Homologs in group_60

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01050 FBDBKF_01050 51.2 Morganella morganii S1 hisS histidine--tRNA ligase
FBDBKF_09165 FBDBKF_09165 93.1 Morganella morganii S1 hisS histidine--tRNA ligase
EHELCC_00495 EHELCC_00495 51.2 Morganella morganii S2 hisS histidine--tRNA ligase
EHELCC_10245 EHELCC_10245 93.1 Morganella morganii S2 hisS histidine--tRNA ligase
NLDBIP_02965 NLDBIP_02965 51.2 Morganella morganii S4 hisS histidine--tRNA ligase
NLDBIP_10590 NLDBIP_10590 93.1 Morganella morganii S4 hisS histidine--tRNA ligase
LHKJJB_04480 LHKJJB_04480 51.2 Morganella morganii S3 hisS histidine--tRNA ligase
LHKJJB_10765 LHKJJB_10765 93.1 Morganella morganii S3 hisS histidine--tRNA ligase
HKOGLL_02565 HKOGLL_02565 51.2 Morganella morganii S5 hisS histidine--tRNA ligase
HKOGLL_13825 HKOGLL_13825 93.1 Morganella morganii S5 hisS histidine--tRNA ligase
F4V73_RS07125 F4V73_RS07125 50.7 Morganella psychrotolerans hisS histidine--tRNA ligase
PMI_RS09100 PMI_RS09100 51.0 Proteus mirabilis HI4320 hisS histidine--tRNA ligase

Distribution of the homologs in the orthogroup group_60

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_60

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q1QTK7 1.81e-157 454 55 2 406 3 hisS Histidine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q83C80 1.53e-154 446 51 2 419 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV9 1.53e-154 446 51 2 419 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU6 1.53e-154 446 51 2 419 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
B6J7Q5 1.62e-154 446 51 2 419 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
B6IZN1 2.7e-154 446 51 2 419 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
Q87S15 1.71e-152 441 52 2 405 3 hisS Histidine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7FFZ0 2.92e-152 441 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C3LT13 7.95e-152 439 52 1 386 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTX0 7.95e-152 439 52 1 386 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3G1 7.95e-152 439 52 1 386 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MNF0 8.39e-152 439 50 2 417 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain YJ016)
Q8DEZ9 8.39e-152 439 50 2 417 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain CMCP6)
B1JS06 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A0 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMT6 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CK90 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R801 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCT6 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pestis
B2K9P9 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5I9 1.39e-151 439 50 1 415 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
B7VJT9 1.94e-151 438 50 2 417 3 hisS Histidine--tRNA ligase Vibrio atlanticus (strain LGP32)
Q2NS41 2.48e-151 438 50 1 415 3 hisS Histidine--tRNA ligase Sodalis glossinidius (strain morsitans)
B4T0P8 4.56e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella newport (strain SL254)
B5R581 4.56e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FR62 4.56e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella dublin (strain CT_02021853)
O52765 6.54e-151 437 50 1 415 1 hisS Histidine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYN1 6.54e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
A9N202 6.54e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8Z4P4 6.68e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella typhi
B5BAY6 7.13e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNI1 7.13e-151 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7MZE2 8.29e-151 437 52 2 400 3 hisS Histidine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
B4TD92 1.03e-150 437 50 1 415 3 hisS Histidine--tRNA ligase Salmonella heidelberg (strain SL476)
B4TR94 1.36e-150 436 50 1 415 3 hisS Histidine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B5F197 1.36e-150 436 50 1 415 3 hisS Histidine--tRNA ligase Salmonella agona (strain SL483)
C6DBH3 2.27e-150 436 49 1 415 3 hisS Histidine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5RCZ1 3.32e-150 435 50 1 415 3 hisS Histidine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57LI7 1.07e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
Q6D277 1.08e-149 434 49 1 415 3 hisS Histidine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1R8L9 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LNG9 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
P60906 1.3e-149 434 50 1 415 1 hisS Histidine--tRNA ligase Escherichia coli (strain K12)
B1IWE7 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60907 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEX1 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE52 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O1:K1 / APEC
A8A320 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O9:H4 (strain HS)
B1XAY9 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / DH10B)
C4ZX89 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7L8 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O8 (strain IAI1)
B7MYE9 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O81 (strain ED1a)
B7NRG4 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0Y3 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60908 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7
B7MHZ9 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPV7 1.3e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MHL6 1.48e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7LCQ4 1.51e-149 434 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain 55989 / EAEC)
B7N6A2 2.21e-149 433 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7UGW0 2.66e-149 433 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3YZ38 4.12e-149 432 50 1 415 3 hisS Histidine--tRNA ligase Shigella sonnei (strain Ss046)
C4LC38 6.52e-149 432 48 1 422 3 hisS Histidine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B2VE90 7.11e-149 432 52 0 388 3 hisS Histidine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9KXK7 7.94e-149 432 51 0 388 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS195)
A6WQP6 9.05e-149 432 51 0 388 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS185)
A3D6V8 9.05e-149 432 51 0 388 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9S8 9.05e-149 432 51 0 388 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS223)
B6I586 1.72e-148 431 50 1 415 3 hisS Histidine--tRNA ligase Escherichia coli (strain SE11)
B5FAX3 1.81e-148 431 51 1 384 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E771 1.81e-148 431 51 1 384 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q32D48 2.9e-148 430 50 1 415 3 hisS Histidine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
B8CKR2 2.99e-148 430 49 2 420 3 hisS Histidine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
B2TXT9 3.98e-148 430 50 1 415 3 hisS Histidine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q31XX6 1.49e-147 429 50 1 415 3 hisS Histidine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
Q83K44 2.25e-147 428 50 1 415 3 hisS Histidine--tRNA ligase Shigella flexneri
A8FT71 2.59e-147 428 50 0 388 3 hisS Histidine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
A8H246 5.5e-147 427 49 2 420 3 hisS Histidine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1RHQ4 7.07e-147 427 52 0 379 3 hisS Histidine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y8T9 7.07e-147 427 52 0 379 3 hisS Histidine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
P62373 8.39e-147 427 48 2 419 3 hisS Histidine--tRNA ligase Photobacterium profundum (strain SS9)
B3GY63 2.31e-146 426 52 1 376 3 hisS Histidine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B8GTN4 2.42e-146 426 54 2 377 3 hisS Histidine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
P43823 2.55e-146 426 52 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGH2 2.76e-146 425 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittGG)
B0TLI5 3.14e-146 425 48 2 420 3 hisS Histidine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
A8GHW4 4.22e-146 425 49 1 414 3 hisS Histidine--tRNA ligase Serratia proteamaculans (strain 568)
Q12PT3 6.05e-146 424 49 2 418 3 hisS Histidine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4WD92 1.04e-145 424 49 1 415 3 hisS Histidine--tRNA ligase Enterobacter sp. (strain 638)
Q4QNH3 1.56e-145 423 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
A1JKS3 2.14e-145 423 48 1 415 3 hisS Histidine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q603B8 5.51e-145 422 52 1 388 3 hisS Histidine--tRNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A5UAB7 6.15e-145 422 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittEE)
A6VQX5 7.57e-145 422 47 3 419 3 hisS Histidine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q47BR7 8.87e-145 422 50 7 425 3 hisS Histidine--tRNA ligase Dechloromonas aromatica (strain RCB)
P57988 9.01e-145 421 52 1 377 3 hisS Histidine--tRNA ligase Pasteurella multocida (strain Pm70)
A3QCG3 1.24e-144 421 48 3 420 3 hisS Histidine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q15R57 2.26e-144 421 52 0 386 3 hisS Histidine--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8EC33 2.38e-144 421 50 0 388 3 hisS Histidine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3ICZ6 2.84e-144 420 50 0 388 3 hisS Histidine--tRNA ligase Pseudoalteromonas translucida (strain TAC 125)
C5BET0 3.26e-144 420 49 3 416 3 hisS Histidine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
A1S862 7.23e-144 419 49 3 424 3 hisS Histidine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B7LKC4 9.13e-144 419 50 2 420 3 hisS Histidine--tRNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5XNL6 1.19e-143 419 49 1 415 3 hisS Histidine--tRNA ligase Klebsiella pneumoniae (strain 342)
A0KJ45 1.91e-143 418 48 2 421 3 hisS Histidine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B4EZT2 3.19e-143 417 49 5 418 3 hisS Histidine--tRNA ligase Proteus mirabilis (strain HI4320)
B4RV88 3.93e-143 417 50 2 418 3 hisS Histidine--tRNA ligase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A4SP01 5.74e-143 417 48 2 421 3 hisS Histidine--tRNA ligase Aeromonas salmonicida (strain A449)
Q5WWH1 7.96e-143 417 50 0 389 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Lens)
B1KKJ3 1.09e-142 416 51 0 388 3 hisS Histidine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
Q5X519 4.6e-142 415 50 0 389 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Paris)
Q5ZV96 5.36e-142 414 49 0 389 3 hisS Histidine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q65R83 5.54e-142 414 47 4 423 3 hisS Histidine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7N705 8.46e-142 414 47 4 423 3 hisS Histidine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9HXJ5 1.23e-141 414 51 2 390 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RV6 1.23e-141 414 51 2 390 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7VME1 1.59e-141 413 51 3 378 3 hisS Histidine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B7UWI9 1.63e-141 413 51 2 390 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
A1WXZ0 2.8e-141 412 51 3 387 3 hisS Histidine--tRNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q31I05 9.5e-141 411 50 3 391 3 hisS Histidine--tRNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3K7B7 7.14e-140 409 48 4 418 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
A0KUJ6 1.07e-139 409 51 0 388 3 hisS Histidine--tRNA ligase Shewanella sp. (strain ANA-3)
Q0HKV8 1.65e-139 408 51 0 388 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-4)
Q0HX56 3.38e-139 407 51 0 388 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-7)
Q1H0V0 2.01e-138 405 49 4 407 3 hisS Histidine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0VNE1 2.01e-138 405 50 1 388 3 hisS Histidine--tRNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q085U5 3.47e-138 405 50 0 388 3 hisS Histidine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
B0USG9 6.67e-138 404 49 1 384 3 hisS Histidine--tRNA ligase Histophilus somni (strain 2336)
Q0I2E8 7.13e-138 404 49 1 384 3 hisS Histidine--tRNA ligase Histophilus somni (strain 129Pt)
A6V0W1 2.82e-137 402 51 2 390 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
A6VV07 5.82e-137 402 51 2 389 3 hisS Histidine--tRNA ligase Marinomonas sp. (strain MWYL1)
C1DD44 8.24e-137 401 50 3 389 3 hisS Histidine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
Q9JUZ9 2.21e-136 400 47 5 429 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
C1DE56 4.05e-136 400 49 5 417 3 hisS Histidine--tRNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1W578 4.24e-136 400 48 5 396 3 hisS Histidine--tRNA ligase Acidovorax sp. (strain JS42)
Q9JZX9 4.58e-136 400 46 5 428 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F9G8 4.99e-136 399 47 6 429 3 hisS Histidine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9M402 5.1e-136 399 46 5 429 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C (strain 053442)
A1KT95 5.51e-136 399 46 5 428 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1K3Z0 1.18e-135 399 49 7 420 3 hisS Histidine--tRNA ligase Azoarcus sp. (strain BH72)
Q5P7B4 1.32e-135 399 47 6 426 3 hisS Histidine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7NS89 1.85e-135 398 46 4 423 3 hisS Histidine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B9MFX7 1.97e-135 398 48 5 396 3 hisS Histidine--tRNA ligase Acidovorax ebreus (strain TPSY)
Q47WC1 1.98e-135 398 51 0 388 3 hisS Histidine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
C3K1L3 2.94e-135 397 47 4 418 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain SBW25)
Q8K9P3 3.21e-135 397 48 0 377 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A4XY31 8.54e-135 396 51 2 390 3 hisS Histidine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q3SL69 1.69e-134 395 52 5 388 3 hisS Histidine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
Q48LZ3 2.77e-134 395 49 2 390 3 hisS Histidine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5QYB0 3.13e-134 394 47 3 411 3 hisS Histidine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1JDV7 8.04e-134 394 47 4 417 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain W619)
Q4ZX22 8.67e-134 394 49 2 390 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q4K6V0 1.02e-133 394 47 4 418 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q886Y9 1.46e-133 393 48 2 390 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4VNX0 3.98e-133 392 52 2 390 3 hisS Histidine--tRNA ligase Stutzerimonas stutzeri (strain A1501)
B2I3E6 4.49e-133 392 50 5 396 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ACICU)
A3M212 5.76e-133 392 50 5 396 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q88PJ6 1.27e-132 391 46 4 417 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KPI8 1.27e-132 391 46 4 417 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain GB-1)
A5VYT6 1.27e-132 391 46 4 417 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q0AE43 8.07e-132 389 47 5 423 3 hisS Histidine--tRNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0A986 9.23e-132 389 49 3 404 3 hisS Histidine--tRNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q82XU9 2.06e-131 387 47 6 423 3 hisS Histidine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B7I5G8 4.73e-130 384 50 5 395 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB0057)
B0VKR7 6.93e-130 384 50 5 394 1 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain SDF)
Q8Y029 9.4e-130 384 47 5 395 3 hisS Histidine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6FEM2 1.11e-129 383 50 5 395 3 hisS Histidine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0V5G6 1.64e-129 383 50 5 395 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AYE)
B7H068 1.64e-129 383 50 5 395 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
Q492E1 7.26e-129 382 44 3 430 3 hisS Histidine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
B2SXS9 7.83e-129 382 46 5 395 3 hisS Histidine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q46ZI4 1.16e-128 382 48 5 397 3 hisS Histidine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1IEI0 1.45e-128 380 45 5 418 3 hisS Histidine--tRNA ligase Pseudomonas entomophila (strain L48)
A9AGZ7 4.91e-128 380 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
A3NA53 5.42e-128 380 47 5 395 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 668)
P59482 5.6e-128 379 45 0 385 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q2KY92 7.85e-128 379 50 5 391 3 hisS Histidine--tRNA ligase Bordetella avium (strain 197N)
B2JIV0 8.74e-128 379 46 6 399 3 hisS Histidine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A4JEN9 1.7e-127 378 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q63UT2 2.18e-127 378 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain K96243)
A3NVX0 2.18e-127 378 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
Q13X29 3.33e-127 377 46 5 395 3 hisS Histidine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
Q2SWE3 3.96e-127 377 46 5 395 1 hisS Histidine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B3R1K1 8.53e-127 377 47 5 397 3 hisS Histidine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q7VRR8 8.77e-127 376 45 3 393 3 hisS Histidine--tRNA ligase Blochmanniella floridana
Q3JRQ5 9.34e-127 376 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A1V4K0 9.34e-127 376 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62JW5 9.34e-127 376 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2S2A3 9.34e-127 376 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3MK74 9.34e-127 376 46 5 395 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
Q0BEW8 4.82e-126 375 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YR43 4.82e-126 375 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
Q39FR0 7.77e-126 374 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0K963 1.06e-125 374 47 6 398 3 hisS Histidine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P57375 1.56e-125 372 43 2 391 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B1JT91 1.81e-125 373 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain MC0-3)
B4EAW8 1.81e-125 373 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q1BGX3 2.23e-125 373 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain AU 1054)
A0K7T5 2.23e-125 373 46 5 394 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
Q7W6P7 2.72e-125 372 49 5 392 3 hisS Histidine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN1 2.72e-125 372 49 5 392 3 hisS Histidine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1AWV6 9.39e-125 370 47 2 385 3 hisS Histidine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
Q7VWL1 1.63e-124 370 49 5 392 3 hisS Histidine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A5WGQ0 2.66e-124 370 48 5 405 3 hisS Histidine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
Q0BK72 5.4e-124 369 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
A5CWE8 5.96e-124 369 46 2 385 3 hisS Histidine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B0TWR5 6.86e-124 368 48 2 390 3 hisS Histidine--tRNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q8F1 1.27e-123 367 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. novicida (strain U112)
A7NEI6 1.36e-123 367 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SEW9 4.4e-123 366 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1H0 5.53e-123 366 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain LVS)
A4IW12 1.41e-122 365 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIL5 1.41e-122 365 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K18 1.41e-122 365 49 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
Q55653 1.08e-120 361 47 7 412 3 hisS Histidine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1QD17 1.48e-119 358 45 8 434 3 hisS Histidine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B7K2B6 2.43e-116 349 46 5 394 3 hisS Histidine--tRNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
B2IN41 5.26e-116 348 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
Q4FTW6 6.53e-116 348 44 7 443 3 hisS Histidine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8DHP7 7.77e-116 348 48 4 378 3 hisS Histidine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
C1CU26 9.44e-116 348 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CAV1 1.31e-115 347 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain 70585)
Q97NC9 1.38e-115 347 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DN46 1.57e-115 347 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZPP6 1.57e-115 347 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04I50 1.57e-115 347 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CH52 4.5e-115 346 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain JJA)
Q02WI8 4.96e-115 346 43 3 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
B1WVZ0 5.76e-115 346 45 5 406 3 hisS Histidine--tRNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q9CE78 6.44e-115 345 43 4 405 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
B5E3C8 9.83e-115 345 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
A2RN96 1.03e-114 345 43 3 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
B1I9T7 1.55e-114 345 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
C1CNA0 1.6e-114 345 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain P1031)
B1XJ88 2.51e-114 344 45 4 390 3 hisS Histidine--tRNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q31KX6 3.33e-114 344 45 6 411 3 hisS Histidine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A4VT07 3.54e-114 343 44 3 387 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZ92 3.54e-114 343 44 3 387 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 98HAH33)
A3CR40 1.06e-113 342 43 4 404 3 hisS Histidine--tRNA ligase Streptococcus sanguinis (strain SK36)
B8HMM0 1.76e-113 342 46 4 388 3 hisS Histidine--tRNA ligase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A8AZV0 1.02e-112 340 43 4 412 3 hisS Histidine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B0CDA0 1.31e-112 340 44 7 430 3 hisS Histidine--tRNA ligase Acaryochloris marina (strain MBIC 11017)
A5GQA2 2.68e-112 338 44 5 415 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain RCC307)
Q5N0Z5 1.61e-111 337 44 6 411 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B0JRF1 4.26e-111 336 45 5 384 3 hisS Histidine--tRNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q48QS7 1.74e-110 334 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q7U9Q6 1.97e-109 332 44 4 397 3 hisS Histidine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
B7KFP0 2.47e-109 331 47 4 381 3 hisS Histidine--tRNA ligase Gloeothece citriformis (strain PCC 7424)
Q8NZ19 5.18e-109 330 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99XK9 6.3e-109 330 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M1
P0DG41 7.18e-109 330 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG40 7.18e-109 330 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A2RGY1 1.88e-108 329 42 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
B5XJ83 1.92e-108 329 42 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
Q5X9E5 2.75e-108 328 42 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q2JRX6 5.43e-108 327 43 5 410 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain JA-3-3Ab)
Q3JYL6 6.91e-108 327 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7VCG1 8.63e-108 327 51 1 315 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P67486 1.27e-107 327 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67485 1.27e-107 327 43 4 405 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
Q8CWW2 1.86e-107 327 43 4 404 3 hisS Histidine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C4XT36 2.47e-107 326 40 5 426 3 hisS Histidine--tRNA ligase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A2CCR1 8.87e-107 325 43 4 401 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
Q3B0D3 1.79e-106 324 41 5 419 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9902)
Q7V4P3 4.7e-106 323 43 4 401 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
B5YHK1 1e-105 322 44 5 389 3 hisS Histidine--tRNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A3DF35 1.38e-105 321 41 4 411 3 hisS Histidine--tRNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q46LS5 1.6e-105 322 42 4 390 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL2A)
A2C182 2.35e-105 321 43 4 390 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL1A)
A5GIA4 4.06e-105 321 44 3 397 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain WH7803)
B3EB83 6.98e-105 320 42 4 385 3 hisS Histidine--tRNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q3A5R6 1.41e-104 319 41 6 422 3 hisS Histidine--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B8JBF6 4.72e-104 317 42 4 416 3 hisS Histidine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q0IDK4 6.91e-104 317 43 2 395 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9311)
Q1XDD9 1.9e-103 316 45 5 382 3 hisS Histidine--tRNA ligase, chloroplastic Neopyropia yezoensis
Q24US1 2.21e-103 316 43 7 401 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain Y51)
B8FQR7 2.21e-103 316 43 7 401 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q1WTV0 4.42e-103 315 41 4 390 3 hisS Histidine--tRNA ligase Ligilactobacillus salivarius (strain UCC118)
Q6B910 5.41e-103 315 42 5 391 3 hisS Histidine--tRNA ligase, chloroplastic Gracilaria tenuistipitata var. liui
C5D510 5.5e-103 315 43 5 392 3 hisS Histidine--tRNA ligase Geobacillus sp. (strain WCH70)
A9B9Z7 5.68e-103 315 42 5 408 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
B4UEL3 7.39e-103 314 42 5 417 3 hisS Histidine--tRNA ligase Anaeromyxobacter sp. (strain K)
A4J2J1 1.05e-102 314 43 3 383 3 hisS Histidine--tRNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A2BQA4 1.21e-102 314 43 6 411 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain AS9601)
A4XHB0 2.55e-102 313 40 4 420 3 hisS Histidine--tRNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A4IR95 3.44e-102 313 42 4 388 3 hisS Histidine--tRNA ligase Geobacillus thermodenitrificans (strain NG80-2)
P51348 4.02e-102 313 43 6 382 3 hisS Histidine--tRNA ligase, chloroplastic Porphyra purpurea
Q833I1 4.32e-102 313 41 4 390 3 hisS Histidine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8CS98 1.62e-101 311 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS1 1.62e-101 311 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q31BR1 3.06e-101 310 42 5 411 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
Q5KWS8 6.82e-101 310 42 4 388 3 hisS Histidine--tRNA ligase Geobacillus kaustophilus (strain HTA426)
B4SCE2 8.6e-101 309 41 8 412 3 hisS Histidine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q92BJ3 9.44e-101 309 40 7 420 3 hisS Histidine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B9MPF7 1.06e-100 309 39 4 420 3 hisS Histidine--tRNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B9DW81 1.66e-100 308 42 3 387 3 hisS Histidine--tRNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B5YDT1 1.74e-100 308 42 6 384 3 hisS Histidine--tRNA ligase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B2GBY6 2.5e-100 308 40 5 392 3 hisS Histidine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8RAI8 4.31e-100 307 40 5 416 3 hisS Histidine--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A3PBZ7 4.88e-100 307 43 4 391 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
Q6AQS3 7.23e-100 307 43 6 389 3 hisS Histidine--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B7GFR0 7.56e-100 307 40 5 415 3 hisS Histidine--tRNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A1ANS7 1.02e-99 306 41 4 387 3 hisS Histidine--tRNA ligase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B9E707 1.42e-99 306 41 6 384 3 hisS Histidine--tRNA ligase Macrococcus caseolyticus (strain JCSC5402)
A7GT85 1.98e-99 306 38 6 425 3 hisS Histidine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q4UM71 2.14e-99 305 46 1 314 3 hisS Histidine--tRNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q5M281 2.47e-99 306 42 4 403 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXM9 2.47e-99 306 42 4 403 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain CNRZ 1066)
Q8Y708 3.17e-99 305 39 5 415 3 hisS Histidine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B1L097 3.72e-99 305 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
C6BVJ9 3.73e-99 305 39 7 414 3 hisS Histidine--tRNA ligase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C1FKE6 4.32e-99 305 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Kyoto / Type A2)
B1IMD8 5.43e-99 304 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
Q038S0 5.72e-99 305 42 5 389 3 hisS Histidine--tRNA ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEM3 5.72e-99 305 42 5 389 3 hisS Histidine--tRNA ligase Lacticaseibacillus casei (strain BL23)
Q03IB2 6.32e-99 305 42 4 403 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q2RWE3 6.59e-99 304 40 5 410 3 hisS Histidine--tRNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
C3KTB7 6.96e-99 304 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain 657 / Type Ba4)
B8CXE6 7.61e-99 304 42 4 385 3 hisS Histidine--tRNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A7GHS3 8.27e-99 304 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A5I6D6 8.36e-99 304 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY04 8.36e-99 304 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
A8EZE6 1.4e-98 303 46 1 315 3 hisS Histidine--tRNA ligase Rickettsia canadensis (strain McKiel)
Q7V263 2.73e-98 303 41 4 391 3 hisS Histidine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q5FUR8 4.37e-98 302 39 4 417 3 hisS Histidine--tRNA ligase Gluconobacter oxydans (strain 621H)
A2BVT6 4.79e-98 302 41 4 391 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
B0K977 5.34e-98 302 41 4 387 3 hisS Histidine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8EPR9 5.51e-98 302 38 5 422 3 hisS Histidine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A8MGM7 5.85e-98 302 38 5 398 3 hisS Histidine--tRNA ligase Alkaliphilus oremlandii (strain OhILAs)
Q88VQ7 5.92e-98 302 39 6 418 3 hisS Histidine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C0MB21 7.84e-98 302 41 4 405 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. equi (strain 4047)
P60913 8.44e-98 301 41 5 405 3 hisS Histidine--tRNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B8E1C1 1.3e-97 301 42 6 385 3 hisS Histidine--tRNA ligase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A4SE02 1.4e-97 301 40 7 418 3 hisS Histidine--tRNA ligase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q49Y69 1.65e-97 301 40 5 413 3 hisS Histidine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q71ZF0 1.84e-97 301 38 5 415 3 hisS Histidine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
A6Q371 2.04e-97 300 41 6 387 3 hisS Histidine--tRNA ligase Nitratiruptor sp. (strain SB155-2)
Q65GR3 3.27e-97 300 42 7 390 3 hisS Histidine--tRNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B0K0N4 3.42e-97 300 41 4 387 3 hisS Histidine--tRNA ligase Thermoanaerobacter sp. (strain X514)
A8GMY5 4.87e-97 299 45 1 314 3 hisS Histidine--tRNA ligase Rickettsia akari (strain Hartford)
Q5WHP4 5.19e-97 300 40 5 391 3 hisS1 Histidine--tRNA ligase 1 Shouchella clausii (strain KSM-K16)
A7HN13 9.92e-97 299 42 9 390 3 hisS Histidine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q30RH3 1.07e-96 298 39 4 407 3 hisS Histidine--tRNA ligase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P62379 1.25e-96 298 41 6 421 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C0MGD4 1.34e-96 298 41 4 405 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain H70)
B1HV72 1.38e-96 298 41 7 407 3 hisS Histidine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
A1V9B1 1.59e-96 298 41 6 421 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain DP4)
P60915 1.64e-96 298 40 4 387 3 hisS Histidine--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8RGJ5 1.87e-96 298 38 4 390 3 hisS Histidine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q03F51 2.1e-96 298 42 8 398 3 hisS Histidine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A7Z751 2.55e-96 298 41 7 400 3 hisS Histidine--tRNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A6Q9Z9 3.23e-96 297 40 6 407 3 hisS Histidine--tRNA ligase Sulfurovum sp. (strain NBC37-1)
B4U0K6 3.43e-96 298 41 4 405 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
P60912 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MW2)
P60911 3.48e-96 297 40 5 417 1 hisS Histidine--tRNA ligase Staphylococcus aureus
A8Z2F8 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T8 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q6GG72 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MRSA252)
P60910 3.48e-96 297 40 5 417 1 hisS Histidine--tRNA ligase Staphylococcus aureus (strain N315)
P60909 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHH3 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Newman)
Q5HFD2 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YT99 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITF5 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH9)
Q2FXU4 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG96 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300)
A6U299 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH1)
A7X345 3.48e-96 297 40 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
O66522 4.05e-96 296 42 7 389 3 hisS Histidine--tRNA ligase Aquifex aeolicus (strain VF5)
Q38XB7 4.37e-96 298 40 6 409 3 hisS Histidine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
B3QS95 6.01e-96 297 39 6 391 3 hisS Histidine--tRNA ligase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q1ISE2 6.75e-96 297 40 7 424 3 hisS Histidine--tRNA ligase Koribacter versatilis (strain Ellin345)
B3ELN3 8.71e-96 297 42 5 355 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain BS1)
P30053 1.03e-95 296 41 4 405 1 hisS Histidine--tRNA ligase Streptococcus dysgalactiae subsp. equisimilis
Q3AQK2 1.04e-95 296 40 7 406 3 hisS Histidine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
Q6HDC2 1.07e-95 296 37 5 424 3 hisS2 Histidine--tRNA ligase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E2 1.07e-95 296 37 5 424 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ZK / E33L)
Q81LI6 1.07e-95 296 37 5 424 3 hisS-2 Histidine--tRNA ligase 2 Bacillus anthracis
B9DNF9 1.11e-95 296 40 5 411 3 hisS Histidine--tRNA ligase Staphylococcus carnosus (strain TM300)
A5N1Y9 1.64e-95 295 39 5 388 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5P3 1.64e-95 295 39 5 388 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain NBRC 12016)
Q817X7 2.1e-95 295 37 5 424 3 hisS-2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C4L534 3.27e-95 295 39 5 391 3 hisS Histidine--tRNA ligase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A5D3E2 3.29e-95 295 39 5 407 3 hisS Histidine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
P62370 3.52e-95 295 37 5 424 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q04AV4 3.6e-95 295 41 5 403 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAG8 4.23e-95 295 41 5 403 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B0TF88 5.01e-95 295 39 5 408 3 hisS Histidine--tRNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q8D1Y2 5.31e-95 295 42 1 317 3 hisS Histidine--tRNA ligase Wigglesworthia glossinidia brevipalpis
Q92IK8 5.65e-95 294 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q183H5 6.09e-95 294 38 6 417 3 hisS Histidine--tRNA ligase Clostridioides difficile (strain 630)
Q3AA16 6.24e-95 294 41 4 372 3 hisS Histidine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A0PZW9 6.34e-95 294 40 6 391 3 hisS Histidine--tRNA ligase Clostridium novyi (strain NT)
Q8KFT6 1.6e-94 293 40 7 402 3 hisS Histidine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A9F907 2.71e-94 293 43 7 393 3 hisS Histidine--tRNA ligase Sorangium cellulosum (strain So ce56)
Q4L6X6 2.74e-94 293 40 7 421 3 hisS Histidine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
A1BDE6 2.85e-94 293 43 5 357 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
C3PN13 3.43e-94 292 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia africae (strain ESF-5)
O32039 3.74e-94 292 40 9 420 3 hisS Histidine--tRNA ligase Bacillus subtilis (strain 168)
A9HJ49 6e-94 291 43 2 351 3 hisS Histidine--tRNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B0BWZ9 1.14e-93 291 43 1 314 3 hisS Histidine--tRNA ligase Rickettsia rickettsii (strain Iowa)
Q3B1Z1 2.02e-93 290 39 6 411 3 hisS Histidine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q68X64 3.47e-93 289 44 0 314 3 hisS Histidine--tRNA ligase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q39UD2 4.64e-93 289 40 4 387 3 hisS Histidine--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6ME90 5.03e-93 289 41 5 402 3 hisS Histidine--tRNA ligase Protochlamydia amoebophila (strain UWE25)
Q9KDG2 6.74e-93 289 40 6 393 3 hisS Histidine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9ZDL9 7.54e-93 288 44 0 314 3 hisS Histidine--tRNA ligase Rickettsia prowazekii (strain Madrid E)
B3QQI7 8.5e-93 289 40 8 412 3 hisS Histidine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q1RJ50 1.09e-92 288 40 8 386 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain RML369-C)
A8GVU9 1.09e-92 288 40 8 386 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain OSU 85-389)
A8YUZ9 1.14e-92 288 40 4 390 3 hisS Histidine--tRNA ligase Lactobacillus helveticus (strain DPC 4571)
C4K1W2 1.17e-92 288 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia peacockii (strain Rustic)
B1I363 1.3e-92 288 39 4 408 3 hisS Histidine--tRNA ligase Desulforudis audaxviator (strain MP104C)
C0QFI0 2.45e-92 288 46 2 309 3 hisS Histidine--tRNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q03SE4 3.03e-92 288 39 9 417 3 hisS Histidine--tRNA ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P60916 5.58e-92 287 41 4 390 3 hisS Histidine--tRNA ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A7ZDK1 6.06e-92 286 38 7 413 3 hisS Histidine--tRNA ligase Campylobacter concisus (strain 13826)
Q043X4 6.35e-92 286 40 6 394 3 hisS Histidine--tRNA ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B8FKS7 8.24e-92 286 45 2 313 3 hisS Histidine--tRNA ligase Desulfatibacillum aliphaticivorans
B2A2F9 8.38e-92 286 40 7 387 3 hisS Histidine--tRNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q2GBN6 1.51e-91 285 38 4 417 3 hisS Histidine--tRNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q317R4 1.96e-91 285 37 6 420 3 hisS Histidine--tRNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0RPD3 4.21e-91 284 38 7 406 3 hisS Histidine--tRNA ligase Campylobacter fetus subsp. fetus (strain 82-40)
A5FX98 5.43e-91 284 41 2 351 3 hisS Histidine--tRNA ligase Acidiphilium cryptum (strain JF-5)
Q2RHW0 6.97e-91 284 38 5 412 3 hisS Histidine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B7IHK5 1.08e-90 283 40 6 386 3 hisS Histidine--tRNA ligase Thermosipho africanus (strain TCF52B)
P60917 2.13e-90 282 39 5 422 3 hisS Histidine--tRNA ligase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q5FKI5 2.16e-90 283 39 4 390 3 hisS Histidine--tRNA ligase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B4S4H1 3.2e-90 282 39 7 412 3 hisS Histidine--tRNA ligase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B3EFA6 1.24e-89 281 42 5 356 3 hisS Histidine--tRNA ligase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A8ZUR6 1.25e-89 281 45 2 313 3 hisS Histidine--tRNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A6LL06 1.71e-89 280 39 7 388 3 hisS Histidine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q0AYS2 3.73e-89 279 38 3 381 3 hisS Histidine--tRNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B3CLR6 5.03e-89 278 45 1 311 3 hisS Histidine--tRNA ligase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
P46696 1e-88 278 38 6 416 3 hisS Histidine--tRNA ligase Mycobacterium leprae (strain TN)
Q5HAI0 3.05e-88 277 46 2 313 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Welgevonden)
A7I1U5 4.17e-88 276 42 2 315 3 hisS Histidine--tRNA ligase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q5FG57 5.4e-88 276 46 2 313 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Gardel)
A8F593 5.56e-88 276 38 5 378 3 hisS Histidine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
P9WFV5 7.67e-88 276 38 6 415 1 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFV4 7.67e-88 276 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5T0 7.67e-88 276 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AF49 7.67e-88 276 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLS8 7.67e-88 276 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67484 7.67e-88 276 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1T898 9.44e-88 276 39 6 403 3 hisS Histidine--tRNA ligase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A5IN85 1.13e-87 275 40 4 384 3 hisS Histidine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B1L829 1.4e-87 275 38 5 421 3 hisS Histidine--tRNA ligase Thermotoga sp. (strain RQ2)
P62351 2.16e-87 274 44 1 312 3 hisS Histidine--tRNA ligase Wolbachia pipientis wMel
A0PPE8 2.97e-87 274 38 6 422 3 hisS Histidine--tRNA ligase Mycobacterium ulcerans (strain Agy99)
Q9X0H5 3.24e-87 274 38 5 421 3 hisS Histidine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1VDK9 3.46e-87 275 41 5 353 3 hisS Histidine--tRNA ligase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B2HN79 4.02e-87 274 38 6 422 3 hisS Histidine--tRNA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q3ZWB6 4.32e-87 274 38 3 386 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
A5FSR7 4.32e-87 274 38 3 386 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
C4LIW5 7.37e-87 273 39 8 395 3 hisS Histidine--tRNA ligase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
Q028M4 8.51e-87 273 38 6 415 3 hisS Histidine--tRNA ligase Solibacter usitatus (strain Ellin6076)
B3CTK8 8.74e-87 273 40 5 376 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Ikeda)
Q3YRB1 8.82e-87 273 46 1 313 3 hisS Histidine--tRNA ligase Ehrlichia canis (strain Jake)
Q4JVE8 9.5e-87 274 36 5 428 3 hisS Histidine--tRNA ligase Corynebacterium jeikeium (strain K411)
A5CEP8 9.74e-87 273 40 6 384 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Boryong)
C0ZZ58 5.16e-86 271 38 5 408 3 hisS Histidine--tRNA ligase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q2GLK4 6.26e-86 271 44 1 312 3 hisS Histidine--tRNA ligase Anaplasma phagocytophilum (strain HZ)
Q0TP27 6.49e-86 271 41 7 394 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SRP7 8.41e-86 270 41 7 394 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
Q3ZAI8 8.61e-86 270 37 4 418 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
P56194 9.29e-86 271 36 5 419 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62374 9.29e-86 271 36 5 419 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
C0R4G6 1.16e-85 270 44 1 312 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q8XJ27 1.24e-85 270 41 7 394 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
B9KHM7 1.48e-85 270 47 2 312 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain Florida)
B9KG88 1.6e-85 270 37 5 387 3 hisS Histidine--tRNA ligase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q827T0 1.7e-85 270 37 9 416 3 hisS Histidine--tRNA ligase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9KXP2 3.33e-85 269 37 9 413 3 hisS Histidine--tRNA ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4FBB7 3.86e-85 269 36 5 419 3 hisS Histidine--tRNA ligase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q1AWC4 4.47e-85 269 38 7 400 3 hisS Histidine--tRNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5HV27 4.96e-85 268 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni (strain RM1221)
Q9PPF4 4.96e-85 268 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P60914 8.2e-85 268 44 3 318 3 hisS Histidine--tRNA ligase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q0S1B6 9.53e-85 268 37 5 412 3 hisS Histidine--tRNA ligase Rhodococcus jostii (strain RHA1)
Q5PBP9 2.67e-84 267 47 2 312 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain St. Maries)
A9NGF8 6.18e-84 266 40 6 379 3 hisS Histidine--tRNA ligase Acholeplasma laidlawii (strain PG-8A)
Q8NQ07 1.36e-83 265 37 9 430 3 hisS Histidine--tRNA ligase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C1B4E1 5.79e-83 263 37 6 410 3 hisS Histidine--tRNA ligase Rhodococcus opacus (strain B4)
Q2GHH1 8.54e-83 263 45 3 316 3 hisS Histidine--tRNA ligase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
B1H0I8 1.28e-82 262 41 5 358 3 hisS Histidine--tRNA ligase Endomicrobium trichonymphae
Q67LN9 2.1e-82 262 38 9 426 3 hisS Histidine--tRNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5GSM4 2.18e-82 261 41 4 348 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q2GCZ0 8.61e-82 260 41 1 317 3 hisS Histidine--tRNA ligase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q2N5U7 9.07e-82 261 40 2 351 3 hisS Histidine--tRNA ligase Erythrobacter litoralis (strain HTCC2594)
Q5L735 1.15e-81 260 46 3 302 3 hisS Histidine--tRNA ligase Chlamydia abortus (strain DSM 27085 / S26/3)
B1W3H3 1.62e-81 259 36 7 404 3 hisS Histidine--tRNA ligase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q5YTH9 3.83e-81 259 38 8 407 3 hisS Histidine--tRNA ligase Nocardia farcinica (strain IFM 10152)
A7H477 4.15e-80 256 37 5 387 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q824R3 4.98e-80 256 44 3 302 3 hisS Histidine--tRNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A1VZB3 5.14e-80 255 36 6 409 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FLH8 9.69e-80 254 37 5 387 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q252T8 3.99e-79 254 44 2 296 3 hisS Histidine--tRNA ligase Chlamydia felis (strain Fe/C-56)
Q9PQK6 5.05e-79 253 40 6 369 3 hisS Histidine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIS5 5.05e-79 253 40 6 369 3 hisS Histidine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10785
Feature type CDS
Gene hisS
Product histidine--tRNA ligase
Location 288609 - 289880 (strand: -1)
Length 1272 (nucleotides) / 423 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_60
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF13393 Histidyl-tRNA synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0124 Translation, ribosomal structure and biogenesis (J) J Histidyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01892 histidyl-tRNA synthetase [EC:6.1.1.21] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MEKIQSIRGMRSVLPEETPVWQWLENRIRNITTRYGYQEVRLPILEPVALFERAVGESTDIVSKEMYNFLDKSGEHITLRPEGTSGCVRTVIDNNMCYNTTQRLWYQGPMFRYERPQKGRLRQFTQFGVETFGMPGADIDAELIFMVKDIFKALGVDKHVRLEINSLGTPEERSEHRLQLVSYFTEHKALLDEDSLRRLDTNPLRILDSKNPDMQEMIEAAPRLLDFLGDESQQHFDDLRRLLDSENIAYVVNPRLVRGLDYYTRTVFEWITDELGSQGTVCGGGRYDGLVELFSGKKLPASGFAIGVERLLLLIQTLGLDKAIVNQPDIVVTYEDASQNVDALLLANTLRHQLPQYKILSDFTSAKLKRQHSSALKSGCRYIVTLNHDGEIGLWDLAENSNETVTGDTLAAAVLQKTITATA

Flanking regions ( +/- flanking 50bp)

TGATGACAGCCGGAATTTCTCACAGAGAAACTGTATATAGAGGACTAAAAATGGAAAAAATTCAGTCAATCAGAGGGATGCGAAGTGTGCTTCCGGAAGAAACCCCGGTTTGGCAGTGGCTGGAAAACCGGATACGCAATATTACCACCCGTTACGGATACCAGGAGGTCAGGCTGCCGATTCTGGAACCGGTCGCTCTGTTTGAGCGTGCGGTCGGCGAATCCACCGATATCGTCTCAAAAGAGATGTATAACTTCCTGGATAAAAGCGGTGAACATATCACGCTGCGTCCGGAAGGCACCAGTGGTTGCGTGCGCACGGTTATTGATAACAACATGTGCTACAACACCACGCAGCGCCTGTGGTATCAGGGACCGATGTTCCGTTATGAACGCCCGCAAAAAGGTCGCCTGCGTCAGTTTACGCAGTTCGGGGTGGAAACCTTTGGTATGCCGGGCGCTGATATTGATGCTGAACTAATTTTTATGGTGAAAGATATCTTTAAGGCACTCGGCGTAGATAAACATGTGCGCCTTGAGATTAACTCACTGGGCACACCGGAAGAGCGCTCAGAGCACCGCCTGCAACTGGTCAGTTACTTCACAGAACACAAAGCACTGCTGGATGAAGACAGCCTGCGCCGTCTGGACACCAACCCGCTGCGTATTCTCGACAGTAAAAACCCGGATATGCAGGAGATGATTGAAGCAGCACCACGCCTGCTGGATTTTCTGGGTGATGAATCACAACAGCACTTCGATGATTTACGCCGTCTGCTGGACAGCGAAAACATTGCTTATGTGGTAAATCCACGGCTGGTACGCGGTCTGGACTACTATACCCGCACTGTTTTTGAGTGGATCACCGATGAACTGGGTTCACAGGGGACAGTCTGCGGTGGCGGTCGTTATGACGGGCTGGTTGAGCTGTTCAGCGGTAAAAAACTGCCGGCGTCCGGATTTGCTATCGGTGTTGAGCGGCTGTTACTGCTGATCCAGACCTTAGGCCTGGATAAAGCGATTGTTAATCAACCCGATATTGTTGTGACTTATGAAGATGCTTCACAGAATGTGGATGCCCTGTTACTGGCAAACACACTGCGTCATCAGTTACCGCAATATAAAATACTGAGCGATTTCACCAGCGCCAAACTGAAACGTCAGCACAGCAGTGCCCTGAAATCAGGCTGCCGCTACATTGTGACGCTCAATCATGACGGAGAAATCGGTCTGTGGGATCTGGCGGAAAACAGTAATGAAACGGTGACCGGTGATACTCTCGCCGCGGCTGTTCTGCAAAAAACCATTACGGCAACAGCCTGATTTAACGCTATAAAATACTGAAAGCATCGCACTGCGATGCTTTTTTCTAT