Homologs in group_68

Help

12 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10590 FBDBKF_10590 44.2 Morganella morganii S1 atoC acetoacetate metabolism transcriptional regulator AtoC
FBDBKF_12110 FBDBKF_12110 73.7 Morganella morganii S1 glnG nitrogen regulation protein NR(I)
EHELCC_14195 EHELCC_14195 73.7 Morganella morganii S2 glnG nitrogen regulation protein NR(I)
EHELCC_14925 EHELCC_14925 44.2 Morganella morganii S2 atoC acetoacetate metabolism transcriptional regulator AtoC
NLDBIP_14755 NLDBIP_14755 44.2 Morganella morganii S4 atoC acetoacetate metabolism transcriptional regulator AtoC
NLDBIP_15290 NLDBIP_15290 73.7 Morganella morganii S4 glnG nitrogen regulation protein NR(I)
LHKJJB_14590 LHKJJB_14590 44.2 Morganella morganii S3 atoC acetoacetate metabolism transcriptional regulator AtoC
LHKJJB_15320 LHKJJB_15320 73.7 Morganella morganii S3 glnG nitrogen regulation protein NR(I)
HKOGLL_13210 HKOGLL_13210 44.2 Morganella morganii S5 atoC acetoacetate metabolism transcriptional regulator AtoC
HKOGLL_14440 HKOGLL_14440 73.7 Morganella morganii S5 glnG nitrogen regulation protein NR(I)
F4V73_RS14300 F4V73_RS14300 44.4 Morganella psychrotolerans atoC acetoacetate metabolism transcriptional regulator AtoC
F4V73_RS14530 F4V73_RS14530 72.3 Morganella psychrotolerans glnG nitrogen regulation protein NR(I)

Distribution of the homologs in the orthogroup group_68

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_68

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P28787 0.0 900 91 0 473 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P41789 0.0 721 73 2 471 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFB8 0.0 717 72 2 471 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 0.0 717 72 2 471 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P03029 0.0 712 72 3 474 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P10577 8.58e-146 428 44 6 484 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45671 9.32e-136 402 44 5 484 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q04848 2.34e-134 399 42 5 480 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P10576 1.64e-133 397 42 4 481 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q06065 8.57e-119 358 40 3 469 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q9APD9 3.43e-113 343 42 5 461 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P14375 1.52e-111 339 41 4 463 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P25852 3.13e-110 336 41 4 467 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X613 3.17e-110 336 41 5 463 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q8Z333 1.73e-109 334 41 4 467 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q00934 1.52e-106 327 38 6 471 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87MX7 3.82e-104 321 39 4 461 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MM78 7.67e-103 317 43 1 389 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 7.67e-103 317 43 1 389 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P0C5S5 8.82e-103 317 39 4 461 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 8.82e-103 317 39 4 461 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q9KT84 3.44e-101 313 39 4 460 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0AFU5 9.39e-101 311 38 7 481 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 9.39e-101 311 38 7 481 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q9HU19 8.3e-94 294 37 4 472 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I4N3 7.56e-93 292 36 4 466 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04849 8.25e-91 286 33 6 471 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P13632 1.8e-89 283 38 1 364 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P17899 2.84e-85 272 36 9 438 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P23747 2.42e-83 267 38 2 381 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P12626 1.3e-82 268 41 1 332 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P10046 1.78e-82 265 38 1 361 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q88RJ6 2.94e-82 264 36 4 449 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O25408 6.61e-82 261 35 4 380 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q88AQ2 1.31e-80 260 34 3 448 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P09570 1.42e-79 259 54 1 232 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P29267 7.12e-79 256 33 8 497 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P56266 3.25e-78 256 53 1 237 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P03027 3.5e-78 256 53 1 237 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P27713 3.78e-78 256 40 4 373 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P12627 5.04e-78 255 42 2 327 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P54930 1.26e-77 254 53 1 232 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P71229 8.58e-76 253 41 5 339 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
G3XCV0 3.63e-75 247 37 10 458 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q43965 8.82e-75 248 40 4 338 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q9ZCY9 1.76e-74 244 30 8 477 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q46802 4.67e-74 247 41 4 333 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P09432 6.82e-74 243 33 13 484 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P06519 9.6e-74 245 41 4 330 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P26047 1.41e-73 246 41 4 336 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q4UL27 1.48e-73 242 29 7 477 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P09133 4.19e-73 245 45 2 279 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P30667 6.51e-73 244 37 6 385 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54929 7.31e-73 244 38 7 383 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P24426 7.5e-73 236 46 1 254 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
Q845S7 7.78e-73 237 40 3 340 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
Q68WH4 1.53e-72 239 29 8 477 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RJS1 2.19e-72 239 30 7 474 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
A4STH5 4.85e-72 239 47 1 255 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q53206 1.59e-71 240 40 4 342 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
E1WAA4 2.02e-71 242 39 6 372 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P0CL46 3.44e-71 241 39 6 372 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19323 6.76e-71 241 40 6 372 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P05407 6.92e-71 238 49 1 242 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P31908 1.15e-70 235 34 7 488 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0CY94 1.19e-70 238 45 2 267 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
D5ARW9 1.24e-70 238 45 2 267 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P54931 2.86e-70 236 42 2 293 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5E3W8 3.43e-70 234 43 4 294 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KEJ0 4.56e-70 234 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3K999 4.96e-70 230 40 4 330 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q92HC2 5.34e-70 233 30 9 478 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P77743 2.54e-69 233 38 10 395 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P74839 4.75e-69 232 40 8 349 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A4WDR5 8.76e-69 231 39 3 333 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
Q8Z4C6 1.01e-68 231 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.01e-68 231 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.01e-68 231 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.01e-68 231 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
A8ANR6 1.11e-68 230 40 3 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5PF20 1.15e-68 230 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDG4 1.15e-68 230 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4T3B0 3.06e-68 229 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
A9MFX7 3.58e-68 229 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F363 3.58e-68 229 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
Q8D4F9 3.74e-68 229 39 4 339 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
O87455 4.2e-68 229 36 11 448 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C0PWN2 4.38e-68 229 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5FSZ0 4.52e-68 229 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
Q8ZMJ8 4.81e-68 229 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 4.81e-68 229 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
B7UHC1 5.79e-68 228 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FEN6 6.71e-68 228 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MZ04 7e-68 228 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
O85057 8.95e-68 229 41 7 329 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q7MFY9 1.06e-67 228 38 4 344 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
B1LQ27 1.07e-67 228 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
Q6D8R9 1.12e-67 228 39 2 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3YYF5 1.19e-67 228 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
Q01265 1.21e-67 221 41 2 256 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q1R7Z1 1.73e-67 227 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 1.73e-67 227 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 1.73e-67 227 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LW25 1.79e-67 227 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I695 2.07e-67 227 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B4TF23 2.13e-67 227 40 4 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
Q0TEH1 2.33e-67 227 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LEC0 3.33e-67 226 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
A7ZQD8 3.9e-67 226 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N6T9 4.11e-67 226 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8A3I6 4.52e-67 226 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B7M9E6 4.52e-67 226 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
B1IUX0 4.57e-67 226 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 5.19e-67 226 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
P37013 1.23e-66 225 40 5 337 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.23e-66 225 40 5 337 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.23e-66 225 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B5Z370 1.57e-66 224 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 1.57e-66 224 40 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
B7NSI9 4.26e-66 223 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P59402 5.21e-66 223 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 5.21e-66 223 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q32CL9 5.21e-66 223 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
Q9ZIB7 3.92e-65 221 37 6 373 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
A6TCX4 5.33e-65 221 46 1 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P09828 1.73e-64 219 43 3 274 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
A8GG93 1.97e-64 219 48 0 224 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B5XVA2 4.21e-64 219 46 1 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P54529 9.85e-64 221 46 3 250 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q9KN48 1.96e-63 217 38 3 342 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P07604 2.28e-62 214 38 6 345 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P0A2D7 2.53e-62 214 37 4 348 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 2.53e-62 214 37 4 348 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P03028 2.83e-62 214 39 8 373 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
O54426 2.87e-62 214 38 4 344 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P37344 6.64e-62 207 46 1 227 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
Q9K4U8 6.96e-62 213 38 2 334 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O31551 1.44e-61 214 35 7 367 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P28614 2.01e-61 215 39 7 351 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P38022 2.14e-57 199 37 5 329 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q9K4V0 3.14e-55 195 46 0 226 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P36219 4.79e-50 176 41 2 236 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P37931 1.27e-48 172 43 1 209 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P26316 2.11e-48 171 42 1 209 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P37930 8.06e-47 167 42 1 201 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P26408 1.21e-43 163 27 10 495 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P44694 1.45e-43 159 35 4 280 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54156 4.93e-35 136 33 5 254 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P76016 1.68e-34 140 30 5 313 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P38035 5.28e-34 137 37 4 226 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 1.93e-32 134 29 6 327 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P06184 2.68e-25 110 22 8 455 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55610 1.36e-22 104 25 6 349 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P23221 3.06e-21 94 37 1 137 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P23914 2.47e-18 92 31 10 245 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
D0ZLR9 4.77e-17 87 32 5 180 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
A0PWB4 2.35e-16 81 31 2 154 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q742C1 2.52e-16 81 32 3 154 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.52e-16 81 32 3 154 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A1KHB7 2.69e-16 81 32 3 154 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 2.69e-16 81 32 3 154 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0R3I8 2.8e-16 81 31 4 164 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGM9 4.06e-16 80 31 2 154 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 4.06e-16 80 31 2 154 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 4.06e-16 80 31 2 154 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8KR08 5.18e-16 80 31 1 133 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q9CD68 7.72e-16 80 32 3 148 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q3LWR6 1.67e-15 79 30 2 138 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.67e-15 79 30 2 138 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.67e-15 79 30 2 138 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P08368 2.31e-15 78 30 0 129 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
A1TEL7 2.47e-15 78 31 3 148 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P06628 2.59e-15 75 37 2 112 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
O87940 5.37e-15 77 34 0 120 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
P52942 9.82e-15 73 35 2 110 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
P15940 3.37e-14 75 27 1 154 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1B3X8 4.95e-14 74 28 0 125 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 4.95e-14 74 28 0 125 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 4.95e-14 74 28 0 125 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P10958 6.38e-14 73 29 1 144 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q2FWH6 1.75e-13 73 29 1 132 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q99U73 3.12e-13 72 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P26487 3.65e-13 72 34 0 120 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q82EB1 3.79e-13 72 28 1 139 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A0A4P7TS68 4.08e-13 72 31 1 126 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 4.08e-13 72 31 1 126 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 4.08e-13 72 31 1 126 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 4.08e-13 72 31 1 126 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 4.08e-13 72 31 1 126 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 4.08e-13 72 31 1 126 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 4.08e-13 72 31 1 126 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 4.08e-13 72 31 1 126 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P0C001 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 4.45e-13 71 35 3 129 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 4.45e-13 71 35 3 129 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P51586 4.81e-13 69 33 1 124 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P36556 1.2e-12 70 32 0 130 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45337 1.49e-12 70 33 0 114 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O78428 4.06e-12 69 32 1 104 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P28835 4.41e-12 69 33 1 106 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
G3XCY6 4.71e-12 69 35 1 113 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7D9K0 5.45e-12 69 30 1 130 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 5.45e-12 69 30 1 130 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8CQK0 6.24e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 6.24e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9ZEP4 6.58e-12 68 28 1 128 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7A216 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 6.6e-12 68 28 2 139 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 6.6e-12 68 28 2 139 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 6.6e-12 68 28 2 139 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 6.6e-12 68 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
O34903 6.78e-12 68 31 0 119 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P48259 9.13e-12 68 30 2 134 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P0C5S3 9.16e-12 67 31 1 114 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
O69730 1.02e-11 68 28 0 111 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A6UEL7 1.43e-11 67 31 1 114 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q4LAJ9 1.65e-11 67 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q8Z7H2 2.15e-11 67 33 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q83RR0 2.28e-11 67 33 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 2.28e-11 67 33 0 108 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DM78 2.32e-11 67 33 0 108 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 2.32e-11 67 33 0 108 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 2.32e-11 67 33 0 108 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 2.32e-11 67 33 0 108 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 2.32e-11 67 33 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC3 2.78e-11 66 33 0 108 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
P31079 3.88e-11 66 33 3 115 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0A4I0 3.97e-11 66 35 0 111 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 3.97e-11 66 35 0 111 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q4A160 4.22e-11 66 28 2 139 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1XDC9 4.42e-11 66 32 1 105 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P23836 5e-11 65 32 0 108 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
P96602 5.33e-11 65 25 6 184 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P13792 5.62e-11 66 29 1 130 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P62645 5.85e-11 67 38 4 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P51358 5.91e-11 66 32 1 105 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
L7N689 7.56e-11 65 29 0 108 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q04942 8.18e-11 65 32 1 102 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B8H358 8.45e-11 65 25 0 122 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 8.45e-11 65 25 0 122 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q89SQ1 1.03e-10 66 34 6 128 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8X738 1.03e-10 65 33 0 108 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P37478 1.47e-10 64 28 4 138 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P21866 1.57e-10 64 28 1 125 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P42421 1.58e-10 64 33 1 116 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P42508 1.64e-10 63 28 1 114 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P0CL17 1.88e-10 64 29 1 126 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.88e-10 64 29 1 126 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q7CQM8 2.34e-10 63 29 0 117 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGN1 2.36e-10 63 32 4 142 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 2.36e-10 63 32 4 142 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1XDE4 2.42e-10 63 24 6 197 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
Q44006 3.23e-10 63 27 2 136 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P72781 3.33e-10 63 26 3 154 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P28257 3.34e-10 63 31 1 105 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q47456 3.37e-10 63 26 1 135 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P30843 3.7e-10 63 30 0 130 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q4L6C6 3.78e-10 63 31 3 130 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
O05251 4.09e-10 63 30 4 136 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
P9WGM1 4.21e-10 63 29 1 115 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 4.21e-10 63 29 1 115 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 4.21e-10 63 29 1 115 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q04803 7.01e-10 63 33 1 103 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DPL7 7.34e-10 62 29 1 102 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 7.34e-10 62 29 1 102 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 7.34e-10 62 29 1 102 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q5HLN2 7.93e-10 62 29 1 119 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN92 8.39e-10 62 29 1 119 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q93P00 9.97e-10 59 36 3 104 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q8D0P1 1.45e-09 59 36 3 104 3 cheY Chemotaxis protein CheY Yersinia pestis
Q8GP20 1.7e-09 61 32 0 109 1 rssB Swarming motility regulation protein RssB Serratia marcescens
Q49XM7 2.07e-09 61 32 2 124 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P24072 2.11e-09 58 26 1 115 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q50136 2.33e-09 61 29 1 115 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
O82868 2.37e-09 60 27 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q9K998 2.68e-09 60 35 2 102 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q20XE6 3.01e-09 62 26 5 203 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodopseudomonas palustris (strain BisB18)
Q8H7S7 3.9e-09 62 37 2 107 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
Q9TLQ4 3.93e-09 60 28 1 101 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
A2XE31 4.33e-09 62 37 2 107 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
Q07783 4.77e-09 60 31 1 102 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P37740 5.41e-09 59 31 1 105 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
P35163 5.42e-09 60 29 2 117 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P23620 5.69e-09 60 29 1 108 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31432 6.22e-09 59 29 2 122 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
O49397 7.16e-09 61 35 2 107 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
O32192 7.49e-09 59 30 3 102 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
O25918 7.66e-09 59 30 2 130 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q2T8Y6 8.65e-09 60 36 4 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P0DMC5 9.7e-09 61 33 1 120 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q49ZT8 1.11e-08 58 31 1 115 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P50350 1.19e-08 59 32 1 102 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q8FGP6 1.33e-08 56 35 3 104 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5JF95 1.38e-08 60 34 4 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9ZWJ9 1.41e-08 60 31 5 145 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
P9WGM3 1.47e-08 58 30 4 123 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.47e-08 58 30 4 123 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8F3H4 1.59e-08 60 36 4 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62643 1.59e-08 60 36 4 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q52990 1.61e-08 58 28 1 113 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q7A1J1 1.63e-08 58 26 2 140 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.63e-08 58 26 2 140 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.63e-08 58 26 2 140 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.63e-08 58 26 2 140 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.63e-08 58 26 2 140 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.63e-08 58 26 2 140 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.63e-08 58 26 2 140 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.63e-08 58 26 2 140 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.63e-08 58 26 2 140 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.63e-08 58 26 2 140 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P0DMC6 2.12e-08 60 33 1 120 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q2SFK0 2.16e-08 59 37 4 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q31S42 2.21e-08 58 27 1 115 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P50351 2.24e-08 58 32 1 102 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0A2D5 2.31e-08 55 34 3 104 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 2.31e-08 55 34 3 104 3 cheY Chemotaxis protein CheY Salmonella typhi
P48359 2.42e-08 57 25 6 205 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q8FZ93 2.49e-08 58 23 0 130 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 2.49e-08 58 23 0 130 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 2.49e-08 58 23 0 130 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 2.49e-08 58 23 0 130 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 2.49e-08 58 23 0 130 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 2.49e-08 58 23 0 130 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 2.49e-08 58 23 0 130 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 2.49e-08 58 23 0 130 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P52931 2.51e-08 57 26 8 184 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
A6WZ81 2.56e-08 58 23 0 130 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q53228 2.7e-08 57 26 0 107 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q70FH0 2.83e-08 57 27 2 159 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P62598 3e-08 59 35 2 107 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P45607 3.24e-08 57 29 1 112 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q5N6V8 3.31e-08 59 30 4 137 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
P0AE69 3.31e-08 55 34 3 104 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 3.31e-08 55 34 3 104 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 3.31e-08 55 34 3 104 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q9FAD7 3.41e-08 55 33 3 104 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q8L9Y3 3.57e-08 58 33 1 103 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
P45606 3.69e-08 57 29 1 112 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0AFJ5 3.69e-08 57 29 1 112 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 3.69e-08 57 29 1 112 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
O33558 3.72e-08 58 38 2 71 1 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Cereibacter sphaeroides
B8GZM2 4.03e-08 58 30 3 121 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 4.03e-08 58 30 3 121 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P58662 4.16e-08 59 32 0 104 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q93CB8 4.31e-08 57 29 1 101 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q3J653 4.4e-08 58 38 2 71 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q56128 4.54e-08 59 32 0 104 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P9WGM7 4.73e-08 57 29 1 101 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 4.73e-08 57 29 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 4.73e-08 57 29 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P43501 4.8e-08 54 31 1 116 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9CCJ2 4.91e-08 57 29 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P26275 4.98e-08 57 31 3 124 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O58192 5.1e-08 58 31 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P32040 5.23e-08 57 27 3 139 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8CQ17 5.45e-08 57 30 1 99 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 5.45e-08 57 30 1 99 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P33112 5.5e-08 57 28 5 132 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
P45605 5.56e-08 57 30 1 112 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
Q10WZ6 5.72e-08 58 25 5 200 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P39663 6.26e-08 57 30 4 143 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0DOA0 6.31e-08 58 28 2 107 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
Q940D0 6.33e-08 58 35 3 107 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
A0QTK2 7.13e-08 56 29 1 101 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8XBS3 7.33e-08 56 29 0 108 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q9FGT7 7.36e-08 58 39 1 76 2 ARR18 Two-component response regulator ARR18 Arabidopsis thaliana
P0AE90 8.05e-08 56 37 6 128 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 8.05e-08 56 37 6 128 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 8.05e-08 56 37 6 128 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P66795 8.2e-08 56 28 2 149 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 8.2e-08 56 28 2 149 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q9ZHD3 8.59e-08 56 29 3 112 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q2INJ8 8.59e-08 57 33 2 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3IRR4 9.13e-08 57 31 3 101 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A0A0H3GGB5 1.03e-07 56 36 8 151 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q0HVI0 1.03e-07 57 34 4 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q97GZ3 1.04e-07 57 25 7 207 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P52932 1.05e-07 55 33 4 116 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
P0A4H5 1.15e-07 53 35 0 71 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 1.15e-07 53 35 0 71 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P0DMK7 1.16e-07 56 28 1 111 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 1.16e-07 56 28 1 111 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q1IRH0 1.17e-07 57 32 2 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
P0A4H8 1.21e-07 55 33 2 92 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 1.21e-07 55 33 2 92 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7A0U4 1.34e-07 56 27 4 131 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.34e-07 56 27 4 131 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.34e-07 56 27 4 131 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.34e-07 56 27 4 131 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.34e-07 56 27 4 131 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.34e-07 56 27 4 131 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.34e-07 56 27 4 131 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.34e-07 56 27 4 131 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
O29221 1.38e-07 57 31 3 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9RC52 1.41e-07 55 29 2 106 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7Y0W3 1.46e-07 57 26 5 161 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
Q02540 1.47e-07 55 25 0 112 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
P0A4I4 1.51e-07 56 26 6 187 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 1.51e-07 56 26 6 187 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P52929 1.52e-07 55 29 2 124 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q7Y0W5 1.54e-07 57 26 5 161 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
Q0HIF6 1.59e-07 57 34 4 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
Q8EF61 1.66e-07 56 34 4 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P94413 1.67e-07 55 25 4 166 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P13800 1.85e-07 55 31 2 115 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q9LYP5 1.87e-07 57 26 4 178 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q9UYF3 1.89e-07 56 30 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q51455 1.9e-07 53 32 2 104 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52076 2.13e-07 55 29 0 108 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q01473 2.17e-07 57 30 0 110 3 rcaC Protein RcaC Microchaete diplosiphon
P54443 2.25e-07 55 29 3 129 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q7MBQ5 2.26e-07 56 32 6 131 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
Q55890 2.61e-07 55 29 4 113 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2YZ24 2.75e-07 54 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
O06978 2.82e-07 55 27 1 124 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q9AE24 3.15e-07 54 22 1 138 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
A1W0A5 3.19e-07 52 31 3 105 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 3.19e-07 52 31 3 105 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 3.19e-07 52 31 3 105 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8D4X6 3.24e-07 55 32 6 131 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
Q6K8X6 3.24e-07 56 33 2 107 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
B8AEH1 3.42e-07 56 33 2 107 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q8F6P9 3.51e-07 55 24 6 189 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 3.51e-07 55 24 6 189 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q5A4X5 3.92e-07 56 25 0 137 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
A8R3S7 4.1e-07 54 24 2 180 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
Q39SY1 4.35e-07 55 28 3 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q9FXD6 4.39e-07 55 33 2 103 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P42244 4.96e-07 54 27 5 165 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q06239 5.81e-07 53 27 2 122 3 vanR Regulatory protein VanR Enterococcus faecium
Q9HV32 5.86e-07 53 35 2 96 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6H805 6.33e-07 55 34 2 102 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 6.67e-07 55 34 2 102 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
P52928 6.8e-07 54 26 7 189 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q5SML5 7e-07 55 32 2 107 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 7.06e-07 55 32 2 107 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q9I4F9 7.39e-07 53 23 2 162 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62635 8.15e-07 54 31 5 129 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q56312 8.94e-07 51 25 1 102 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P0DMI2 9.57e-07 54 31 3 102 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4K0 9.57e-07 54 31 3 102 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P52934 1.02e-06 53 30 3 110 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q7A039 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.06e-06 53 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9KU36 1.07e-06 53 27 4 135 3 VC_0693 Uncharacterized response regulatory protein VC_0693 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9K621 1.07e-06 53 22 3 162 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O87717 1.15e-06 54 31 5 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8EEQ0 1.16e-06 54 34 5 110 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P38684 1.28e-06 53 25 2 128 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P62636 1.38e-06 53 32 5 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q30RX5 1.39e-06 53 31 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q888V8 1.46e-06 53 32 4 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P39486 1.5e-06 52 27 3 121 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q3ADG9 1.53e-06 53 30 3 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P62639 1.6e-06 53 26 3 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q6GE73 1.61e-06 52 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q2KCH7 1.63e-06 50 31 2 117 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q30ZJ5 1.66e-06 53 30 4 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7NZB3 1.7e-06 53 28 4 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4ZYD3 1.71e-06 53 31 5 125 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. syringae (strain B728a)
Q24T61 1.72e-06 53 33 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
Q1MLG8 1.74e-06 53 29 6 148 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q3SVA1 1.76e-06 53 32 2 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q6LU34 1.8e-06 53 27 7 195 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Photobacterium profundum (strain SS9)
A6QJK3 1.94e-06 52 28 1 128 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.94e-06 52 28 1 128 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P0AEV3 1.96e-06 53 29 0 100 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.96e-06 53 29 0 100 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.96e-06 53 29 0 100 3 rssB Regulator of RpoS Escherichia coli O157:H7
P94504 1.97e-06 52 24 4 157 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q9ZM64 2.12e-06 50 29 3 103 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q39QJ2 2.15e-06 53 31 3 107 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P71403 2.31e-06 50 29 3 103 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q39KQ1 2.31e-06 53 27 8 213 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q47GX7 2.32e-06 53 33 4 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Dechloromonas aromatica (strain RCB)
P62638 2.35e-06 53 32 3 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9WY30 2.35e-06 53 25 2 117 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14255
Feature type CDS
Gene glnG
Product nitrogen regulation protein NR(I)
Location 3163007 - 3164428 (strand: 1)
Length 1422 (nucleotides) / 473 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_68
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2204 Signal transduction mechanisms (T) T DNA-binding transcriptional response regulator, NtrC family, contains REC, AAA-type ATPase, and a Fis-type DNA-binding domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07712 two-component system, NtrC family, nitrogen regulation response regulator GlnG Two-component system -

Protein Sequence

MQKGNIWVVDDDSSIRWVLERAITREGLTCKTFEHANDVLSALNSELPDVLLSDIRMPDIDGLSLLKSVKEQHPTLPVIIMTAHSDLDAAVNAYQQGAFDYLPKPFDIDDTLALIHRAITHYREQKQPNTTETNLQSVSDMIGEAPAMQEVYRIIGRLSRSSISVLINGESGTGKELVAHALHRHSPRAQAPFIALNMAAIPKDLIESELFGHEKGAFTGASQVRQGRFEQANGGSLFLDEIGDMPLDIQTRLLRVLAEGQFYRVGGYAPVKVDVRIIAATHQDLEKRVMEGDFREDLYHRLNVIRIQLPPLRDRTEDIPSLARYFLQKTARELGVETKVLHQQSLHCMMEYHWSGNVRQLENVCRWLTVMTASQEIMPQDLPQEIRQSDEKSKSIPRVSSQHWSQHLSLWADEVFSEGKENILNDALPQFERTLLLSALSYTKGHKQDAARLLGWGRNTLTRKLKELGIEEF

Flanking regions ( +/- flanking 50bp)

GGGAAATACCGAGTTTTCTATTTACTTGCCAATAAAATAGGAGATAACCAATGCAAAAAGGAAATATATGGGTTGTCGATGATGATAGCTCTATTCGCTGGGTACTTGAGCGAGCCATTACACGAGAAGGCCTTACATGTAAAACCTTCGAACACGCTAATGACGTCCTCAGTGCACTCAATAGTGAACTTCCCGATGTATTATTATCAGATATTCGTATGCCTGATATTGATGGTTTATCTCTATTAAAAAGCGTTAAAGAGCAACACCCTACGTTGCCGGTTATTATCATGACAGCGCATTCTGATCTTGATGCCGCGGTAAATGCTTATCAGCAAGGGGCATTTGATTATCTCCCCAAGCCTTTTGATATTGATGATACACTTGCACTCATTCATCGTGCTATTACGCACTATCGAGAGCAAAAACAACCTAATACAACAGAAACTAACCTTCAATCTGTCTCTGACATGATTGGCGAAGCCCCTGCGATGCAAGAGGTTTATCGCATTATTGGCCGCCTTTCTCGCTCATCAATTAGTGTGCTTATCAATGGCGAGTCGGGTACTGGTAAAGAATTAGTTGCACATGCTCTTCATCGCCATAGTCCGAGAGCACAAGCCCCTTTTATTGCACTCAATATGGCGGCTATTCCCAAAGACTTAATTGAATCAGAACTTTTTGGTCATGAAAAAGGGGCATTTACTGGTGCATCTCAAGTACGCCAAGGCCGTTTTGAACAAGCAAATGGCGGTTCCCTCTTTCTTGATGAAATTGGCGATATGCCACTGGATATTCAAACCCGCTTATTACGCGTCTTGGCTGAAGGACAATTTTATCGTGTTGGCGGTTATGCCCCTGTGAAAGTCGATGTGCGTATTATTGCCGCGACTCATCAAGACTTAGAAAAACGCGTAATGGAAGGTGATTTTCGTGAAGATCTCTACCATCGACTCAATGTAATACGTATTCAATTGCCCCCACTGCGTGATAGAACAGAAGATATTCCAAGCTTAGCGCGTTATTTTCTCCAAAAAACCGCTCGAGAGCTTGGTGTTGAAACCAAAGTGCTCCACCAGCAAAGTTTACATTGCATGATGGAATACCACTGGTCAGGTAACGTCAGACAATTAGAAAACGTATGTCGTTGGTTAACGGTTATGACCGCTAGCCAAGAGATTATGCCGCAAGATTTACCTCAAGAGATCCGCCAATCAGATGAGAAGAGCAAATCGATACCTCGAGTCTCCTCTCAACATTGGTCACAACATCTTTCATTATGGGCGGATGAGGTATTCAGTGAAGGCAAAGAAAATATTCTTAATGACGCTCTACCGCAATTTGAGCGCACCTTACTACTCAGTGCGCTTTCCTATACAAAAGGCCATAAACAAGATGCTGCTCGTTTATTAGGATGGGGAAGAAATACGCTGACACGTAAATTAAAAGAGTTAGGTATAGAGGAGTTTTAAGTCACTCCCCTCCCTTTTATTTTTGCCCACTAAATCACTCGAGAGAATTG