Homologs in group_44

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01050 FBDBKF_01050 100.0 Morganella morganii S1 hisS histidine--tRNA ligase
FBDBKF_09165 FBDBKF_09165 51.5 Morganella morganii S1 hisS histidine--tRNA ligase
EHELCC_00495 EHELCC_00495 100.0 Morganella morganii S2 hisS histidine--tRNA ligase
EHELCC_10245 EHELCC_10245 51.5 Morganella morganii S2 hisS histidine--tRNA ligase
NLDBIP_02965 NLDBIP_02965 100.0 Morganella morganii S4 hisS histidine--tRNA ligase
NLDBIP_10590 NLDBIP_10590 51.5 Morganella morganii S4 hisS histidine--tRNA ligase
LHKJJB_04480 LHKJJB_04480 100.0 Morganella morganii S3 hisS histidine--tRNA ligase
LHKJJB_10765 LHKJJB_10765 51.5 Morganella morganii S3 hisS histidine--tRNA ligase
HKOGLL_13825 HKOGLL_13825 51.5 Morganella morganii S5 hisS histidine--tRNA ligase
F4V73_RS07125 F4V73_RS07125 93.4 Morganella psychrotolerans hisS histidine--tRNA ligase
F4V73_RS10785 F4V73_RS10785 51.2 Morganella psychrotolerans hisS histidine--tRNA ligase
PMI_RS09100 PMI_RS09100 80.3 Proteus mirabilis HI4320 hisS histidine--tRNA ligase

Distribution of the homologs in the orthogroup group_44

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_44

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZT2 0.0 725 80 1 427 3 hisS Histidine--tRNA ligase Proteus mirabilis (strain HI4320)
Q7N705 0.0 717 79 1 425 3 hisS Histidine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A9MHL6 0.0 696 77 2 426 3 hisS Histidine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O52765 0.0 692 77 2 426 1 hisS Histidine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYN1 0.0 692 77 2 426 3 hisS Histidine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
A9N202 0.0 692 77 2 426 3 hisS Histidine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q1R8L9 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LNG9 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
P60906 0.0 691 77 2 426 1 hisS Histidine--tRNA ligase Escherichia coli (strain K12)
B1IWE7 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60907 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEX1 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE52 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O1:K1 / APEC
A8A320 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O9:H4 (strain HS)
B1XAY9 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / DH10B)
C4ZX89 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7L8 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O8 (strain IAI1)
B7MYE9 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O81 (strain ED1a)
B7NRG4 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0Y3 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60908 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7
B7LCQ4 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain 55989 / EAEC)
B7MHZ9 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPV7 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
B4T0P8 0.0 691 76 2 426 3 hisS Histidine--tRNA ligase Salmonella newport (strain SL254)
B5R581 0.0 691 76 2 426 3 hisS Histidine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FR62 0.0 691 76 2 426 3 hisS Histidine--tRNA ligase Salmonella dublin (strain CT_02021853)
B7LKC4 0.0 691 76 2 430 3 hisS Histidine--tRNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7UGW0 0.0 691 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3YZ38 0.0 690 77 2 426 3 hisS Histidine--tRNA ligase Shigella sonnei (strain Ss046)
B4TR94 0.0 690 76 2 426 3 hisS Histidine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B4TD92 0.0 690 76 2 426 3 hisS Histidine--tRNA ligase Salmonella heidelberg (strain SL476)
B5F197 0.0 690 76 2 426 3 hisS Histidine--tRNA ligase Salmonella agona (strain SL483)
B6I586 0.0 690 77 2 426 3 hisS Histidine--tRNA ligase Escherichia coli (strain SE11)
B5BAY6 0.0 689 76 2 426 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNI1 0.0 689 76 2 426 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7N6A2 0.0 689 76 2 426 3 hisS Histidine--tRNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8Z4P4 0.0 689 76 2 426 3 hisS Histidine--tRNA ligase Salmonella typhi
Q57LI7 0.0 689 76 2 426 3 hisS Histidine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
Q32D48 0.0 688 76 2 426 3 hisS Histidine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
B5XNL6 0.0 687 76 2 426 3 hisS Histidine--tRNA ligase Klebsiella pneumoniae (strain 342)
Q83K44 0.0 686 76 2 426 3 hisS Histidine--tRNA ligase Shigella flexneri
B5RCZ1 0.0 686 76 2 426 3 hisS Histidine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B2TXT9 0.0 686 76 2 426 3 hisS Histidine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A4WD92 0.0 685 76 2 426 3 hisS Histidine--tRNA ligase Enterobacter sp. (strain 638)
Q31XX6 0.0 683 76 2 426 3 hisS Histidine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
B2VE90 0.0 681 77 2 415 3 hisS Histidine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BET0 0.0 679 76 2 426 3 hisS Histidine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
C6DBH3 0.0 677 75 2 425 3 hisS Histidine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1JKS3 0.0 677 76 2 426 3 hisS Histidine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q6D277 0.0 677 75 2 425 3 hisS Histidine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7FFZ0 0.0 674 76 2 426 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GHW4 0.0 674 74 2 426 3 hisS Histidine--tRNA ligase Serratia proteamaculans (strain 568)
B1JS06 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A0 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMT6 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CK90 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R801 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCT6 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pestis
B2K9P9 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5I9 0.0 672 75 2 426 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
Q2NS41 0.0 660 73 2 426 3 hisS Histidine--tRNA ligase Sodalis glossinidius (strain morsitans)
P62373 0.0 625 68 2 425 3 hisS Histidine--tRNA ligase Photobacterium profundum (strain SS9)
C3LT13 0.0 624 69 2 424 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTX0 0.0 624 69 2 424 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3G1 0.0 624 69 2 424 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FAX3 0.0 624 68 2 425 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E771 0.0 624 68 2 425 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MNF0 0.0 618 67 2 425 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain YJ016)
Q8DEZ9 0.0 618 67 2 425 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain CMCP6)
A7MZE2 0.0 591 64 2 425 3 hisS Histidine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q87S15 0.0 587 64 2 425 3 hisS Histidine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4SP01 0.0 583 66 3 413 3 hisS Histidine--tRNA ligase Aeromonas salmonicida (strain A449)
A0KJ45 0.0 582 66 3 413 3 hisS Histidine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7VJT9 0.0 581 63 2 425 3 hisS Histidine--tRNA ligase Vibrio atlanticus (strain LGP32)
C4LC38 0.0 579 65 3 425 3 hisS Histidine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P57988 0.0 576 66 3 414 3 hisS Histidine--tRNA ligase Pasteurella multocida (strain Pm70)
Q8EC33 0.0 575 64 4 427 3 hisS Histidine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RHQ4 0.0 573 64 3 425 3 hisS Histidine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y8T9 0.0 573 64 3 425 3 hisS Histidine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q65R83 0.0 572 65 2 414 3 hisS Histidine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q12PT3 0.0 572 63 4 428 3 hisS Histidine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B0USG9 0.0 572 65 2 410 3 hisS Histidine--tRNA ligase Histophilus somni (strain 2336)
Q0HKV8 0.0 571 65 3 425 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-4)
B8CKR2 0.0 571 63 3 426 3 hisS Histidine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
A0KUJ6 0.0 571 65 3 425 3 hisS Histidine--tRNA ligase Shewanella sp. (strain ANA-3)
Q0I2E8 0.0 571 65 2 410 3 hisS Histidine--tRNA ligase Histophilus somni (strain 129Pt)
Q0HX56 0.0 570 65 3 425 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-7)
Q4QNH3 0.0 569 64 3 413 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
P43823 0.0 569 64 3 413 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q085U5 0.0 568 64 4 428 3 hisS Histidine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
A5UAB7 0.0 564 64 3 413 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittEE)
A5UGH2 0.0 563 64 3 413 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittGG)
A6WQP6 0.0 563 63 4 427 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS185)
A3D6V8 0.0 563 63 4 427 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9S8 0.0 563 63 4 427 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS223)
A9KXK7 0.0 563 63 4 427 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS195)
A8H246 0.0 561 62 3 426 3 hisS Histidine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TLI5 0.0 561 62 3 426 3 hisS Histidine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
Q3ICZ6 0.0 560 63 4 427 3 hisS Histidine--tRNA ligase Pseudoalteromonas translucida (strain TAC 125)
B3GY63 0.0 560 62 3 424 3 hisS Histidine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A6VQX5 0.0 559 63 3 414 3 hisS Histidine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A8FT71 0.0 558 60 4 428 3 hisS Histidine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
Q7VME1 0.0 553 62 3 424 3 hisS Histidine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A3QCG3 0.0 551 62 5 427 3 hisS Histidine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KKJ3 0.0 550 62 3 424 3 hisS Histidine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A1S862 0.0 550 61 4 427 3 hisS Histidine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B4RV88 0.0 548 61 3 426 3 hisS Histidine--tRNA ligase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q15R57 0.0 543 60 4 427 3 hisS Histidine--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q47WC1 0.0 540 63 3 422 3 hisS Histidine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8GTN4 0.0 533 60 5 430 3 hisS Histidine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q492E1 0.0 526 57 2 422 3 hisS Histidine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
Q1IEI0 0.0 526 60 5 425 3 hisS Histidine--tRNA ligase Pseudomonas entomophila (strain L48)
Q1QTK7 0.0 525 60 2 415 3 hisS Histidine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3K7B7 0.0 524 60 5 426 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q5QYB0 0.0 521 61 3 408 3 hisS Histidine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0VNE1 0.0 514 58 4 426 3 hisS Histidine--tRNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B7UWI9 1.26e-180 513 59 3 427 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
Q9HXJ5 1.33e-180 513 59 3 427 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RV6 1.33e-180 513 59 3 427 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
A4XY31 2.37e-180 512 59 3 424 3 hisS Histidine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q88PJ6 2.71e-180 512 59 3 423 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KPI8 2.71e-180 512 59 3 423 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain GB-1)
A5VYT6 2.71e-180 512 59 3 423 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q4K6V0 3.97e-180 511 61 5 426 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1JDV7 7.01e-180 511 59 3 423 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain W619)
Q886Y9 5.19e-178 506 60 5 426 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZX22 2.25e-176 502 60 5 426 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q48LZ3 4.43e-176 501 60 5 426 3 hisS Histidine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C3K1L3 6.63e-176 501 59 5 426 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain SBW25)
Q7VRR8 1.59e-175 500 55 2 424 3 hisS Histidine--tRNA ligase Blochmanniella floridana
A4VNX0 1.7e-175 500 60 3 427 3 hisS Histidine--tRNA ligase Stutzerimonas stutzeri (strain A1501)
C1DE56 4.63e-175 499 60 3 427 3 hisS Histidine--tRNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A6V0W1 5.34e-175 499 59 3 427 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
A6VV07 8.45e-175 498 58 3 412 3 hisS Histidine--tRNA ligase Marinomonas sp. (strain MWYL1)
C1DD44 1.33e-170 487 56 3 423 3 hisS Histidine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
Q603B8 7.46e-169 483 55 4 418 3 hisS Histidine--tRNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A1WXZ0 7.48e-169 483 58 5 405 3 hisS Histidine--tRNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q7NS89 3.02e-168 481 56 3 425 3 hisS Histidine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8K9P3 1.15e-167 480 51 2 425 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1H0V0 1.78e-166 476 55 3 416 3 hisS Histidine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q5P7B4 2.25e-165 474 55 4 426 3 hisS Histidine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1K3Z0 9.73e-165 473 55 5 427 3 hisS Histidine--tRNA ligase Azoarcus sp. (strain BH72)
Q31I05 1.03e-164 472 55 3 412 3 hisS Histidine--tRNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q83C80 2.2e-163 469 54 3 418 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV9 2.2e-163 469 54 3 418 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU6 2.2e-163 469 54 3 418 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
B6IZN1 2.41e-163 469 54 3 418 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
B6J7Q5 2.93e-163 468 54 3 418 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
Q5ZV96 1.07e-161 465 53 4 425 3 hisS Histidine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WWH1 1.39e-161 464 54 4 425 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Lens)
P59482 1.66e-161 464 48 2 421 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B2JIV0 2.83e-161 464 54 4 427 3 hisS Histidine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q5X519 3.02e-161 464 55 3 408 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Paris)
Q13X29 7e-161 463 56 3 403 3 hisS Histidine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
Q47BR7 4.4e-160 461 55 4 411 3 hisS Histidine--tRNA ligase Dechloromonas aromatica (strain RCB)
Q82XU9 5.82e-160 460 54 3 410 3 hisS Histidine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AE43 8e-160 460 55 4 412 3 hisS Histidine--tRNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7W6P7 1.09e-159 460 55 5 419 3 hisS Histidine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN1 1.09e-159 460 55 5 419 3 hisS Histidine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2SWE3 1.13e-159 460 53 5 427 1 hisS Histidine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7VWL1 1.54e-159 459 55 5 419 3 hisS Histidine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P57375 2.01e-159 459 50 3 425 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q46ZI4 2.38e-159 460 56 4 412 3 hisS Histidine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A3NA53 4.77e-159 459 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 668)
B2SXS9 4.98e-159 459 56 3 403 3 hisS Histidine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q6FEM2 1.04e-158 457 55 6 423 3 hisS Histidine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3JRQ5 1.17e-158 458 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A1V4K0 1.17e-158 458 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62JW5 1.17e-158 458 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2S2A3 1.17e-158 458 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3MK74 1.17e-158 458 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
Q63UT2 1.77e-158 457 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain K96243)
A3NVX0 1.77e-158 457 53 5 428 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
Q2KY92 3.38e-158 456 53 5 425 3 hisS Histidine--tRNA ligase Bordetella avium (strain 197N)
B2I3E6 4.08e-158 456 53 6 430 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ACICU)
A3M212 5.48e-158 456 53 6 430 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A4JEN9 5.55e-158 456 54 5 427 3 hisS Histidine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q9JUZ9 7.78e-158 455 53 4 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JZX9 1.34e-157 454 54 4 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0K963 1.41e-157 455 54 4 425 3 hisS Histidine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0A986 1.78e-157 454 55 5 423 3 hisS Histidine--tRNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q39FR0 3.7e-157 454 54 5 427 3 hisS Histidine--tRNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9AGZ7 8.95e-157 453 55 3 403 3 hisS Histidine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BEW8 9.56e-157 453 53 5 427 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YR43 9.56e-157 453 53 5 427 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
B3R1K1 1.06e-156 453 53 5 427 3 hisS Histidine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B7I5G8 1.1e-156 452 55 6 430 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB0057)
B1JT91 1.6e-156 452 53 5 427 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain MC0-3)
B4EAW8 1.6e-156 452 53 5 427 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A1KT95 1.74e-156 452 53 4 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M402 2.91e-156 451 53 4 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C (strain 053442)
B0V5G6 3.42e-156 451 54 6 430 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AYE)
B7H068 3.42e-156 451 54 6 430 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
Q1BGX3 4.96e-156 451 53 5 427 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain AU 1054)
A0K7T5 4.96e-156 451 53 5 427 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
Q3SL69 1.73e-155 449 54 3 418 3 hisS Histidine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
B0VKR7 3.34e-155 448 54 6 429 1 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain SDF)
Q8Y029 7.93e-155 447 52 4 424 3 hisS Histidine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5F9G8 7.33e-154 445 53 5 431 3 hisS Histidine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1AWV6 7.61e-152 439 52 4 413 3 hisS Histidine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
A5CWE8 2.76e-151 438 51 4 413 3 hisS Histidine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q1QD17 4.84e-148 430 51 5 427 3 hisS Histidine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A5WGQ0 6.71e-147 427 51 6 423 3 hisS Histidine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
Q4FTW6 3.38e-146 426 50 5 438 3 hisS Histidine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1W578 1.24e-143 419 50 4 411 3 hisS Histidine--tRNA ligase Acidovorax sp. (strain JS42)
B9MFX7 4.94e-143 417 51 6 412 3 hisS Histidine--tRNA ligase Acidovorax ebreus (strain TPSY)
B2SEW9 2.43e-137 402 49 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
A7NEI6 2.54e-137 402 49 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A0Q8F1 2.56e-137 402 49 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. novicida (strain U112)
A4IW12 9.47e-137 401 49 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIL5 9.47e-137 401 49 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K18 9.47e-137 401 49 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
Q2A1H0 9.89e-137 401 48 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain LVS)
Q0BK72 1.76e-136 400 48 3 409 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
B8HMM0 1.56e-132 390 49 5 419 3 hisS Histidine--tRNA ligase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q31KX6 3.32e-132 390 50 6 419 3 hisS Histidine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8DHP7 2.56e-131 387 49 7 415 3 hisS Histidine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5N0Z5 1.14e-129 384 50 6 419 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55653 4.29e-129 382 48 5 421 3 hisS Histidine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0TWR5 8.79e-129 381 47 4 409 3 hisS Histidine--tRNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B1XJ88 1.69e-128 380 48 6 422 3 hisS Histidine--tRNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A2CCR1 3.07e-128 380 47 5 416 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
B1WVZ0 3.87e-127 377 46 6 424 3 hisS Histidine--tRNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q3A5R6 4.4e-127 376 46 6 422 3 hisS Histidine--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B0CDA0 4.41e-127 377 47 5 421 3 hisS Histidine--tRNA ligase Acaryochloris marina (strain MBIC 11017)
P60915 7.48e-127 375 48 7 407 3 hisS Histidine--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7V4P3 3.96e-126 375 47 5 416 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
B3EB83 9.54e-126 373 47 5 409 3 hisS Histidine--tRNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B0JRF1 2.48e-125 372 47 6 423 3 hisS Histidine--tRNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A2C182 4.23e-125 372 47 4 402 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL1A)
A1ANS7 5.2e-125 371 46 7 411 3 hisS Histidine--tRNA ligase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q39UD2 8.95e-125 370 47 7 407 3 hisS Histidine--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6AQS3 1.43e-124 370 46 6 412 3 hisS Histidine--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q46LS5 1.43e-124 370 47 4 402 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL2A)
Q0IDK4 3.52e-124 369 46 6 418 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9311)
B4UEL3 2.16e-123 367 46 4 419 3 hisS Histidine--tRNA ligase Anaeromyxobacter sp. (strain K)
Q3B0D3 2.43e-123 367 48 6 410 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9902)
Q2JRX6 5.94e-123 366 48 6 414 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain JA-3-3Ab)
B8JBF6 7.38e-123 365 46 4 419 3 hisS Histidine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A5GQA2 1.06e-122 365 48 4 415 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain RCC307)
Q7U9Q6 1.18e-122 365 46 6 425 3 hisS Histidine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
A1V9B1 5.05e-122 363 46 7 422 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain DP4)
B7K2B6 7.87e-122 363 45 5 421 3 hisS Histidine--tRNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q833I1 9.15e-122 363 43 6 424 3 hisS Histidine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
A5GIA4 1.09e-121 363 46 4 409 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain WH7803)
A4VT07 2.03e-121 362 44 5 425 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZ92 2.03e-121 362 44 5 425 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 98HAH33)
P62379 2.19e-121 362 46 7 422 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q6B910 3.65e-121 361 42 4 420 3 hisS Histidine--tRNA ligase, chloroplastic Gracilaria tenuistipitata var. liui
Q7VCG1 5.51e-121 361 47 4 402 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A9B9Z7 6.55e-121 361 46 4 404 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
B2IN41 1.84e-120 360 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
Q97NC9 2.11e-120 360 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CU26 3.76e-120 359 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Taiwan19F-14)
B8CXE6 4.16e-120 358 43 6 423 3 hisS Histidine--tRNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q5FUR8 5.52e-120 358 45 4 418 3 hisS Histidine--tRNA ligase Gluconobacter oxydans (strain 621H)
Q8DN46 6.13e-120 358 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZPP6 6.13e-120 358 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04I50 6.13e-120 358 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CNA0 6.68e-120 358 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain P1031)
C1CH52 1.4e-119 358 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain JJA)
Q2RWE3 1.51e-119 357 45 5 422 3 hisS Histidine--tRNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B1I9T7 2.04e-119 357 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
A3DF35 3e-119 356 42 5 418 3 hisS Histidine--tRNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
C3KTB7 3.61e-119 356 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain 657 / Type Ba4)
C1CAV1 7.94e-119 356 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain 70585)
A2RN96 8.29e-119 356 44 6 410 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
B7KFP0 9.34e-119 355 47 5 421 3 hisS Histidine--tRNA ligase Gloeothece citriformis (strain PCC 7424)
B5E3C8 1.15e-118 355 42 5 425 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
P60913 5.88e-118 353 44 4 419 3 hisS Histidine--tRNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C1FKE6 6.08e-118 353 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Kyoto / Type A2)
Q1ISE2 8.49e-118 353 44 6 425 3 hisS Histidine--tRNA ligase Koribacter versatilis (strain Ellin345)
Q02WI8 1.13e-117 353 43 6 410 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
A5I6D6 1.39e-117 352 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY04 1.39e-117 352 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
P51348 1.39e-117 352 43 5 422 3 hisS Histidine--tRNA ligase, chloroplastic Porphyra purpurea
B1IMD8 1.45e-117 352 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
A7GHS3 1.53e-117 352 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C6BVJ9 1.9e-117 352 44 9 416 3 hisS Histidine--tRNA ligase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B1L097 2.12e-117 352 42 7 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
Q9CE78 2.35e-117 352 44 6 410 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
P0DG41 4.71e-117 351 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG40 4.71e-117 351 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8NZ19 1.26e-116 350 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
B5XJ83 1.41e-116 350 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
A2RGY1 1.41e-116 350 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q5X9E5 1.87e-116 350 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B2GBY6 1.94e-116 350 42 7 415 3 hisS Histidine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8RGJ5 1.96e-116 349 43 5 409 3 hisS Histidine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A7Z751 2.22e-116 349 43 6 408 3 hisS Histidine--tRNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A3CR40 2.79e-116 349 43 5 413 3 hisS Histidine--tRNA ligase Streptococcus sanguinis (strain SK36)
Q5WHP4 4.21e-116 348 43 6 423 3 hisS1 Histidine--tRNA ligase 1 Shouchella clausii (strain KSM-K16)
Q99XK9 4.4e-116 348 44 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M1
B5YHK1 8.85e-116 348 44 6 423 3 hisS Histidine--tRNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A5FX98 1.07e-115 347 44 5 419 3 hisS Histidine--tRNA ligase Acidiphilium cryptum (strain JF-5)
A8AZV0 1.5e-115 347 43 5 413 3 hisS Histidine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A9HJ49 1.65e-115 347 44 4 424 3 hisS Histidine--tRNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q317R4 5.03e-115 345 44 7 414 3 hisS Histidine--tRNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q38XB7 8.37e-115 345 42 7 423 3 hisS Histidine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
Q03SE4 1.44e-114 345 43 7 412 3 hisS Histidine--tRNA ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q48QS7 1.6e-114 345 43 5 402 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
C4XT36 2.79e-114 344 44 6 419 3 hisS Histidine--tRNA ligase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
O32039 2.81e-114 344 43 6 409 3 hisS Histidine--tRNA ligase Bacillus subtilis (strain 168)
Q038S0 5.43e-114 343 41 6 425 3 hisS Histidine--tRNA ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEM3 5.43e-114 343 41 6 425 3 hisS Histidine--tRNA ligase Lacticaseibacillus casei (strain BL23)
O66522 1.59e-113 341 46 9 415 3 hisS Histidine--tRNA ligase Aquifex aeolicus (strain VF5)
A4J2J1 1.74e-113 342 43 5 406 3 hisS Histidine--tRNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A9F907 2.64e-113 342 43 6 423 3 hisS Histidine--tRNA ligase Sorangium cellulosum (strain So ce56)
Q5KWS8 3.05e-113 341 42 6 426 3 hisS Histidine--tRNA ligase Geobacillus kaustophilus (strain HTA426)
Q8D1Y2 1.59e-112 340 43 4 410 3 hisS Histidine--tRNA ligase Wigglesworthia glossinidia brevipalpis
Q028M4 1.92e-112 339 44 7 421 3 hisS Histidine--tRNA ligase Solibacter usitatus (strain Ellin6076)
B3CLR6 1.97e-112 338 42 5 409 3 hisS Histidine--tRNA ligase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
C0QFI0 2.53e-112 339 43 6 410 3 hisS Histidine--tRNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B8FKS7 3.41e-112 338 42 6 423 3 hisS Histidine--tRNA ligase Desulfatibacillum aliphaticivorans
A2BQA4 3.9e-112 338 44 4 400 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain AS9601)
Q8CWW2 4.02e-112 338 43 5 401 3 hisS Histidine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q31BR1 6.49e-112 338 44 4 400 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
A5N1Y9 1.34e-111 337 41 7 420 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5P3 1.34e-111 337 41 7 420 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain NBRC 12016)
Q1XDD9 1.43e-111 337 43 6 422 3 hisS Histidine--tRNA ligase, chloroplastic Neopyropia yezoensis
B0TF88 6.4e-111 335 44 4 409 3 hisS Histidine--tRNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A2BVT6 7.02e-111 335 44 4 389 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
A7GT85 8.4e-111 335 40 6 425 3 hisS Histidine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8EPR9 9.94e-111 335 41 6 425 3 hisS Histidine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B7GFR0 1.03e-110 335 40 6 425 3 hisS Histidine--tRNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q03IB2 1.47e-110 334 43 5 425 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q3AA16 1.92e-110 334 40 5 413 3 hisS Histidine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
C5D510 2.11e-110 334 40 6 425 3 hisS Histidine--tRNA ligase Geobacillus sp. (strain WCH70)
A4IR95 3.86e-110 333 41 6 423 3 hisS Histidine--tRNA ligase Geobacillus thermodenitrificans (strain NG80-2)
Q817X7 4.92e-110 333 40 6 425 3 hisS-2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q65GR3 5.84e-110 333 41 6 408 3 hisS Histidine--tRNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6HDC2 7.19e-110 333 40 6 425 3 hisS2 Histidine--tRNA ligase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E2 7.19e-110 333 40 6 425 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ZK / E33L)
Q81LI6 7.19e-110 333 40 6 425 3 hisS-2 Histidine--tRNA ligase 2 Bacillus anthracis
A7HN13 8.94e-110 332 42 10 427 3 hisS Histidine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q5M281 9.29e-110 332 43 5 425 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXM9 9.29e-110 332 43 5 425 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain CNRZ 1066)
C1B4E1 1.49e-109 332 42 6 426 3 hisS Histidine--tRNA ligase Rhodococcus opacus (strain B4)
Q88VQ7 2.07e-109 332 40 7 428 3 hisS Histidine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P62370 2.17e-109 331 40 6 425 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B2A2F9 2.79e-109 331 41 7 424 3 hisS Histidine--tRNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q7V263 3.51e-109 331 43 4 397 3 hisS Histidine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q9KDG2 4.61e-109 331 42 7 425 3 hisS Histidine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0PZW9 4.87e-109 330 39 7 423 3 hisS Histidine--tRNA ligase Clostridium novyi (strain NT)
B1I363 5.53e-109 330 43 6 419 3 hisS Histidine--tRNA ligase Desulforudis audaxviator (strain MP104C)
A6LL06 6.3e-109 330 42 6 405 3 hisS Histidine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A5D3E2 7.29e-109 330 42 5 416 3 hisS Histidine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A3PBZ7 7.85e-109 330 43 4 400 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
Q3JYL6 1.01e-108 330 41 6 428 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1RJ50 1.49e-108 329 42 6 413 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain RML369-C)
A8GVU9 1.49e-108 329 42 6 413 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain OSU 85-389)
Q0S1B6 2.18e-108 329 42 6 426 3 hisS Histidine--tRNA ligase Rhodococcus jostii (strain RHA1)
A4XHB0 2.81e-108 328 39 5 419 3 hisS Histidine--tRNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q8RAI8 3.65e-108 328 40 5 408 3 hisS Histidine--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C0ZZ58 4e-108 328 43 6 425 3 hisS Histidine--tRNA ligase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
P67486 8.7e-108 327 41 5 425 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67485 8.7e-108 327 41 5 425 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
C4L534 1.24e-107 327 39 9 427 3 hisS Histidine--tRNA ligase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
C0MB21 3.52e-107 326 42 5 426 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. equi (strain 4047)
Q24US1 4.29e-107 325 42 5 409 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain Y51)
B8FQR7 4.29e-107 325 42 5 409 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q71ZF0 4.93e-107 325 38 6 421 3 hisS Histidine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
Q8Y708 5.04e-107 325 38 6 426 3 hisS Histidine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q183H5 7.65e-107 325 38 6 422 3 hisS Histidine--tRNA ligase Clostridioides difficile (strain 630)
B7IHK5 1.16e-106 324 43 6 405 3 hisS Histidine--tRNA ligase Thermosipho africanus (strain TCF52B)
Q92BJ3 3.73e-106 323 38 6 422 3 hisS Histidine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
C0MGD4 4.25e-106 323 43 5 413 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain H70)
B9DW81 5e-106 323 40 5 425 3 hisS Histidine--tRNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A8ZUR6 1.46e-105 322 43 5 409 3 hisS Histidine--tRNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q1AWC4 1.49e-105 322 40 6 415 3 hisS Histidine--tRNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B3QS95 1.52e-105 322 39 4 420 3 hisS Histidine--tRNA ligase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A1T898 2.24e-105 321 43 6 408 3 hisS Histidine--tRNA ligase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q5YTH9 2.34e-105 321 43 6 409 3 hisS Histidine--tRNA ligase Nocardia farcinica (strain IFM 10152)
B1L829 3.1e-105 321 43 7 409 3 hisS Histidine--tRNA ligase Thermotoga sp. (strain RQ2)
P30053 3.95e-105 320 43 5 413 1 hisS Histidine--tRNA ligase Streptococcus dysgalactiae subsp. equisimilis
B0K977 4.45e-105 320 40 6 422 3 hisS Histidine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B1HV72 4.77e-105 320 41 6 419 3 hisS Histidine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
B5YDT1 5.13e-105 320 42 6 405 3 hisS Histidine--tRNA ligase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A6Q9Z9 9.15e-105 319 42 5 412 3 hisS Histidine--tRNA ligase Sulfurovum sp. (strain NBC37-1)
A8F593 1.07e-104 320 40 6 407 3 hisS Histidine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B4U0K6 1.1e-104 319 42 5 413 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q9X0H5 1.44e-104 319 43 7 409 3 hisS Histidine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P9WFV5 1.52e-104 319 42 7 426 1 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFV4 1.52e-104 319 42 7 426 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5T0 1.52e-104 319 42 7 426 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AF49 1.52e-104 319 42 7 426 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLS8 1.52e-104 319 42 7 426 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67484 1.52e-104 319 42 7 426 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A5IN85 1.7e-104 319 43 7 407 3 hisS Histidine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q0SRP7 2.34e-104 318 42 5 406 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
Q30RH3 2.59e-104 318 43 6 409 3 hisS Histidine--tRNA ligase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
C4LIW5 2.8e-104 318 42 6 410 3 hisS Histidine--tRNA ligase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
Q04AV4 3.08e-104 318 41 7 423 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAG8 3.58e-104 318 40 7 427 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1WTV0 4.42e-104 318 39 6 412 3 hisS Histidine--tRNA ligase Ligilactobacillus salivarius (strain UCC118)
Q8XJ27 4.43e-104 317 42 5 406 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q0TP27 4.89e-104 317 42 5 406 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B2HN79 4.91e-104 318 43 6 412 3 hisS Histidine--tRNA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
B9E707 6.16e-104 317 40 7 422 3 hisS Histidine--tRNA ligase Macrococcus caseolyticus (strain JCSC5402)
Q0AYS2 1.72e-103 316 39 5 423 3 hisS Histidine--tRNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B9MPF7 2.11e-103 316 37 5 423 3 hisS Histidine--tRNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A0PPE8 2.77e-103 316 43 6 412 3 hisS Histidine--tRNA ligase Mycobacterium ulcerans (strain Agy99)
P60917 2.96e-103 315 42 6 424 3 hisS Histidine--tRNA ligase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B0K0N4 3.6e-103 315 39 5 420 3 hisS Histidine--tRNA ligase Thermoanaerobacter sp. (strain X514)
Q2RHW0 3.74e-103 315 41 5 403 3 hisS Histidine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A8MGM7 4.45e-103 315 38 6 418 3 hisS Histidine--tRNA ligase Alkaliphilus oremlandii (strain OhILAs)
Q6ME90 5.45e-103 315 38 7 422 3 hisS Histidine--tRNA ligase Protochlamydia amoebophila (strain UWE25)
A9NGF8 8.63e-103 314 40 9 424 3 hisS Histidine--tRNA ligase Acholeplasma laidlawii (strain PG-8A)
Q2GLK4 1.07e-102 314 40 4 422 3 hisS Histidine--tRNA ligase Anaplasma phagocytophilum (strain HZ)
A9KIA5 1.44e-102 314 40 7 409 3 hisS Histidine--tRNA ligase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q4L6X6 7.89e-102 312 40 6 424 3 hisS Histidine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
A7ZDK1 8.71e-102 311 39 5 418 3 hisS Histidine--tRNA ligase Campylobacter concisus (strain 13826)
B8E1C1 9.15e-102 311 40 6 411 3 hisS Histidine--tRNA ligase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q043X4 2.38e-101 311 39 6 421 3 hisS Histidine--tRNA ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P46696 2.58e-101 311 43 6 414 3 hisS Histidine--tRNA ligase Mycobacterium leprae (strain TN)
C0R4G6 3.3e-101 310 41 5 409 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A8YUZ9 1.05e-100 309 39 6 416 3 hisS Histidine--tRNA ligase Lactobacillus helveticus (strain DPC 4571)
P62351 1.06e-100 308 41 5 409 3 hisS Histidine--tRNA ligase Wolbachia pipientis wMel
P60912 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MW2)
P60911 2.61e-100 308 39 6 418 1 hisS Histidine--tRNA ligase Staphylococcus aureus
A8Z2F8 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T8 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q6GG72 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MRSA252)
P60910 2.61e-100 308 39 6 418 1 hisS Histidine--tRNA ligase Staphylococcus aureus (strain N315)
P60909 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHH3 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Newman)
Q5HFD2 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YT99 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITF5 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH9)
Q2FXU4 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG96 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300)
A6U299 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH1)
A7X345 2.61e-100 308 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q03F51 6.56e-100 307 39 9 434 3 hisS Histidine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8CS98 7.64e-100 307 39 7 419 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS1 7.64e-100 307 39 7 419 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4UM71 8.1e-100 306 39 7 410 3 hisS Histidine--tRNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GMY5 8.74e-99 304 38 6 414 3 hisS Histidine--tRNA ligase Rickettsia akari (strain Hartford)
B9KHM7 1.08e-98 304 42 5 419 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain Florida)
P56194 1.08e-98 304 41 6 424 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62374 1.08e-98 304 41 6 424 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5FKI5 1.61e-98 304 37 7 429 3 hisS Histidine--tRNA ligase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q67LN9 1.9e-98 303 40 7 420 3 hisS Histidine--tRNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B3QQI7 2.34e-98 303 39 7 424 3 hisS Histidine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q3YRB1 2.73e-98 303 40 7 416 3 hisS Histidine--tRNA ligase Ehrlichia canis (strain Jake)
Q3ZWB6 2.76e-98 303 41 6 410 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
A5FSR7 2.76e-98 303 41 6 410 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A0RPD3 3.13e-98 302 39 6 419 3 hisS Histidine--tRNA ligase Campylobacter fetus subsp. fetus (strain 82-40)
A4FBB7 3.34e-98 303 41 6 424 3 hisS Histidine--tRNA ligase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q8FPL5 3.95e-98 303 41 7 416 3 hisS Histidine--tRNA ligase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B3ELN3 5.51e-98 303 39 6 428 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain BS1)
A4SE02 8.01e-98 302 38 7 434 3 hisS Histidine--tRNA ligase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q5PBP9 9.14e-98 302 42 5 419 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain St. Maries)
Q5GSM4 1.32e-97 301 38 5 420 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q92IK8 1.71e-97 300 39 7 410 3 hisS Histidine--tRNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q3AQK2 1.83e-97 301 40 4 413 3 hisS Histidine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
Q3B1Z1 2.17e-97 301 39 7 419 3 hisS Histidine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A6Q371 2.53e-97 300 42 6 407 3 hisS Histidine--tRNA ligase Nitratiruptor sp. (strain SB155-2)
Q8NQ07 3.39e-97 300 41 7 416 3 hisS Histidine--tRNA ligase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8KFT6 4.01e-97 300 40 8 420 3 hisS Histidine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P60916 6.21e-97 300 38 6 416 3 hisS Histidine--tRNA ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q68X64 7.23e-97 299 38 4 412 3 hisS Histidine--tRNA ligase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
C3PN13 7.52e-97 299 38 7 410 3 hisS Histidine--tRNA ligase Rickettsia africae (strain ESF-5)
Q3ZAI8 8.4e-97 299 42 6 410 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q49Y69 1.08e-96 299 39 6 413 3 hisS Histidine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B3EFA6 1.29e-96 299 39 4 406 3 hisS Histidine--tRNA ligase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A8EZE6 1.74e-96 298 37 4 413 3 hisS Histidine--tRNA ligase Rickettsia canadensis (strain McKiel)
Q4JVE8 3.06e-96 298 40 6 420 3 hisS Histidine--tRNA ligase Corynebacterium jeikeium (strain K411)
C4K1W2 5.25e-96 297 38 7 410 3 hisS Histidine--tRNA ligase Rickettsia peacockii (strain Rustic)
B0BWZ9 1.19e-95 296 38 6 410 3 hisS Histidine--tRNA ligase Rickettsia rickettsii (strain Iowa)
Q5HAI0 1.48e-95 296 39 6 415 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Welgevonden)
Q5FG57 2.93e-95 295 39 6 415 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Gardel)
Q9ZDL9 1.25e-94 293 37 4 409 3 hisS Histidine--tRNA ligase Rickettsia prowazekii (strain Madrid E)
Q2GHH1 1.62e-94 293 39 7 415 3 hisS Histidine--tRNA ligase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
B4SCE2 1.68e-94 293 39 4 409 3 hisS Histidine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B1W3H3 2.64e-94 293 39 7 428 3 hisS Histidine--tRNA ligase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B9DNF9 3.11e-94 293 38 6 418 3 hisS Histidine--tRNA ligase Staphylococcus carnosus (strain TM300)
A1BDE6 8.11e-94 291 39 4 409 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q827T0 6.8e-93 289 39 6 428 3 hisS Histidine--tRNA ligase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P60914 1.28e-92 288 39 6 414 3 hisS Histidine--tRNA ligase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B1VDK9 1.84e-92 288 39 7 418 3 hisS Histidine--tRNA ligase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q9KXP2 2.02e-92 288 39 6 426 3 hisS Histidine--tRNA ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A7I1U5 6.22e-92 286 37 6 422 3 hisS Histidine--tRNA ligase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2GBN6 7.72e-92 286 46 3 322 3 hisS Histidine--tRNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A1VZB3 2.18e-91 285 38 6 418 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q5HV27 1.19e-90 283 38 6 418 3 hisS Histidine--tRNA ligase Campylobacter jejuni (strain RM1221)
Q9PPF4 1.19e-90 283 38 6 418 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FLH8 1.19e-90 283 38 6 418 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B1H0I8 1.38e-90 283 40 8 410 3 hisS Histidine--tRNA ligase Endomicrobium trichonymphae
A7H477 1.44e-90 283 38 6 418 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q2N5U7 1.73e-90 284 46 3 319 3 hisS Histidine--tRNA ligase Erythrobacter litoralis (strain HTCC2594)
B3CTK8 1.82e-89 280 36 7 429 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Ikeda)
B4S4H1 2.27e-89 280 38 4 421 3 hisS Histidine--tRNA ligase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A5CEP8 1.52e-88 278 36 7 429 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Boryong)
B1VA46 2.85e-88 277 37 6 412 3 hisS Histidine--tRNA ligase Phytoplasma australiense
Q2GCZ0 3.33e-88 276 36 5 425 3 hisS Histidine--tRNA ligase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
B9KG88 2.56e-87 274 37 7 418 3 hisS Histidine--tRNA ligase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q8EWB8 2.65e-86 272 35 8 426 3 hisS Histidine--tRNA ligase Malacoplasma penetrans (strain HF-2)
P62372 5.12e-84 266 36 7 404 3 hisS Histidine--tRNA ligase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_02565
Feature type CDS
Gene hisS
Product histidine--tRNA ligase
Location 117233 - 118513 (strand: 1)
Length 1281 (nucleotides) / 426 (amino acids)
In genomic island -

Contig

Accession ZDB_680
Length 282413 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_44
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF03129 Anticodon binding domain
PF13393 Histidyl-tRNA synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0124 Translation, ribosomal structure and biogenesis (J) J Histidyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01892 histidyl-tRNA synthetase [EC:6.1.1.21] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MATKIQSVRGMNDYLPADTAVWQRIENTLKRILTSYGISEIRTPIVEHTPLFQRAIGEVTDVVEKEMYSFQDREENVSLTLRPEGTAGCVRAGIEKGLLYNQEQRLWYIGPMFRHERPQKGRYRQFHQLGAEVFGLSGPDIDAELIMMTARWWRELGIAEHVTLELNSIGSLQARANYREALVAFLEQHKDKLDEDCKRRMYTNPLRVLDSKDKVVQELLNDAPALFDYLDEESKVHFDGLCAILDAAGIQYRINQRLVRGLDYYNRTVFEWVTTALGSQGTVCAGGRYDGLVEQLGGHNTPAVGFAMGLERMVLLVQSVNPDFVSETAVTDIYLASFGEGSQVAAMMLAEQIRDSLPDVRIMTNYGGGNFKRQLSRADKNGARIALILGEDEIANGTVTVKELATGEQQTLAQSGLSARLSELLG

Flanking regions ( +/- flanking 50bp)

GGGTCGCTTTTATAATCGGAAACATATTTCATTGAGTTAAGAGAATTAACGTGGCGACAAAAATCCAATCTGTTCGTGGTATGAATGATTATCTGCCTGCTGATACTGCGGTATGGCAGCGTATTGAAAACACGCTTAAACGCATTCTGACAAGCTACGGGATCAGTGAAATCCGTACGCCGATTGTCGAGCATACCCCCCTGTTTCAGCGCGCCATCGGTGAAGTGACCGATGTTGTTGAAAAGGAAATGTACTCTTTTCAGGACCGCGAAGAAAATGTGAGCTTAACACTGCGGCCGGAAGGAACAGCGGGCTGTGTTCGTGCCGGGATCGAGAAAGGCCTGCTGTACAATCAGGAACAGCGCCTCTGGTATATCGGACCGATGTTCCGCCACGAGCGTCCGCAGAAAGGCCGCTATCGTCAGTTCCATCAGCTGGGTGCGGAAGTTTTCGGCCTGAGCGGTCCGGATATCGATGCTGAGCTGATTATGATGACCGCCCGCTGGTGGCGTGAGCTGGGCATTGCGGAGCATGTTACCCTGGAACTGAACTCAATCGGTTCGTTACAGGCGCGTGCAAACTACCGTGAAGCACTGGTTGCCTTTCTGGAACAGCACAAAGACAAACTGGATGAAGACTGCAAACGCCGGATGTACACCAACCCGCTGCGTGTGCTGGATTCCAAAGACAAAGTTGTTCAGGAACTCCTGAACGATGCACCGGCACTGTTTGATTATCTTGATGAAGAATCAAAAGTCCACTTTGACGGCCTGTGTGCCATCCTGGATGCTGCCGGTATTCAGTACCGCATCAATCAGCGTCTGGTCCGTGGTCTGGATTACTATAACCGCACCGTGTTTGAGTGGGTGACCACCGCACTGGGTTCGCAGGGAACTGTCTGCGCGGGCGGCCGTTATGACGGGCTGGTTGAACAGCTCGGCGGTCATAATACCCCGGCGGTGGGCTTTGCCATGGGTCTGGAGCGTATGGTACTGCTGGTTCAGTCCGTCAATCCGGACTTTGTGAGCGAAACCGCAGTGACCGATATTTATCTGGCCTCCTTCGGTGAAGGCAGCCAGGTTGCGGCAATGATGCTGGCGGAACAGATCCGCGACAGCCTGCCGGATGTGCGTATCATGACCAACTACGGCGGCGGCAACTTTAAACGTCAGCTGAGCCGTGCGGATAAAAACGGTGCGCGCATCGCCCTGATTTTAGGTGAGGATGAAATTGCCAACGGGACAGTCACTGTCAAAGAACTGGCCACCGGTGAGCAGCAGACGCTGGCACAGAGCGGGCTTTCCGCTCGTCTGAGCGAACTTTTAGGTTAAGGAGAGACGTGTGGAAGTCTATACCACAGAAAATGAACAGGTATCAGCGC