Homologs in group_60

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01050 FBDBKF_01050 93.4 Morganella morganii S1 hisS histidine--tRNA ligase
FBDBKF_09165 FBDBKF_09165 51.0 Morganella morganii S1 hisS histidine--tRNA ligase
EHELCC_00495 EHELCC_00495 93.4 Morganella morganii S2 hisS histidine--tRNA ligase
EHELCC_10245 EHELCC_10245 51.0 Morganella morganii S2 hisS histidine--tRNA ligase
NLDBIP_02965 NLDBIP_02965 93.4 Morganella morganii S4 hisS histidine--tRNA ligase
NLDBIP_10590 NLDBIP_10590 51.0 Morganella morganii S4 hisS histidine--tRNA ligase
LHKJJB_04480 LHKJJB_04480 93.4 Morganella morganii S3 hisS histidine--tRNA ligase
LHKJJB_10765 LHKJJB_10765 51.0 Morganella morganii S3 hisS histidine--tRNA ligase
HKOGLL_02565 HKOGLL_02565 93.4 Morganella morganii S5 hisS histidine--tRNA ligase
HKOGLL_13825 HKOGLL_13825 51.0 Morganella morganii S5 hisS histidine--tRNA ligase
F4V73_RS10785 F4V73_RS10785 50.7 Morganella psychrotolerans hisS histidine--tRNA ligase
PMI_RS09100 PMI_RS09100 80.5 Proteus mirabilis HI4320 hisS histidine--tRNA ligase

Distribution of the homologs in the orthogroup group_60

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_60

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N705 0.0 733 81 0 424 3 hisS Histidine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EZT2 0.0 725 80 1 427 3 hisS Histidine--tRNA ligase Proteus mirabilis (strain HI4320)
Q1R8L9 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LNG9 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
P60906 0.0 696 77 1 425 1 hisS Histidine--tRNA ligase Escherichia coli (strain K12)
B1IWE7 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60907 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEX1 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE52 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O1:K1 / APEC
A8A320 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O9:H4 (strain HS)
B1XAY9 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / DH10B)
C4ZX89 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7L8 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O8 (strain IAI1)
B7MYE9 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O81 (strain ED1a)
B7NRG4 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0Y3 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60908 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7
B7MHZ9 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPV7 0.0 696 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UGW0 0.0 695 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N6A2 0.0 695 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LCQ4 0.0 695 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain 55989 / EAEC)
O52765 0.0 694 77 1 425 1 hisS Histidine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYN1 0.0 694 77 1 425 3 hisS Histidine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
A9N202 0.0 694 77 1 425 3 hisS Histidine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TD92 0.0 694 77 1 425 3 hisS Histidine--tRNA ligase Salmonella heidelberg (strain SL476)
A9MHL6 0.0 694 77 1 425 3 hisS Histidine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3YZ38 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Shigella sonnei (strain Ss046)
B4T0P8 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Salmonella newport (strain SL254)
B5R581 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FR62 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Salmonella dublin (strain CT_02021853)
Q32D48 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
B5BAY6 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNI1 0.0 693 77 1 425 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z4P4 0.0 692 77 1 425 3 hisS Histidine--tRNA ligase Salmonella typhi
B4TR94 0.0 692 77 1 425 3 hisS Histidine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B5F197 0.0 692 77 1 425 3 hisS Histidine--tRNA ligase Salmonella agona (strain SL483)
B2VE90 0.0 691 79 1 414 3 hisS Histidine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q57LI7 0.0 691 77 1 425 3 hisS Histidine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
B6I586 0.0 691 77 1 425 3 hisS Histidine--tRNA ligase Escherichia coli (strain SE11)
B2TXT9 0.0 690 77 1 425 3 hisS Histidine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q83K44 0.0 689 77 1 425 3 hisS Histidine--tRNA ligase Shigella flexneri
B5XNL6 0.0 689 77 1 425 3 hisS Histidine--tRNA ligase Klebsiella pneumoniae (strain 342)
A7FFZ0 0.0 688 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JKS3 0.0 688 78 1 425 3 hisS Histidine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GHW4 0.0 688 76 1 425 3 hisS Histidine--tRNA ligase Serratia proteamaculans (strain 568)
B5RCZ1 0.0 688 76 1 425 3 hisS Histidine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A4WD92 0.0 687 76 1 425 3 hisS Histidine--tRNA ligase Enterobacter sp. (strain 638)
Q31XX6 0.0 687 76 1 425 3 hisS Histidine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
B1JS06 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A0 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMT6 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CK90 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R801 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCT6 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pestis
B2K9P9 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5I9 0.0 686 78 1 425 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
C5BET0 0.0 681 76 1 425 3 hisS Histidine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
C6DBH3 0.0 679 75 1 424 3 hisS Histidine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7LKC4 0.0 679 75 2 430 3 hisS Histidine--tRNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q6D277 0.0 679 75 1 424 3 hisS Histidine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NS41 0.0 668 74 1 425 3 hisS Histidine--tRNA ligase Sodalis glossinidius (strain morsitans)
P62373 0.0 632 69 1 424 3 hisS Histidine--tRNA ligase Photobacterium profundum (strain SS9)
B5FAX3 0.0 629 69 1 424 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E771 0.0 629 69 1 424 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LT13 0.0 628 69 1 423 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTX0 0.0 628 69 1 423 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3G1 0.0 628 69 1 423 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MNF0 0.0 622 68 1 424 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain YJ016)
Q8DEZ9 0.0 622 68 1 424 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain CMCP6)
A7MZE2 0.0 592 65 1 424 3 hisS Histidine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q87S15 0.0 590 64 1 424 3 hisS Histidine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7VJT9 0.0 590 64 1 424 3 hisS Histidine--tRNA ligase Vibrio atlanticus (strain LGP32)
Q65R83 0.0 584 67 1 413 3 hisS Histidine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A4SP01 0.0 582 66 3 414 3 hisS Histidine--tRNA ligase Aeromonas salmonicida (strain A449)
A0KJ45 0.0 581 65 3 424 3 hisS Histidine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P57988 0.0 580 68 3 413 3 hisS Histidine--tRNA ligase Pasteurella multocida (strain Pm70)
C4LC38 0.0 578 66 2 424 3 hisS Histidine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q8EC33 0.0 575 65 3 426 3 hisS Histidine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q12PT3 0.0 575 63 3 427 3 hisS Histidine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A0KUJ6 0.0 572 65 2 424 3 hisS Histidine--tRNA ligase Shewanella sp. (strain ANA-3)
Q0HKV8 0.0 572 65 2 424 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-4)
B0USG9 0.0 572 66 2 409 3 hisS Histidine--tRNA ligase Histophilus somni (strain 2336)
P43823 0.0 572 65 3 412 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QNH3 0.0 572 65 3 412 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
Q0I2E8 0.0 571 66 2 409 3 hisS Histidine--tRNA ligase Histophilus somni (strain 129Pt)
Q0HX56 0.0 570 65 2 424 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-7)
B8CKR2 0.0 570 63 2 425 3 hisS Histidine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
A1RHQ4 0.0 570 64 3 426 3 hisS Histidine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y8T9 0.0 570 64 3 426 3 hisS Histidine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WQP6 0.0 568 63 3 426 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS185)
A3D6V8 0.0 568 63 3 426 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9S8 0.0 568 63 3 426 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS223)
A5UAB7 0.0 567 65 3 412 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittEE)
A9KXK7 0.0 567 63 3 426 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS195)
A8FT71 0.0 566 62 3 427 3 hisS Histidine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
A5UGH2 0.0 566 65 3 412 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittGG)
A8H246 0.0 565 63 2 425 3 hisS Histidine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TLI5 0.0 565 63 2 425 3 hisS Histidine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
Q085U5 0.0 565 63 3 427 3 hisS Histidine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
B3GY63 0.0 563 63 3 423 3 hisS Histidine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q3ICZ6 0.0 562 64 3 427 3 hisS Histidine--tRNA ligase Pseudoalteromonas translucida (strain TAC 125)
Q7VME1 0.0 561 63 3 423 3 hisS Histidine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VQX5 0.0 558 64 3 413 3 hisS Histidine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A3QCG3 0.0 556 63 4 426 3 hisS Histidine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S862 0.0 556 62 3 426 3 hisS Histidine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KKJ3 0.0 556 63 2 423 3 hisS Histidine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
B4RV88 0.0 551 62 2 425 3 hisS Histidine--tRNA ligase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q47WC1 0.0 548 65 3 426 3 hisS Histidine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15R57 0.0 548 61 2 426 3 hisS Histidine--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B8GTN4 0.0 537 61 4 429 3 hisS Histidine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q492E1 0.0 534 56 1 423 3 hisS Histidine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
Q3K7B7 0.0 528 60 2 423 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q5QYB0 0.0 526 62 2 407 3 hisS Histidine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B7UWI9 0.0 525 60 2 426 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
Q9HXJ5 0.0 525 60 2 426 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RV6 0.0 525 60 2 426 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1QTK7 0.0 525 61 3 416 3 hisS Histidine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1IEI0 0.0 524 60 5 424 3 hisS Histidine--tRNA ligase Pseudomonas entomophila (strain L48)
A4XY31 0.0 523 61 2 423 3 hisS Histidine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q88PJ6 0.0 520 60 2 422 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KPI8 0.0 520 60 2 422 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain GB-1)
A5VYT6 0.0 520 60 2 422 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q0VNE1 0.0 518 58 3 425 3 hisS Histidine--tRNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B1JDV7 0.0 516 59 2 422 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain W619)
Q4K6V0 0.0 516 61 2 423 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6V0W1 2.88e-180 512 61 2 426 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
Q886Y9 3.25e-180 512 61 2 426 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4VNX0 4e-180 511 62 4 428 3 hisS Histidine--tRNA ligase Stutzerimonas stutzeri (strain A1501)
C1DE56 1.65e-179 510 61 2 426 3 hisS Histidine--tRNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4ZX22 1.2e-178 508 60 2 426 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
C3K1L3 1.25e-178 508 60 2 423 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain SBW25)
Q48LZ3 2.11e-178 507 60 2 426 3 hisS Histidine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A6VV07 3.69e-177 504 59 2 411 3 hisS Histidine--tRNA ligase Marinomonas sp. (strain MWYL1)
Q7VRR8 9.49e-174 496 55 1 421 3 hisS Histidine--tRNA ligase Blochmanniella floridana
A1WXZ0 1.46e-168 482 57 3 401 3 hisS Histidine--tRNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
C1DD44 2.7e-168 481 56 4 423 3 hisS Histidine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
Q603B8 4.26e-168 481 56 3 417 3 hisS Histidine--tRNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q31I05 3.61e-167 479 55 2 411 3 hisS Histidine--tRNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q7NS89 7.07e-166 475 55 4 425 3 hisS Histidine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1H0V0 8.08e-166 475 55 4 416 3 hisS Histidine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B6IZN1 2.67e-165 474 55 2 417 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
Q83C80 2.7e-165 474 55 2 417 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV9 2.7e-165 474 55 2 417 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU6 2.7e-165 474 55 2 417 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
B6J7Q5 2.98e-165 473 55 2 417 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
Q5P7B4 1.14e-164 473 55 5 426 3 hisS Histidine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P59482 2.63e-164 471 49 2 422 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8K9P3 1.62e-163 469 49 1 424 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1K3Z0 2.53e-163 469 55 6 427 3 hisS Histidine--tRNA ligase Azoarcus sp. (strain BH72)
Q6FEM2 5.77e-163 468 56 6 423 3 hisS Histidine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P57375 5.28e-161 463 50 2 424 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q0A986 6.71e-161 463 55 4 422 3 hisS Histidine--tRNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5WWH1 1.19e-160 462 53 2 426 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Lens)
Q5X519 1.37e-160 462 53 2 426 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Paris)
Q5ZV96 1.86e-160 461 53 2 426 3 hisS Histidine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B2I3E6 2.23e-160 461 54 6 429 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ACICU)
A3M212 3.31e-160 461 54 6 429 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q0AE43 5.8e-160 460 56 5 412 3 hisS Histidine--tRNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q47BR7 1.31e-159 459 56 5 411 3 hisS Histidine--tRNA ligase Dechloromonas aromatica (strain RCB)
B7I5G8 5.28e-159 458 55 6 429 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB0057)
B0V5G6 1.72e-158 457 55 6 429 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AYE)
B7H068 1.72e-158 457 55 6 429 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
B0VKR7 1.42e-157 454 55 6 429 1 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain SDF)
B2JIV0 3.1e-157 454 53 5 428 3 hisS Histidine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q82XU9 4.31e-157 453 54 4 410 3 hisS Histidine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3SL69 4.3e-156 450 55 4 418 3 hisS Histidine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
Q2SWE3 5.95e-156 451 52 7 430 1 hisS Histidine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q13X29 7.64e-156 451 55 4 404 3 hisS Histidine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
B2SXS9 3.67e-155 449 53 5 428 3 hisS Histidine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A3NA53 8.41e-155 448 53 7 431 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 668)
Q7VWL1 9.77e-155 447 53 7 421 3 hisS Histidine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W6P7 1.3e-154 447 53 7 421 3 hisS Histidine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN1 1.3e-154 447 53 7 421 3 hisS Histidine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3JRQ5 1.99e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A1V4K0 1.99e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62JW5 1.99e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2S2A3 1.99e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3MK74 1.99e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
Q63UT2 2.7e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain K96243)
A3NVX0 2.7e-154 447 52 7 431 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
Q46ZI4 5.43e-154 446 55 5 412 3 hisS Histidine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2KY92 1.68e-153 444 52 7 429 3 hisS Histidine--tRNA ligase Bordetella avium (strain 197N)
A1AWV6 2.72e-153 443 52 3 412 3 hisS Histidine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
A9AGZ7 3.21e-153 444 54 4 404 3 hisS Histidine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
Q9JUZ9 4.04e-153 443 52 5 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0K963 6.95e-153 443 53 6 427 3 hisS Histidine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A4JEN9 7.11e-153 443 53 6 428 3 hisS Histidine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q9JZX9 8.21e-153 442 52 5 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q1BGX3 9.03e-153 443 53 6 428 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain AU 1054)
A0K7T5 9.03e-153 443 53 6 428 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
B3R1K1 4.53e-152 441 53 7 429 3 hisS Histidine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B1JT91 5.64e-152 441 53 6 428 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain MC0-3)
B4EAW8 5.64e-152 441 53 6 428 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39FR0 5.7e-152 441 53 6 428 3 hisS Histidine--tRNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1KT95 6.24e-152 440 52 5 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M402 9.24e-152 439 52 5 431 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C (strain 053442)
Q0BEW8 1.32e-151 440 52 6 428 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YR43 1.32e-151 440 52 6 428 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
Q5F9G8 3.24e-151 438 51 5 431 3 hisS Histidine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5CWE8 1.33e-150 436 51 3 412 3 hisS Histidine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q8Y029 3.61e-150 436 52 5 425 3 hisS Histidine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1QD17 2.15e-148 431 52 5 427 3 hisS Histidine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A5WGQ0 5.76e-148 430 51 6 423 3 hisS Histidine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
Q4FTW6 5.04e-146 426 51 5 438 3 hisS Histidine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B9MFX7 9.74e-142 414 51 7 414 3 hisS Histidine--tRNA ligase Acidovorax ebreus (strain TPSY)
A1W578 1.22e-141 414 50 7 414 3 hisS Histidine--tRNA ligase Acidovorax sp. (strain JS42)
B2SEW9 1.82e-139 408 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
A7NEI6 2.17e-139 408 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A0Q8F1 2.42e-139 407 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. novicida (strain U112)
A4IW12 6.24e-139 407 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIL5 6.24e-139 407 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K18 6.24e-139 407 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
Q2A1H0 6.88e-139 406 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain LVS)
Q31KX6 1.54e-138 406 52 5 417 3 hisS Histidine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q0BK72 1.59e-138 405 49 3 404 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
B8HMM0 2.43e-137 403 50 4 417 3 hisS Histidine--tRNA ligase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q8DHP7 2.17e-136 400 50 6 414 3 hisS Histidine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5N0Z5 3.48e-136 400 52 5 417 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B0TWR5 2.07e-134 395 50 4 404 3 hisS Histidine--tRNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B1XJ88 1.93e-133 393 49 4 418 3 hisS Histidine--tRNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q55653 1.94e-133 394 50 4 420 3 hisS Histidine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0CDA0 1.9e-131 388 48 4 420 3 hisS Histidine--tRNA ligase Acaryochloris marina (strain MBIC 11017)
B1WVZ0 1.39e-130 386 46 5 424 3 hisS Histidine--tRNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A2CCR1 1.62e-130 386 48 5 414 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
B3EB83 1.16e-129 383 48 5 409 3 hisS Histidine--tRNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q7V4P3 1.46e-129 383 48 4 414 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
Q2JRX6 1.55e-129 382 49 5 413 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain JA-3-3Ab)
Q0IDK4 2.68e-129 382 48 5 417 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9311)
A1ANS7 2.23e-128 379 47 6 410 3 hisS Histidine--tRNA ligase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B0JRF1 2.41e-128 380 48 5 421 3 hisS Histidine--tRNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q833I1 1.97e-127 378 44 5 423 3 hisS Histidine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
P60915 3.37e-127 376 48 6 406 3 hisS Histidine--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A5GQA2 4.33e-127 376 49 3 415 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain RCC307)
Q3B0D3 4.39e-127 377 49 4 407 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9902)
A2C182 1.36e-126 375 48 3 400 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL1A)
Q39UD2 1.8e-126 375 47 6 407 3 hisS Histidine--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6AQS3 3.25e-126 374 46 6 411 3 hisS Histidine--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q46LS5 3.28e-126 374 47 3 400 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL2A)
B7K2B6 5.02e-126 374 46 4 421 3 hisS Histidine--tRNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q7U9Q6 1.33e-125 373 46 5 424 3 hisS Histidine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
B8CXE6 3.25e-125 372 44 5 423 3 hisS Histidine--tRNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B4UEL3 5.41e-125 371 45 3 418 3 hisS Histidine--tRNA ligase Anaeromyxobacter sp. (strain K)
Q6B910 7.51e-125 371 43 3 419 3 hisS Histidine--tRNA ligase, chloroplastic Gracilaria tenuistipitata var. liui
B8JBF6 1.83e-124 369 45 3 418 3 hisS Histidine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q3A5R6 1.95e-124 370 46 6 424 3 hisS Histidine--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B7KFP0 3.67e-124 369 48 4 420 3 hisS Histidine--tRNA ligase Gloeothece citriformis (strain PCC 7424)
C1CU26 4.13e-124 369 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Taiwan19F-14)
A1V9B1 4.92e-124 369 47 6 421 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain DP4)
C1CNA0 5.19e-124 369 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain P1031)
Q8DN46 6.32e-124 369 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZPP6 6.32e-124 369 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04I50 6.32e-124 369 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A3DF35 8.75e-124 368 44 4 416 3 hisS Histidine--tRNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P62379 1.17e-123 367 47 7 424 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C1CH52 1.34e-123 368 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain JJA)
P60913 2.09e-123 367 46 5 419 3 hisS Histidine--tRNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q7VCG1 2.18e-123 367 47 4 405 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A5GIA4 2.24e-123 368 47 3 408 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain WH7803)
Q97NC9 5.09e-123 366 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CAV1 5.61e-123 366 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain 70585)
A9B9Z7 5.74e-123 366 47 3 402 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
Q5FUR8 8.76e-123 365 46 3 417 3 hisS Histidine--tRNA ligase Gluconobacter oxydans (strain 621H)
B5E3C8 1.4e-122 365 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
B1I9T7 3.4e-122 364 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
A4VT07 4.32e-122 364 43 4 424 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZ92 4.32e-122 364 43 4 424 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 98HAH33)
B2IN41 9.87e-122 363 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
A9HJ49 5.27e-121 361 45 4 423 3 hisS Histidine--tRNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q2RWE3 5.44e-121 360 45 4 421 3 hisS Histidine--tRNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P51348 1.01e-120 360 44 5 424 3 hisS Histidine--tRNA ligase, chloroplastic Porphyra purpurea
C3KTB7 1.46e-120 360 43 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain 657 / Type Ba4)
Q8EPR9 4e-120 359 43 5 425 3 hisS Histidine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C6BVJ9 5.81e-120 358 45 9 418 3 hisS Histidine--tRNA ligase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
P0DG41 6.53e-120 358 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG40 6.53e-120 358 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A2RGY1 1.4e-119 357 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8NZ19 1.56e-119 357 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
A2RN96 1.59e-119 357 43 5 408 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
B5XJ83 1.87e-119 357 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
Q5X9E5 2.2e-119 357 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
C1FKE6 2.6e-119 356 43 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Kyoto / Type A2)
Q5WHP4 2.89e-119 357 43 5 423 3 hisS1 Histidine--tRNA ligase 1 Shouchella clausii (strain KSM-K16)
Q8RGJ5 4.24e-119 356 43 4 410 3 hisS Histidine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B2GBY6 4.75e-119 356 43 6 412 3 hisS Histidine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A5I6D6 4.78e-119 356 42 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY04 4.78e-119 356 42 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
B1IMD8 5.1e-119 355 42 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
A7GHS3 5.75e-119 355 42 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A3CR40 5.92e-119 356 44 4 412 3 hisS Histidine--tRNA ligase Streptococcus sanguinis (strain SK36)
A5FX98 7.07e-119 355 45 4 415 3 hisS Histidine--tRNA ligase Acidiphilium cryptum (strain JF-5)
Q99XK9 7.35e-119 355 44 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M1
B1L097 8.69e-119 355 42 6 407 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
A8AZV0 1.47e-118 355 44 4 412 3 hisS Histidine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
O66522 1.9e-118 354 47 8 415 3 hisS Histidine--tRNA ligase Aquifex aeolicus (strain VF5)
Q02WI8 2.98e-118 354 43 5 408 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
Q38XB7 3.53e-118 354 43 6 422 3 hisS Histidine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
Q03SE4 4.8e-118 353 44 6 409 3 hisS Histidine--tRNA ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q9CE78 7.17e-118 353 43 5 409 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q48QS7 1.33e-117 352 43 4 401 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
B5YHK1 1.52e-117 352 45 7 424 3 hisS Histidine--tRNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q1ISE2 1.59e-117 353 44 6 425 3 hisS Histidine--tRNA ligase Koribacter versatilis (strain Ellin345)
C4XT36 2.4e-117 352 45 6 421 3 hisS Histidine--tRNA ligase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A4J2J1 4.82e-117 351 44 4 405 3 hisS Histidine--tRNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A7Z751 7.18e-117 350 44 5 407 3 hisS Histidine--tRNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q038S0 5.7e-116 348 42 5 426 3 hisS Histidine--tRNA ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEM3 5.7e-116 348 42 5 426 3 hisS Histidine--tRNA ligase Lacticaseibacillus casei (strain BL23)
Q317R4 8.11e-116 347 45 6 412 3 hisS Histidine--tRNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q5KWS8 8.52e-116 348 42 5 425 3 hisS Histidine--tRNA ligase Geobacillus kaustophilus (strain HTA426)
A2BQA4 1.07e-115 347 45 4 401 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain AS9601)
B3CLR6 2.77e-115 346 42 4 408 3 hisS Histidine--tRNA ligase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A7GT85 3.17e-115 346 42 5 425 3 hisS Histidine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C0QFI0 3.49e-115 346 43 4 408 3 hisS Histidine--tRNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
O32039 4.2e-115 346 43 6 416 3 hisS Histidine--tRNA ligase Bacillus subtilis (strain 168)
A2BVT6 5.49e-115 346 44 3 389 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
A9F907 5.62e-115 346 44 6 422 3 hisS Histidine--tRNA ligase Sorangium cellulosum (strain So ce56)
B8FKS7 1.21e-114 345 43 5 423 3 hisS Histidine--tRNA ligase Desulfatibacillum aliphaticivorans
A4XHB0 1.84e-114 344 40 4 418 3 hisS Histidine--tRNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q31BR1 2.36e-114 344 45 4 401 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
A7HN13 4.58e-114 343 44 8 426 3 hisS Histidine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B0TF88 6.6e-114 343 45 3 408 3 hisS Histidine--tRNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q8CWW2 1.25e-113 342 42 4 400 3 hisS Histidine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A0PZW9 1.82e-113 342 40 6 422 3 hisS Histidine--tRNA ligase Clostridium novyi (strain NT)
Q03IB2 3.7e-113 341 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q1XDD9 3.98e-113 341 44 6 424 3 hisS Histidine--tRNA ligase, chloroplastic Neopyropia yezoensis
Q8D1Y2 4.83e-113 341 44 4 415 3 hisS Histidine--tRNA ligase Wigglesworthia glossinidia brevipalpis
Q3AA16 6.38e-113 340 41 4 412 3 hisS Histidine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B7GFR0 6.59e-113 340 40 5 425 3 hisS Histidine--tRNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A4IR95 1.09e-112 340 41 5 422 3 hisS Histidine--tRNA ligase Geobacillus thermodenitrificans (strain NG80-2)
B2A2F9 1.17e-112 340 41 6 423 3 hisS Histidine--tRNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
C5D510 1.36e-112 340 41 5 425 3 hisS Histidine--tRNA ligase Geobacillus sp. (strain WCH70)
A5D3E2 1.55e-112 339 43 4 415 3 hisS Histidine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5M281 2.17e-112 339 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXM9 2.17e-112 339 43 4 423 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain CNRZ 1066)
Q88VQ7 2.58e-112 339 41 6 425 3 hisS Histidine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8RAI8 3.41e-112 338 42 4 407 3 hisS Histidine--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9KDG2 3.41e-112 338 42 6 424 3 hisS Histidine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A3PBZ7 3.81e-112 338 44 4 401 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
Q7V263 5.67e-112 338 43 3 398 3 hisS Histidine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q71ZF0 5.76e-112 338 39 5 421 3 hisS Histidine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
Q3JYL6 6.34e-112 338 42 5 426 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q817X7 7.01e-112 338 40 5 425 3 hisS-2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8Y708 7.97e-112 338 39 5 426 3 hisS Histidine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A5N1Y9 9.45e-112 337 41 6 419 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5P3 9.45e-112 337 41 6 419 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain NBRC 12016)
Q92BJ3 1.06e-111 337 40 6 424 3 hisS Histidine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q24US1 1.19e-111 337 43 4 408 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain Y51)
B8FQR7 1.19e-111 337 43 4 408 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q6HDC2 1.29e-111 337 40 5 425 3 hisS2 Histidine--tRNA ligase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E2 1.29e-111 337 40 5 425 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ZK / E33L)
Q81LI6 1.29e-111 337 40 5 425 3 hisS-2 Histidine--tRNA ligase 2 Bacillus anthracis
B0K977 1.59e-111 337 41 4 419 3 hisS Histidine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
C1B4E1 1.94e-111 337 43 5 425 3 hisS Histidine--tRNA ligase Rhodococcus opacus (strain B4)
Q028M4 2.65e-111 336 44 6 420 3 hisS Histidine--tRNA ligase Solibacter usitatus (strain Ellin6076)
A6LL06 2.76e-111 336 43 6 405 3 hisS Histidine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
P67486 3.83e-111 336 41 4 423 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67485 3.83e-111 336 41 4 423 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
P62370 3.85e-111 336 40 5 425 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
C0ZZ58 3.97e-111 336 44 5 424 3 hisS Histidine--tRNA ligase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
C4L534 6.52e-111 335 40 8 426 3 hisS Histidine--tRNA ligase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B1I363 1.72e-110 334 43 5 418 3 hisS Histidine--tRNA ligase Desulforudis audaxviator (strain MP104C)
Q0S1B6 1.95e-110 334 43 5 425 3 hisS Histidine--tRNA ligase Rhodococcus jostii (strain RHA1)
B9E707 2.57e-110 333 41 6 421 3 hisS Histidine--tRNA ligase Macrococcus caseolyticus (strain JCSC5402)
Q65GR3 2.65e-110 333 42 5 407 3 hisS Histidine--tRNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C0MB21 3.17e-110 333 42 4 425 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. equi (strain 4047)
B0K0N4 1.61e-109 332 41 4 419 3 hisS Histidine--tRNA ligase Thermoanaerobacter sp. (strain X514)
C0MGD4 4.28e-109 331 41 4 425 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain H70)
B9MPF7 4.39e-109 330 38 4 422 3 hisS Histidine--tRNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B9DW81 1.21e-108 330 40 4 424 3 hisS Histidine--tRNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P60917 1.27e-108 329 44 5 423 3 hisS Histidine--tRNA ligase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q1RJ50 1.75e-108 329 42 5 412 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain RML369-C)
A8GVU9 1.75e-108 329 42 5 412 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain OSU 85-389)
A1T898 2.16e-108 329 44 5 407 3 hisS Histidine--tRNA ligase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q6ME90 3.08e-108 328 40 6 420 3 hisS Histidine--tRNA ligase Protochlamydia amoebophila (strain UWE25)
B1HV72 3.87e-108 328 41 5 423 3 hisS Histidine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
Q183H5 4.06e-108 328 39 5 421 3 hisS Histidine--tRNA ligase Clostridioides difficile (strain 630)
Q0SRP7 4.3e-108 328 43 4 405 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
P9WFV5 5.59e-108 328 43 6 425 1 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFV4 5.59e-108 328 43 6 425 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5T0 5.59e-108 328 43 6 425 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AF49 5.59e-108 328 43 6 425 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLS8 5.59e-108 328 43 6 425 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67484 5.59e-108 328 43 6 425 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0TP27 5.7e-108 327 42 4 405 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XJ27 6.36e-108 327 43 4 405 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
B4U0K6 8.6e-108 327 42 4 412 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C4LIW5 8.69e-108 327 44 5 410 3 hisS Histidine--tRNA ligase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
A6Q9Z9 1.27e-107 326 42 4 411 3 hisS Histidine--tRNA ligase Sulfurovum sp. (strain NBC37-1)
B7IHK5 1.52e-107 327 43 6 405 3 hisS Histidine--tRNA ligase Thermosipho africanus (strain TCF52B)
A8MGM7 1.55e-107 327 39 5 417 3 hisS Histidine--tRNA ligase Alkaliphilus oremlandii (strain OhILAs)
Q1WTV0 1.92e-107 327 38 5 424 3 hisS Histidine--tRNA ligase Ligilactobacillus salivarius (strain UCC118)
P30053 5.36e-107 325 42 4 412 1 hisS Histidine--tRNA ligase Streptococcus dysgalactiae subsp. equisimilis
B2HN79 8.7e-107 325 44 5 407 3 hisS Histidine--tRNA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q04AV4 1.15e-106 325 41 6 421 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAG8 1.2e-106 325 41 6 425 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A8F593 1.5e-106 324 41 6 403 3 hisS Histidine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q1AWC4 3.14e-106 323 40 5 414 3 hisS Histidine--tRNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A5IN85 3.3e-106 323 43 5 410 3 hisS Histidine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A8ZUR6 3.86e-106 323 43 5 409 3 hisS Histidine--tRNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q2RHW0 4.08e-106 323 43 4 402 3 hisS Histidine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q5YTH9 4.17e-106 323 44 5 408 3 hisS Histidine--tRNA ligase Nocardia farcinica (strain IFM 10152)
Q0AYS2 5.12e-106 323 40 4 422 3 hisS Histidine--tRNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A0PPE8 5.98e-106 322 44 5 407 3 hisS Histidine--tRNA ligase Mycobacterium ulcerans (strain Agy99)
C0R4G6 9.15e-106 322 41 5 412 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
B5YDT1 1.64e-105 321 41 5 409 3 hisS Histidine--tRNA ligase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
P62351 1.85e-105 321 41 5 412 3 hisS Histidine--tRNA ligase Wolbachia pipientis wMel
Q30RH3 2.14e-105 320 42 5 408 3 hisS Histidine--tRNA ligase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B1L829 2.97e-105 321 43 5 402 3 hisS Histidine--tRNA ligase Thermotoga sp. (strain RQ2)
P60912 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MW2)
P60911 8.39e-105 320 41 5 417 1 hisS Histidine--tRNA ligase Staphylococcus aureus
A8Z2F8 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T8 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q6GG72 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MRSA252)
P60910 8.39e-105 320 41 5 417 1 hisS Histidine--tRNA ligase Staphylococcus aureus (strain N315)
P60909 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHH3 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Newman)
Q5HFD2 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YT99 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITF5 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH9)
Q2FXU4 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG96 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300)
A6U299 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH1)
A7X345 8.39e-105 320 41 5 417 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9X0H5 1.17e-104 319 43 5 402 3 hisS Histidine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A9KIA5 2.99e-104 318 42 6 389 3 hisS Histidine--tRNA ligase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q4L6X6 4.67e-104 318 40 5 423 3 hisS Histidine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
A7ZDK1 9.03e-104 317 40 6 418 3 hisS Histidine--tRNA ligase Campylobacter concisus (strain 13826)
P46696 1.76e-103 316 44 5 413 3 hisS Histidine--tRNA ligase Mycobacterium leprae (strain TN)
A6Q371 4.08e-103 315 43 5 406 3 hisS Histidine--tRNA ligase Nitratiruptor sp. (strain SB155-2)
Q2GLK4 4.22e-103 315 39 3 421 3 hisS Histidine--tRNA ligase Anaplasma phagocytophilum (strain HZ)
Q8CS98 4.29e-103 315 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS1 4.29e-103 315 39 6 418 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8YUZ9 5.96e-103 315 39 5 414 3 hisS Histidine--tRNA ligase Lactobacillus helveticus (strain DPC 4571)
A9NGF8 6.1e-103 315 40 8 427 3 hisS Histidine--tRNA ligase Acholeplasma laidlawii (strain PG-8A)
Q03F51 8.67e-103 315 39 8 427 3 hisS Histidine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B8E1C1 1.04e-102 314 40 5 410 3 hisS Histidine--tRNA ligase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B3QS95 1.82e-102 314 39 5 420 3 hisS Histidine--tRNA ligase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q5GSM4 7.59e-102 311 39 4 419 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q043X4 8.62e-102 312 38 5 419 3 hisS Histidine--tRNA ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q3ZWB6 1.52e-101 311 42 5 409 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
A5FSR7 1.52e-101 311 42 5 409 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q67LN9 1.71e-101 311 40 7 430 3 hisS Histidine--tRNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q49Y69 1.86e-101 311 40 5 412 3 hisS Histidine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P56194 2.39e-101 311 42 5 423 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62374 2.39e-101 311 42 5 423 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P60916 3.83e-101 310 39 5 414 3 hisS Histidine--tRNA ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A0RPD3 5.53e-101 309 40 5 418 3 hisS Histidine--tRNA ligase Campylobacter fetus subsp. fetus (strain 82-40)
B9KHM7 5.76e-101 310 42 6 419 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain Florida)
Q5FKI5 7.41e-101 310 37 6 427 3 hisS Histidine--tRNA ligase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q3ZAI8 1.57e-100 308 42 5 409 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A8GMY5 1.92e-100 308 40 5 414 3 hisS Histidine--tRNA ligase Rickettsia akari (strain Hartford)
Q5PBP9 3.82e-100 308 42 6 419 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain St. Maries)
A4FBB7 6.97e-100 307 41 5 423 3 hisS Histidine--tRNA ligase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q8FPL5 1.96e-99 306 41 5 411 3 hisS Histidine--tRNA ligase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3YRB1 2.7e-99 305 40 4 412 3 hisS Histidine--tRNA ligase Ehrlichia canis (strain Jake)
Q4JVE8 4.96e-99 305 41 5 421 3 hisS Histidine--tRNA ligase Corynebacterium jeikeium (strain K411)
Q2GBN6 6.91e-99 304 43 3 387 3 hisS Histidine--tRNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q3AQK2 6.98e-99 305 40 5 413 3 hisS Histidine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
Q5HAI0 9.86e-99 304 39 6 413 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Welgevonden)
B3ELN3 1.15e-98 304 40 7 425 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain BS1)
Q8NQ07 1.23e-98 304 41 5 411 3 hisS Histidine--tRNA ligase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5FG57 1.62e-98 303 39 6 413 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Gardel)
Q3B1Z1 2.61e-98 303 40 9 421 3 hisS Histidine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q4UM71 2.96e-98 303 38 5 413 3 hisS Histidine--tRNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B3EFA6 5.38e-98 302 40 5 408 3 hisS Histidine--tRNA ligase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B9DNF9 6.57e-98 302 39 5 419 3 hisS Histidine--tRNA ligase Staphylococcus carnosus (strain TM300)
B1W3H3 7.52e-98 301 40 5 425 3 hisS Histidine--tRNA ligase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q2GHH1 9.56e-98 301 39 5 413 3 hisS Histidine--tRNA ligase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
B1VDK9 1.39e-97 301 40 5 415 3 hisS Histidine--tRNA ligase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
A4SE02 1.88e-97 301 39 8 431 3 hisS Histidine--tRNA ligase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
P60914 3.82e-97 300 41 5 415 3 hisS Histidine--tRNA ligase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B0BWZ9 6.39e-97 299 38 4 413 3 hisS Histidine--tRNA ligase Rickettsia rickettsii (strain Iowa)
Q92IK8 6.89e-97 299 38 4 413 3 hisS Histidine--tRNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B3QQI7 8.46e-97 299 39 8 423 3 hisS Histidine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q827T0 3.33e-96 297 40 5 426 3 hisS Histidine--tRNA ligase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A8EZE6 3.67e-96 297 38 4 412 3 hisS Histidine--tRNA ligase Rickettsia canadensis (strain McKiel)
C3PN13 4.23e-96 297 38 4 413 3 hisS Histidine--tRNA ligase Rickettsia africae (strain ESF-5)
Q9KXP2 1.56e-95 296 40 5 426 3 hisS Histidine--tRNA ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1VZB3 2.19e-95 295 39 5 417 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q68X64 2.39e-95 295 38 4 411 3 hisS Histidine--tRNA ligase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
C4K1W2 3.06e-95 295 37 4 413 3 hisS Histidine--tRNA ligase Rickettsia peacockii (strain Rustic)
Q8KFT6 5.4e-95 295 39 8 418 3 hisS Histidine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A7H477 7.83e-95 293 39 5 417 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q2N5U7 1.08e-94 295 47 2 321 3 hisS Histidine--tRNA ligase Erythrobacter litoralis (strain HTCC2594)
A8FLH8 1.9e-94 293 39 5 417 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HV27 3.12e-94 292 39 5 417 3 hisS Histidine--tRNA ligase Campylobacter jejuni (strain RM1221)
Q9PPF4 3.12e-94 292 39 5 417 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9ZDL9 5.41e-94 291 37 3 408 3 hisS Histidine--tRNA ligase Rickettsia prowazekii (strain Madrid E)
B4SCE2 8.56e-94 291 40 5 409 3 hisS Histidine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B1H0I8 1.32e-93 290 41 8 418 3 hisS Histidine--tRNA ligase Endomicrobium trichonymphae
A1BDE6 5.1e-92 287 39 5 406 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A7I1U5 3.61e-91 284 38 6 421 3 hisS Histidine--tRNA ligase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B9KG88 3.63e-91 284 38 6 417 3 hisS Histidine--tRNA ligase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B1VA46 6.81e-91 283 38 5 410 3 hisS Histidine--tRNA ligase Phytoplasma australiense
B3CTK8 2.54e-90 282 36 5 428 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Ikeda)
Q8EWB8 7.64e-90 281 36 7 425 3 hisS Histidine--tRNA ligase Malacoplasma penetrans (strain HF-2)
A5CEP8 8.49e-90 281 36 5 428 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Boryong)
Q2GCZ0 1.12e-89 280 37 5 424 3 hisS Histidine--tRNA ligase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
B4S4H1 3.21e-88 277 38 5 421 3 hisS Histidine--tRNA ligase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B2KBC0 9.89e-87 273 38 8 405 3 hisS Histidine--tRNA ligase Elusimicrobium minutum (strain Pei191)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07125
Feature type CDS
Gene hisS
Product histidine--tRNA ligase
Location 1479013 - 1480290 (strand: -1)
Length 1278 (nucleotides) / 425 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_60
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF03129 Anticodon binding domain
PF13393 Histidyl-tRNA synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0124 Translation, ribosomal structure and biogenesis (J) J Histidyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01892 histidyl-tRNA synthetase [EC:6.1.1.21] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MAKNIQAIRGMNDYLPADTIVWQRIESTLKRILTNYGISEIRTPIVEHTPLFQRAIGEVTDVVEKEMYSFQDRGDESLTLRPEGTAGCVRAGIERGLLYNQEQRLWYIGPMFRYERPQKGRYRQFHQLGAEIFGLSGPDIDAELIMMTARWWRELGIAEHVTLELNSIGSLQARANYREALVAFLEQHKEKLDEDCKRRMYTNPLRVLDSKDQGVQTLLNDAPKLFDYLDEESKIHFDGLCAILDAAGIQYRINQRLVRGLDYYNRTVFEWVTTALGAQGTVCAGGRYDGLVEQLGGHNTPAVGFAMGLERMVLLVQEVNPDFVKETAVTDIYLASFGDGSQVAAMLLAEQVRDSLPGVRIMTNYGGGNFKKQLGRADKNGARIALILGEDEIANGTVTVKELATGEQQTLAQSGLSARLSELLG

Flanking regions ( +/- flanking 50bp)

GGGTCGCTTTTATAATCGGTAACATATTTCATTGAGTTAAGAGAACTAACGTGGCCAAAAATATCCAAGCCATTCGTGGTATGAATGATTATCTGCCTGCTGATACGATTGTCTGGCAGCGCATTGAAAGCACGCTCAAACGTATTCTGACAAATTACGGGATCAGTGAAATTCGCACACCCATTGTCGAGCACACCCCGCTGTTTCAGCGCGCCATCGGCGAAGTCACTGATGTTGTTGAAAAAGAAATGTATTCTTTTCAGGATCGTGGTGATGAAAGTTTAACGCTGCGTCCTGAAGGAACAGCGGGCTGTGTTCGCGCAGGTATTGAGCGCGGATTACTGTATAACCAGGAACAGCGCCTCTGGTATATCGGGCCGATGTTCCGCTATGAGCGCCCGCAGAAAGGCCGCTATCGCCAGTTCCATCAGTTAGGTGCGGAAATTTTCGGGCTGAGTGGTCCGGATATTGATGCTGAGCTGATTATGATGACCGCCCGCTGGTGGCGTGAACTGGGTATTGCAGAACATGTTACACTGGAGTTGAACTCTATTGGTTCGCTGCAGGCGCGTGCAAACTACCGAGAAGCGCTGGTCGCATTCCTGGAGCAGCACAAAGAAAAACTGGATGAAGACTGTAAGCGCCGGATGTACACAAATCCGCTGCGCGTACTGGACTCGAAAGATCAGGGCGTGCAGACGCTCCTGAACGATGCACCAAAACTGTTTGATTATCTGGATGAAGAATCAAAAATCCACTTTGACGGTTTGTGCGCCATTCTGGATGCCGCCGGTATTCAATACCGTATTAATCAGCGTCTGGTCCGTGGTCTTGATTATTATAACCGCACCGTGTTTGAGTGGGTCACAACCGCACTTGGCGCACAGGGTACAGTGTGTGCCGGTGGTCGTTACGACGGGCTGGTTGAGCAACTCGGTGGTCACAATACACCGGCGGTCGGTTTTGCGATGGGCCTGGAGCGTATGGTGCTGCTGGTTCAGGAAGTTAATCCTGACTTTGTAAAAGAAACCGCAGTTACCGATATTTATCTGGCATCATTCGGTGACGGCAGCCAGGTGGCAGCAATGTTACTGGCAGAGCAGGTTCGCGACAGTTTACCCGGCGTACGCATTATGACCAACTACGGCGGCGGCAACTTTAAAAAACAGTTAGGTCGCGCTGACAAAAACGGTGCACGTATCGCGCTGATTTTGGGTGAGGATGAAATCGCCAACGGGACAGTGACAGTTAAAGAACTGGCTACCGGTGAGCAACAGACGCTGGCACAGAGCGGGTTATCTGCCCGTCTGAGCGAACTTTTAGGTTAAGGAGAGACGCGTGGAAGTCTATACCACAGAAAATGAACAGGTATCAGTGC