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8H358 2.72e-10 63 27 0 108 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 2.72e-10 63 27 0 108 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1XDE4 3.11e-10 63 31 3 116 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
Q57QC3 3.32e-10 63 32 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q9FAD7 3.4e-10 61 37 3 107 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P0A4I0 3.45e-10 63 32 3 124 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 3.45e-10 63 32 3 124 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q940D0 3.65e-10 65 38 2 107 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q7XQA6 3.7e-10 62 35 3 117 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
P51586 3.81e-10 61 35 1 112 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q8Z7H2 3.86e-10 63 32 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q44006 3.92e-10 63 28 1 117 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P0DM78 4.01e-10 63 32 0 108 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 4.01e-10 63 32 0 108 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 4.01e-10 63 32 0 108 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 4.01e-10 63 32 0 108 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 4.01e-10 63 32 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A2XYV5 4.04e-10 62 35 3 117 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
Q10WZ6 4.05e-10 65 32 3 128 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q8X738 4.26e-10 63 31 0 108 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q9AE24 4.32e-10 63 26 0 119 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q95PI2 4.7e-10 65 30 2 112 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q93CB8 4.78e-10 63 30 1 102 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 5.08e-10 63 30 1 102 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 5.08e-10 63 30 1 102 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 5.08e-10 63 30 1 102 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5HLN2 5.17e-10 63 31 1 116 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN92 5.27e-10 62 31 1 116 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q2WAJ8 5.31e-10 64 37 3 110 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P39486 5.42e-10 63 29 4 131 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q9CCJ2 5.5e-10 62 30 1 102 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q3IRR4 5.6e-10 64 35 3 101 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q83RR0 5.87e-10 62 31 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 5.87e-10 62 31 0 108 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23836 6.33e-10 62 31 0 108 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q8H7S7 6.67e-10 65 40 2 108 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 6.85e-10 65 40 2 108 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
P24072 6.95e-10 60 30 2 118 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P0DMI2 7.2e-10 63 33 5 139 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4K0 7.2e-10 63 33 5 139 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P52076 7.62e-10 62 34 0 102 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P66795 7.98e-10 62 35 0 102 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 7.98e-10 62 35 0 102 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q9KQD5 8.07e-10 60 34 2 105 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 8.07e-10 60 34 2 105 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P50350 8.14e-10 62 35 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
A0QTK2 8.92e-10 62 30 1 102 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9I4F9 9.13e-10 62 30 0 106 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2YZ24 9.7e-10 62 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8L9Y3 9.89e-10 63 35 1 104 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
P0DOA0 1.02e-09 64 32 1 117 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
O58192 1.02e-09 63 34 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P9WGM1 1.16e-09 62 32 1 107 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.16e-09 62 32 1 107 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.16e-09 62 32 1 107 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9LYP5 1.18e-09 64 31 2 122 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
P50351 1.27e-09 62 35 1 101 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P35163 1.31e-09 62 34 3 105 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P42421 1.32e-09 62 33 1 106 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q8GP20 1.73e-09 61 32 0 111 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P21866 2.03e-09 61 31 1 104 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q01473 2.17e-09 63 30 1 113 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 6.88e-06 52 26 1 123 3 rcaC Protein RcaC Microchaete diplosiphon
Q6H468 2.19e-09 59 34 3 121 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 2.19e-09 59 34 3 121 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
P26275 2.28e-09 61 33 3 123 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3BUA2 2.35e-09 62 30 8 205 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PLB4 2.35e-09 62 30 8 205 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas axonopodis pv. citri (strain 306)
P76340 2.45e-09 60 31 2 122 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P08368 2.49e-09 61 28 0 128 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
P0C0F6 2.91e-09 63 28 1 145 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P9WGN1 2.93e-09 60 33 1 105 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 2.93e-09 60 33 1 105 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0C0F7 3.43e-09 63 31 2 133 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q5GYV8 3.49e-09 62 30 8 205 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P1V8 3.49e-09 62 30 8 205 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9K621 3.61e-09 60 23 3 163 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6GE73 4e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
P37740 4.04e-09 59 33 2 117 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q50136 4.07e-09 60 35 3 108 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P94504 4.2e-09 60 28 3 127 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q2T8Y6 4.43e-09 61 37 5 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
O32192 4.54e-09 60 27 3 131 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
Q7A039 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 4.83e-09 60 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2HWH1 4.85e-09 58 34 3 118 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 4.85e-09 58 34 3 118 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
B8GZM2 5.03e-09 62 31 4 147 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 5.03e-09 62 31 4 147 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q75HW2 5.6e-09 62 30 3 135 2 RR27 Two-component response regulator ORR27 Oryza sativa subsp. japonica
Q9KQD8 5.82e-09 61 36 6 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0DMK7 6.17e-09 59 30 2 114 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 6.17e-09 59 30 2 114 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P48359 6.33e-09 59 28 3 132 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q4UU97 6.82e-09 61 30 8 205 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8P9J7 6.82e-09 61 30 8 205 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9UYF3 7.07e-09 61 32 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q07783 7.51e-09 59 33 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P42508 7.57e-09 58 27 0 105 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P0DMC5 7.58e-09 62 32 1 122 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q9KL96 7.58e-09 60 38 3 100 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45606 8.32e-09 59 30 2 115 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0ACZ8 8.41e-09 59 28 0 102 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 8.41e-09 59 28 0 102 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 8.41e-09 59 28 0 102 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q5JF95 8.49e-09 60 30 5 137 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P45607 8.55e-09 59 30 2 115 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P0AFJ5 8.63e-09 59 30 2 115 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 8.63e-09 59 30 2 115 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q2W5V5 9.24e-09 60 32 3 112 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2QXY3 1.12e-08 58 30 7 150 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. japonica
B8BLZ4 1.12e-08 58 30 7 150 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. indica
Q55890 1.28e-08 59 29 2 117 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45605 1.38e-08 58 31 2 115 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P0DMC6 1.5e-08 61 32 1 122 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q9ZM64 1.6e-08 56 33 3 108 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q04803 1.62e-08 59 29 1 104 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WY30 1.65e-08 60 26 1 104 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A6QJK3 1.68e-08 58 33 1 115 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.68e-08 58 33 1 115 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P52931 1.68e-08 58 31 2 112 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q06239 2.07e-08 58 27 1 120 3 vanR Regulatory protein VanR Enterococcus faecium
P62635 2.16e-08 59 28 7 181 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P72253 2.31e-08 59 37 4 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
Q52990 2.44e-08 58 32 1 104 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q56128 2.53e-08 60 31 0 119 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 2.78e-08 60 33 0 104 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q49XM7 2.82e-08 57 32 4 122 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6H805 3.22e-08 59 34 2 112 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
Q9FXD6 3.35e-08 59 36 2 104 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
Q0PVB3 3.38e-08 57 32 3 122 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
Q99U73 3.41e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
A2X1N2 3.45e-08 59 34 2 112 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
P0AEV3 3.47e-08 58 32 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 3.47e-08 58 32 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 3.47e-08 58 32 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P0C001 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 4.74e-08 57 31 2 113 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 4.74e-08 57 31 2 113 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P54443 4.84e-08 57 27 3 148 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q31S42 4.97e-08 57 30 3 121 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZHD3 5.41e-08 57 28 4 142 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q1MLG8 5.97e-08 58 31 4 134 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2YIF7 6.7e-08 54 30 2 117 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
P71403 6.79e-08 54 32 3 108 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
E0X9C7 6.84e-08 58 33 3 107 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q5SML5 6.94e-08 58 35 2 108 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 6.94e-08 58 35 2 108 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q7A1J1 7.03e-08 56 28 2 125 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 7.03e-08 56 28 2 125 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 7.03e-08 56 28 2 125 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 7.03e-08 56 28 2 125 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 7.03e-08 56 28 2 125 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 7.03e-08 56 28 2 125 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 7.03e-08 56 28 2 125 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 7.03e-08 56 28 2 125 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 7.03e-08 56 28 2 125 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 7.03e-08 56 28 2 125 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q9KU36 7.05e-08 57 31 7 141 3 VC_0693 Uncharacterized response regulatory protein VC_0693 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P9WGM5 7.14e-08 56 37 2 107 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 7.14e-08 56 37 2 107 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9K998 7.83e-08 56 25 4 147 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2INJ8 7.88e-08 57 33 2 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
O29221 8.61e-08 57 33 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P32040 8.74e-08 56 28 2 131 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P43501 8.82e-08 53 31 1 105 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89SQ1 8.89e-08 57 33 4 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9KA55 9.46e-08 57 35 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8FZ93 9.48e-08 56 27 1 113 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 9.48e-08 56 27 1 113 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 9.48e-08 56 27 1 113 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 9.48e-08 56 27 1 113 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 9.48e-08 56 27 1 113 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 9.48e-08 56 27 1 113 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 9.48e-08 56 27 1 113 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 9.48e-08 56 27 1 113 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q4L6C6 9.56e-08 56 31 1 106 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q2RAP3 9.71e-08 55 28 6 147 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. japonica
Q4GZK2 9.71e-08 55 28 6 147 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. indica
Q02540 9.8e-08 56 33 2 103 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q8F3H4 1e-07 57 35 4 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62643 1e-07 57 35 4 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A6WZ81 1.02e-07 56 27 1 113 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q39T95 1.04e-07 57 31 3 111 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1SMR4 1.06e-07 57 31 5 132 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P40138 1.07e-07 57 33 2 103 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
A5W4E3 1.15e-07 58 33 3 107 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9F8D7 1.21e-07 58 29 1 107 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q167K9 1.27e-07 57 28 8 217 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5N6V8 1.28e-07 57 35 2 103 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q8ZBV2 1.33e-07 56 36 6 107 3 YPO3287 Uncharacterized response regulatory protein YPO3287/y0902/YP_0397 Yersinia pestis
Q8EF61 1.42e-07 57 34 2 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HVI0 1.43e-07 57 33 2 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q6K9T0 1.46e-07 53 31 2 117 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 1.46e-07 53 31 2 117 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q2RKH8 1.55e-07 57 30 10 222 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P0A4H8 1.62e-07 55 31 1 106 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 1.62e-07 55 31 1 106 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2RRX2 1.66e-07 57 34 3 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P69228 1.66e-07 55 24 2 149 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 1.66e-07 55 24 2 149 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8KIY1 1.77e-07 57 32 3 107 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q2T8Y5 1.78e-07 56 31 4 124 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2KCH8 1.84e-07 56 33 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6K8X6 1.92e-07 57 35 2 108 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q1IRH0 1.97e-07 56 30 4 146 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q9ZWS6 1.99e-07 54 28 2 125 1 ARR6 Two-component response regulator ARR6 Arabidopsis thaliana
Q87K77 2.1e-07 55 37 6 110 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B8AEH1 2.15e-07 57 35 2 108 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
O82868 2.17e-07 54 27 0 105 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
O25153 2.19e-07 57 26 2 119 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
O85128 2.22e-07 56 33 7 147 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q52883 2.32e-07 56 31 4 128 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q0HIF6 2.36e-07 56 33 2 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
Q56312 2.43e-07 52 26 1 103 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P52932 2.58e-07 54 32 3 118 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q20XE6 2.84e-07 56 35 3 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodopseudomonas palustris (strain BisB18)
Q3IDZ3 2.96e-07 56 30 7 148 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas translucida (strain TAC 125)
Q0D3B6 3.09e-07 56 29 2 106 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
A2YQ93 3.12e-07 56 29 2 106 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
P62636 3.84e-07 55 30 4 136 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P52934 3.86e-07 55 28 4 138 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_14195
Feature type CDS
Gene glnG
Product nitrogen regulation protein NR(I)
Location 56194 - 57648 (strand: -1)
Length 1455 (nucleotides) / 484 (amino acids)
In genomic island -

Contig

Accession ZDB_224
Length 134704 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_68
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2204 Signal transduction mechanisms (T) T DNA-binding transcriptional response regulator, NtrC family, contains REC, AAA-type ATPase, and a Fis-type DNA-binding domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07712 two-component system, NtrC family, nitrogen regulation response regulator GlnG Two-component system -

Protein Sequence

MQPGKIWVVDDDSAIRWVLERALSSAGYACVCFDSAENALAALNSGQPDVLISDIRMPGMDGLSLLATVKQHNPLLPVIIMTAHSDLDAAVNAYQQGAFDYLPKPFDIDDAVTLVARALEHYREQHLPVRQEAAADPVSGIIGESAAMQEVYRVIGRLSRSSISVLINGESGTGKELVAHALHHHSPRADAPFIALNMAAIPKDLIESELFGHEKGAFTGASQVRRGRFEQADGGSLFLDEIGDMPLDIQTRLLRVLAEGQFYRVGGYAPVKVDVRIIAATHQDLERLVAEGKFREDLFHRLNVIRMQLPPLRERPGDIPRLTRHFLQKTAKELGTEAKSLHPDTEALLMQLPWSGNVRQLENVCRWLTVMSATQEVLPQDLPADLTMTAAGEHIRSEHSHNPAAGNWDQQLAQWADAQLRAGKTDLLADALPLFERTLLQCALNYSNGHKQDAARLLGWGRNTLTRKLKEAGIDDTASTPETD

Flanking regions ( +/- flanking 50bp)

TATTTTCACTTTATCTGCCAATCCGTCAGTAAGCCTGTTGAGGAGGTCATATGCAGCCGGGAAAAATCTGGGTCGTTGATGATGACAGCGCGATCCGCTGGGTGCTCGAGCGCGCACTGAGCAGCGCCGGTTATGCCTGTGTCTGTTTTGACAGTGCTGAAAATGCCCTTGCGGCCCTGAACAGCGGACAGCCGGACGTGCTGATCTCCGATATCCGGATGCCGGGCATGGACGGCCTGTCTCTGCTGGCAACGGTCAAACAGCATAACCCGTTACTGCCGGTGATTATTATGACCGCCCATTCCGACCTGGATGCCGCAGTGAATGCTTACCAGCAGGGCGCGTTTGATTATCTGCCGAAACCGTTTGATATAGATGATGCGGTCACACTGGTGGCCCGCGCCCTGGAACATTACCGCGAGCAGCATCTGCCGGTACGGCAGGAAGCGGCCGCCGATCCGGTGTCCGGCATTATCGGTGAATCCGCTGCCATGCAGGAGGTATACCGGGTGATAGGCCGGTTATCCCGTTCCTCCATCAGTGTGCTGATTAACGGCGAATCCGGGACCGGGAAGGAGCTGGTGGCTCACGCCCTGCACCATCACAGCCCGCGGGCGGATGCACCGTTTATTGCTCTCAATATGGCGGCGATCCCGAAAGATTTGATTGAATCGGAACTCTTCGGCCATGAAAAAGGGGCATTTACCGGGGCATCACAGGTGCGCCGGGGGCGTTTTGAGCAGGCGGACGGCGGCTCGCTGTTTCTTGATGAAATCGGCGATATGCCGCTCGATATTCAGACACGGCTGCTGCGTGTGCTGGCGGAAGGCCAGTTTTACCGCGTCGGCGGTTACGCACCGGTGAAAGTGGATGTGAGGATTATTGCCGCCACCCATCAGGATCTGGAGCGGCTGGTGGCGGAAGGTAAATTCCGTGAAGACCTGTTCCACCGCCTGAATGTGATCCGCATGCAGCTGCCGCCGCTGCGGGAACGGCCGGGGGACATTCCGCGTCTGACACGCCATTTTCTGCAGAAAACCGCAAAAGAGCTGGGAACAGAAGCGAAAAGCCTGCATCCGGATACCGAAGCACTGCTGATGCAGTTGCCGTGGTCCGGCAACGTCCGCCAGCTGGAAAACGTCTGCCGCTGGCTGACCGTGATGTCCGCCACCCAGGAAGTGCTGCCGCAGGATCTGCCTGCCGACCTGACCATGACCGCCGCCGGAGAACATATCCGCAGTGAGCACAGCCATAATCCGGCAGCCGGAAACTGGGATCAGCAGCTGGCGCAGTGGGCGGATGCACAGTTACGGGCCGGGAAAACCGATCTGCTGGCGGATGCTCTGCCGCTGTTTGAACGCACCCTGTTACAGTGCGCACTGAATTACAGCAACGGACACAAGCAGGACGCGGCCCGCCTGCTGGGCTGGGGGCGCAATACGCTGACGCGGAAACTGAAAGAAGCCGGGATTGATGACACTGCATCAACCCCGGAAACAGATTAAATCACGCGGGAGAACTGACGCTGACGCATCTGGTTGCGCAGATAAGTATC