Homologs in group_44

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01050 FBDBKF_01050 51.5 Morganella morganii S1 hisS histidine--tRNA ligase
FBDBKF_09165 FBDBKF_09165 100.0 Morganella morganii S1 hisS histidine--tRNA ligase
EHELCC_00495 EHELCC_00495 51.5 Morganella morganii S2 hisS histidine--tRNA ligase
NLDBIP_02965 NLDBIP_02965 51.5 Morganella morganii S4 hisS histidine--tRNA ligase
NLDBIP_10590 NLDBIP_10590 100.0 Morganella morganii S4 hisS histidine--tRNA ligase
LHKJJB_04480 LHKJJB_04480 51.5 Morganella morganii S3 hisS histidine--tRNA ligase
LHKJJB_10765 LHKJJB_10765 100.0 Morganella morganii S3 hisS histidine--tRNA ligase
HKOGLL_02565 HKOGLL_02565 51.5 Morganella morganii S5 hisS histidine--tRNA ligase
HKOGLL_13825 HKOGLL_13825 100.0 Morganella morganii S5 hisS histidine--tRNA ligase
F4V73_RS07125 F4V73_RS07125 51.0 Morganella psychrotolerans hisS histidine--tRNA ligase
F4V73_RS10785 F4V73_RS10785 93.1 Morganella psychrotolerans hisS histidine--tRNA ligase
PMI_RS09100 PMI_RS09100 50.7 Proteus mirabilis HI4320 hisS histidine--tRNA ligase

Distribution of the homologs in the orthogroup group_44

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_44

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q87S15 3.06e-157 453 53 2 412 3 hisS Histidine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1QTK7 4.01e-156 451 56 2 397 3 hisS Histidine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q7MNF0 7.4e-156 449 52 2 413 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain YJ016)
Q8DEZ9 7.4e-156 449 52 2 413 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain CMCP6)
B6J7Q5 1.45e-155 449 54 1 385 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
C3LT13 1.66e-155 449 52 2 413 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTX0 1.66e-155 449 52 2 413 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3G1 1.66e-155 449 52 2 413 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6IZN1 1.71e-155 449 54 1 388 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
Q83C80 1.95e-155 448 54 1 388 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV9 1.95e-155 448 54 1 388 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU6 1.95e-155 448 54 1 388 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
A7FFZ0 8.55e-155 447 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JS06 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A0 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMT6 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CK90 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R801 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCT6 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pestis
B2K9P9 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5I9 2.81e-154 446 51 2 415 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
A7MZE2 1.37e-153 444 51 2 414 3 hisS Histidine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
B7VJT9 1.6e-153 444 51 2 414 3 hisS Histidine--tRNA ligase Vibrio atlanticus (strain LGP32)
Q2NS41 7.98e-153 442 51 1 414 3 hisS Histidine--tRNA ligase Sodalis glossinidius (strain morsitans)
A9KXK7 2.87e-152 441 50 1 418 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS195)
A6WQP6 3.77e-152 440 50 1 418 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS185)
A3D6V8 3.77e-152 440 50 1 418 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9S8 3.77e-152 440 50 1 418 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS223)
C6DBH3 1.64e-151 439 50 3 417 3 hisS Histidine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8FT71 1.99e-151 438 50 2 416 3 hisS Histidine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
B8CKR2 3.22e-151 438 50 2 416 3 hisS Histidine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
B5FAX3 7.76e-151 437 53 1 384 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E771 7.76e-151 437 53 1 384 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6D277 1.27e-150 436 50 1 415 3 hisS Histidine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q12PT3 3.82e-150 435 50 3 426 3 hisS Histidine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1RHQ4 4.56e-150 435 50 1 418 3 hisS Histidine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y8T9 4.56e-150 435 50 1 418 3 hisS Histidine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B4T0P8 7.12e-150 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella newport (strain SL254)
B5R581 7.12e-150 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FR62 7.12e-150 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella dublin (strain CT_02021853)
P62373 1.09e-149 434 50 2 411 3 hisS Histidine--tRNA ligase Photobacterium profundum (strain SS9)
O52765 1.1e-149 434 50 3 416 1 hisS Histidine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYN1 1.1e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
A9N202 1.1e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BAY6 1.3e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNI1 1.3e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z4P4 1.35e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella typhi
A8H246 1.38e-149 434 50 2 416 3 hisS Histidine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B4TR94 1.58e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B5F197 1.58e-149 434 50 3 416 3 hisS Histidine--tRNA ligase Salmonella agona (strain SL483)
B4TD92 1.98e-149 433 50 3 416 3 hisS Histidine--tRNA ligase Salmonella heidelberg (strain SL476)
C4LC38 2.64e-149 433 51 0 386 3 hisS Histidine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1R8L9 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LNG9 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
P60906 2.94e-149 433 50 1 414 1 hisS Histidine--tRNA ligase Escherichia coli (strain K12)
B1IWE7 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60907 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEX1 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE52 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O1:K1 / APEC
A8A320 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O9:H4 (strain HS)
B1XAY9 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / DH10B)
C4ZX89 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7L8 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O8 (strain IAI1)
B7MYE9 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O81 (strain ED1a)
B7NRG4 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0Y3 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60908 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7
B7MHZ9 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPV7 2.94e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
B2VE90 3.01e-149 433 52 0 388 3 hisS Histidine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7LCQ4 3.17e-149 433 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain 55989 / EAEC)
B5RCZ1 4.8e-149 432 50 3 416 3 hisS Histidine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MHL6 4.8e-149 432 50 3 416 3 hisS Histidine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7N6A2 5.59e-149 432 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7UGW0 6.73e-149 432 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B0TLI5 6.95e-149 432 50 2 416 3 hisS Histidine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
B8GTN4 1.32e-148 431 54 2 377 3 hisS Histidine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q3YZ38 1.4e-148 431 50 1 414 3 hisS Histidine--tRNA ligase Shigella sonnei (strain Ss046)
Q57LI7 1.49e-148 431 50 3 416 3 hisS Histidine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
B6I586 2.43e-148 431 50 1 414 3 hisS Histidine--tRNA ligase Escherichia coli (strain SE11)
A8GHW4 4.68e-148 430 50 1 414 3 hisS Histidine--tRNA ligase Serratia proteamaculans (strain 568)
Q32D48 5.76e-148 429 50 1 414 3 hisS Histidine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
B2TXT9 7.01e-148 429 50 1 414 3 hisS Histidine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8EC33 3.37e-147 428 52 0 380 3 hisS Histidine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q83K44 4.01e-147 427 50 1 414 3 hisS Histidine--tRNA ligase Shigella flexneri
Q31XX6 4.47e-147 427 50 1 414 3 hisS Histidine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
Q603B8 1.76e-146 426 52 1 388 3 hisS Histidine--tRNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A1JKS3 3.04e-146 425 49 2 415 3 hisS Histidine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1KKJ3 3.58e-146 425 49 1 422 3 hisS Histidine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A5UGH2 4.5e-146 425 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittGG)
Q3ICZ6 4.52e-146 425 51 0 388 3 hisS Histidine--tRNA ligase Pseudoalteromonas translucida (strain TAC 125)
B3GY63 4.55e-146 425 51 1 376 3 hisS Histidine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P43823 8.02e-146 424 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A3QCG3 8.29e-146 424 48 2 422 3 hisS Histidine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
C5BET0 1.46e-145 424 49 1 415 3 hisS Histidine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
A1S862 1.8e-145 423 48 2 425 3 hisS Histidine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q15R57 2.05e-145 423 51 0 390 3 hisS Histidine--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P57988 2.46e-145 423 52 1 377 3 hisS Histidine--tRNA ligase Pasteurella multocida (strain Pm70)
Q4QNH3 6.02e-145 422 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
A5UAB7 1.04e-144 421 51 1 377 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittEE)
A4WD92 1.21e-144 421 49 1 414 3 hisS Histidine--tRNA ligase Enterobacter sp. (strain 638)
B5XNL6 2.38e-144 421 50 1 414 3 hisS Histidine--tRNA ligase Klebsiella pneumoniae (strain 342)
Q47BR7 7.43e-144 419 49 6 425 3 hisS Histidine--tRNA ligase Dechloromonas aromatica (strain RCB)
A0KJ45 7.9e-144 419 48 2 413 3 hisS Histidine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SP01 8.25e-144 419 48 2 413 3 hisS Histidine--tRNA ligase Aeromonas salmonicida (strain A449)
B7LKC4 2.96e-143 418 49 2 419 3 hisS Histidine--tRNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B4EZT2 1.14e-142 416 49 5 420 3 hisS Histidine--tRNA ligase Proteus mirabilis (strain HI4320)
A6VQX5 1.84e-142 416 49 1 383 3 hisS Histidine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A0KUJ6 3.28e-142 415 52 0 380 3 hisS Histidine--tRNA ligase Shewanella sp. (strain ANA-3)
Q0HKV8 4.96e-142 414 52 0 380 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-4)
Q085U5 7.02e-142 414 49 1 409 3 hisS Histidine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
A1WXZ0 7.33e-142 414 52 3 390 3 hisS Histidine--tRNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q1H0V0 8.69e-142 414 51 4 400 3 hisS Histidine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q7N705 8.74e-142 414 48 3 417 3 hisS Histidine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7VME1 9.51e-142 414 50 1 374 3 hisS Histidine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0HX56 1.44e-141 413 52 0 380 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-7)
B4RV88 4.89e-141 412 50 2 414 3 hisS Histidine--tRNA ligase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q9HXJ5 6.87e-141 412 50 3 391 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RV6 6.87e-141 412 50 3 391 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UWI9 7.18e-141 412 50 3 391 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
Q5WWH1 7.31e-141 412 47 1 419 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Lens)
Q65R83 8.16e-141 412 47 3 411 3 hisS Histidine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q31I05 8.61e-141 411 50 3 391 3 hisS Histidine--tRNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5X519 4.13e-140 410 47 1 419 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Paris)
Q5ZV96 5.08e-140 409 47 1 419 3 hisS Histidine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B0USG9 7.68e-140 409 47 2 421 3 hisS Histidine--tRNA ligase Histophilus somni (strain 2336)
Q0I2E8 7.77e-140 409 47 2 421 3 hisS Histidine--tRNA ligase Histophilus somni (strain 129Pt)
Q3K7B7 1.26e-139 409 50 2 390 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q0VNE1 3.01e-138 405 50 1 388 3 hisS Histidine--tRNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C1DD44 6.52e-138 404 48 4 413 3 hisS Histidine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
A6VV07 2.9e-137 402 49 2 414 3 hisS Histidine--tRNA ligase Marinomonas sp. (strain MWYL1)
Q9JUZ9 3.78e-137 402 47 6 426 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q47WC1 5.58e-137 402 52 2 389 3 hisS Histidine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7NS89 7.39e-137 401 46 5 415 3 hisS Histidine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A9M402 1.94e-136 400 47 6 426 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C (strain 053442)
Q9JZX9 3.37e-136 400 47 6 422 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KT95 4.53e-136 400 46 6 426 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A6V0W1 4.93e-136 399 50 2 390 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
C1DE56 7.14e-136 399 50 2 394 3 hisS Histidine--tRNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q5F9G8 7.39e-136 399 47 7 426 3 hisS Histidine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5P7B4 1.06e-135 399 47 6 426 3 hisS Histidine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C3K1L3 3.99e-135 397 49 2 390 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain SBW25)
A1K3Z0 8.94e-135 396 48 7 419 3 hisS Histidine--tRNA ligase Azoarcus sp. (strain BH72)
Q8K9P3 1.08e-134 396 48 0 377 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q4K6V0 1.73e-134 395 49 2 390 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1W578 2.13e-134 395 47 5 396 3 hisS Histidine--tRNA ligase Acidovorax sp. (strain JS42)
A4XY31 2.18e-134 395 51 2 394 3 hisS Histidine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q3SL69 2.72e-134 395 49 6 423 3 hisS Histidine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
B9MFX7 3.71e-134 395 47 5 396 3 hisS Histidine--tRNA ligase Acidovorax ebreus (strain TPSY)
A3M212 3.96e-134 395 50 5 400 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I3E6 4.18e-134 394 50 5 400 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ACICU)
A4VNX0 5.67e-134 394 52 2 394 3 hisS Histidine--tRNA ligase Stutzerimonas stutzeri (strain A1501)
Q4ZX22 7.69e-134 394 49 2 390 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q48LZ3 9.56e-134 394 49 2 390 3 hisS Histidine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5QYB0 2.53e-133 392 48 2 383 3 hisS Histidine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q886Y9 3.85e-133 392 48 2 390 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0A986 3.93e-133 392 49 3 404 3 hisS Histidine--tRNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B1JDV7 1.23e-132 391 48 2 390 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain W619)
Q0AE43 2.26e-132 390 47 4 419 3 hisS Histidine--tRNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q88PJ6 8.74e-132 389 48 2 390 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KPI8 8.74e-132 389 48 2 390 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain GB-1)
A5VYT6 8.74e-132 389 48 2 390 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B7I5G8 2.25e-131 387 50 5 400 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB0057)
Q46ZI4 3.64e-131 388 49 5 397 3 hisS Histidine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8Y029 5.15e-131 387 45 7 433 3 hisS Histidine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B0VKR7 5.44e-131 387 50 5 395 1 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain SDF)
B0V5G6 7.45e-131 386 50 5 400 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AYE)
B7H068 7.45e-131 386 50 5 400 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
Q82XU9 3.8e-130 384 48 5 398 3 hisS Histidine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6FEM2 4.34e-130 384 50 5 395 3 hisS Histidine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B2SXS9 1.33e-129 384 44 8 438 3 hisS Histidine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B3R1K1 1.76e-129 384 45 7 440 3 hisS Histidine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9AGZ7 3.47e-129 382 44 7 437 3 hisS Histidine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
Q492E1 1.25e-128 381 44 3 418 3 hisS Histidine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
Q0K963 3.7e-128 380 48 5 397 3 hisS Histidine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1IEI0 4.97e-128 379 47 3 390 3 hisS Histidine--tRNA ligase Pseudomonas entomophila (strain L48)
Q2KY92 7.04e-128 379 50 5 391 3 hisS Histidine--tRNA ligase Bordetella avium (strain 197N)
A4JEN9 8.1e-128 379 44 7 438 3 hisS Histidine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q13X29 1.02e-127 379 44 8 438 3 hisS Histidine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
A3NA53 1.31e-127 379 47 6 396 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 668)
B2JIV0 1.59e-127 378 46 6 401 3 hisS Histidine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q2SWE3 2.45e-127 378 46 6 396 1 hisS Histidine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63UT2 4.87e-127 377 47 6 396 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain K96243)
A3NVX0 4.87e-127 377 47 6 396 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
P59482 5.43e-127 376 43 1 413 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57375 8.39e-127 376 43 1 385 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q0BEW8 1.21e-126 376 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YR43 1.21e-126 376 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
A1AWV6 1.25e-126 375 48 4 388 3 hisS Histidine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
Q3JRQ5 2.13e-126 375 46 6 396 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A1V4K0 2.13e-126 375 46 6 396 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62JW5 2.13e-126 375 46 6 396 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2S2A3 2.13e-126 375 46 6 396 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3MK74 2.13e-126 375 46 6 396 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
Q1BGX3 3.96e-126 375 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain AU 1054)
A0K7T5 3.96e-126 375 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
B1JT91 4.18e-126 375 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain MC0-3)
B4EAW8 4.18e-126 375 43 7 438 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39FR0 5.03e-126 375 44 7 437 3 hisS Histidine--tRNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7W6P7 6.14e-126 374 50 5 393 3 hisS Histidine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN1 6.14e-126 374 50 5 393 3 hisS Histidine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A5CWE8 6.27e-126 374 47 2 385 3 hisS Histidine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q7VRR8 1.48e-125 373 43 4 419 3 hisS Histidine--tRNA ligase Blochmanniella floridana
A5WGQ0 4.24e-125 372 49 7 408 3 hisS Histidine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
Q7VWL1 5.22e-125 371 49 5 393 3 hisS Histidine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0BK72 1.12e-124 370 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
A0Q8F1 2.39e-124 369 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. novicida (strain U112)
A7NEI6 3.17e-124 369 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SEW9 9e-124 368 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1H0 1.11e-123 368 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain LVS)
A4IW12 2.39e-123 367 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIL5 2.39e-123 367 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K18 2.39e-123 367 48 2 390 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
B0TWR5 1.26e-122 365 48 2 390 3 hisS Histidine--tRNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1QD17 8.15e-121 361 46 6 426 3 hisS Histidine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q55653 2.82e-120 360 47 5 410 3 hisS Histidine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1WVZ0 9.37e-119 355 46 4 390 3 hisS Histidine--tRNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B7K2B6 9.49e-119 355 45 7 419 3 hisS Histidine--tRNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
B2IN41 1.63e-118 355 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
C1CU26 3.17e-118 354 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Taiwan19F-14)
Q4FTW6 3.95e-118 354 44 5 436 3 hisS Histidine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8DN46 4.78e-118 353 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZPP6 4.78e-118 353 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04I50 4.78e-118 353 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CAV1 5.75e-118 353 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain 70585)
Q97NC9 6.07e-118 353 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CH52 1.23e-117 352 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain JJA)
Q31KX6 1.31e-117 353 46 6 416 3 hisS Histidine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8DHP7 1.61e-117 352 47 5 402 3 hisS Histidine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B5E3C8 2.49e-117 352 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
B1I9T7 5.56e-117 351 43 4 419 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
B0CDA0 8.39e-117 350 45 6 418 3 hisS Histidine--tRNA ligase Acaryochloris marina (strain MBIC 11017)
C1CNA0 9.36e-117 350 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain P1031)
B8HMM0 2.77e-116 349 47 4 388 3 hisS Histidine--tRNA ligase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A4VT07 3.03e-116 349 45 3 387 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZ92 3.03e-116 349 45 3 387 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 98HAH33)
Q02WI8 3.19e-116 349 45 3 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
B1XJ88 7.53e-116 348 44 6 418 3 hisS Histidine--tRNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A2RN96 1.02e-115 348 45 3 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
Q9CE78 1.18e-115 347 45 3 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
A3CR40 2.04e-115 347 45 3 387 3 hisS Histidine--tRNA ligase Streptococcus sanguinis (strain SK36)
Q5N0Z5 6.14e-115 346 45 6 416 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A8AZV0 1.5e-114 345 44 3 388 3 hisS Histidine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B0JRF1 7.39e-113 340 43 6 419 3 hisS Histidine--tRNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A5GQA2 2.04e-112 338 43 5 420 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain RCC307)
Q48QS7 7.77e-112 338 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
B7KFP0 6.34e-111 335 47 4 381 3 hisS Histidine--tRNA ligase Gloeothece citriformis (strain PCC 7424)
Q8NZ19 9.4e-111 335 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99XK9 9.4e-111 335 43 3 388 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M1
P0DG41 1.23e-110 335 43 3 388 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG40 1.23e-110 335 43 3 388 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B5XJ83 3.17e-110 333 43 3 388 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
A2RGY1 4.38e-110 333 43 3 388 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q5X9E5 4.68e-110 333 43 3 388 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q7U9Q6 1.38e-109 332 44 4 397 3 hisS Histidine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
Q8CWW2 4.3e-109 331 43 4 404 3 hisS Histidine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q2JRX6 7.15e-109 330 42 5 422 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain JA-3-3Ab)
Q3JYL6 7.83e-109 330 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P67486 9.72e-109 330 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67485 9.72e-109 330 44 4 405 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
Q7VCG1 4.22e-108 328 44 4 386 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
C4XT36 4.86e-108 328 42 5 415 3 hisS Histidine--tRNA ligase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q46LS5 3.43e-107 326 43 4 390 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL2A)
A2C182 3.68e-107 325 44 4 390 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL1A)
A3DF35 1.53e-106 324 40 4 411 3 hisS Histidine--tRNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A2CCR1 2e-106 324 43 3 397 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
Q3B0D3 7e-106 322 43 4 395 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9902)
Q1WTV0 2e-105 321 41 5 404 3 hisS Histidine--tRNA ligase Ligilactobacillus salivarius (strain UCC118)
Q833I1 2.53e-105 321 40 5 419 3 hisS Histidine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q7V4P3 2.54e-105 321 43 3 397 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
B5YHK1 3.13e-105 320 43 6 398 3 hisS Histidine--tRNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q24US1 3.86e-105 320 50 3 311 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain Y51)
B8FQR7 3.86e-105 320 50 3 311 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q3A5R6 4.11e-105 320 41 5 420 3 hisS Histidine--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B3EB83 6.98e-105 320 41 4 386 3 hisS Histidine--tRNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A4J2J1 8.3e-105 319 43 3 383 3 hisS Histidine--tRNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A5GIA4 1.13e-104 320 44 3 395 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain WH7803)
A9B9Z7 1.29e-104 319 42 7 413 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
B2GBY6 1.84e-104 319 41 7 421 3 hisS Histidine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8CS98 2.68e-104 318 40 5 420 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS1 2.68e-104 318 40 5 420 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1XDD9 3.68e-104 318 45 5 382 3 hisS Histidine--tRNA ligase, chloroplastic Neopyropia yezoensis
C5D510 4.14e-104 318 43 5 391 3 hisS Histidine--tRNA ligase Geobacillus sp. (strain WCH70)
Q0IDK4 4.29e-104 318 42 3 413 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9311)
A2BQA4 4.45e-104 318 43 5 411 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain AS9601)
P51348 1.33e-103 317 43 5 382 3 hisS Histidine--tRNA ligase, chloroplastic Porphyra purpurea
A4IR95 2.71e-103 316 43 4 388 3 hisS Histidine--tRNA ligase Geobacillus thermodenitrificans (strain NG80-2)
Q92BJ3 7.51e-103 315 39 5 421 3 hisS Histidine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8JBF6 8.6e-103 314 42 4 413 3 hisS Histidine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A4XHB0 8.81e-103 314 40 4 420 3 hisS Histidine--tRNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B7GFR0 1.47e-102 314 41 5 411 3 hisS Histidine--tRNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q31BR1 1.72e-102 314 42 5 411 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
Q5KWS8 2.14e-102 313 42 4 388 3 hisS Histidine--tRNA ligase Geobacillus kaustophilus (strain HTA426)
B9E707 2.16e-102 313 42 5 383 3 hisS Histidine--tRNA ligase Macrococcus caseolyticus (strain JCSC5402)
Q6B910 2.46e-102 313 41 4 394 3 hisS Histidine--tRNA ligase, chloroplastic Gracilaria tenuistipitata var. liui
B4UEL3 4.17e-102 312 42 4 413 3 hisS Histidine--tRNA ligase Anaeromyxobacter sp. (strain K)
Q49Y69 7.75e-102 312 40 5 416 3 hisS Histidine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9DW81 7.94e-102 312 43 3 387 3 hisS Histidine--tRNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q2RWE3 8.33e-102 311 41 5 411 3 hisS Histidine--tRNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A3PBZ7 9.12e-102 312 43 4 394 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
Q8RAI8 1.02e-101 311 41 5 418 3 hisS Histidine--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8Y708 1.24e-101 311 38 5 421 3 hisS Histidine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A7HN13 1.84e-101 311 43 8 387 3 hisS Histidine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B4SCE2 1.98e-101 311 41 7 418 3 hisS Histidine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A1ANS7 2.99e-101 310 41 4 387 3 hisS Histidine--tRNA ligase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q5M281 3.84e-101 310 41 4 419 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXM9 3.84e-101 310 41 4 419 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain CNRZ 1066)
B5YDT1 3.95e-101 310 43 6 384 3 hisS Histidine--tRNA ligase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q03IB2 4.52e-101 310 41 4 419 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A7GT85 1.35e-100 309 39 6 425 3 hisS Histidine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q71ZF0 1.79e-100 308 38 5 421 3 hisS Histidine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
A4SE02 1.92e-100 308 40 7 418 3 hisS Histidine--tRNA ligase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B0K977 2.88e-100 308 39 5 418 3 hisS Histidine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
P60913 7.09e-100 306 42 4 386 3 hisS Histidine--tRNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q4UM71 8.27e-100 306 46 1 314 3 hisS Histidine--tRNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8MGM7 1.16e-99 306 40 4 384 3 hisS Histidine--tRNA ligase Alkaliphilus oremlandii (strain OhILAs)
Q6AQS3 1.16e-99 306 43 6 389 3 hisS Histidine--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P60912 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MW2)
P60911 1.22e-99 306 42 7 421 1 hisS Histidine--tRNA ligase Staphylococcus aureus
A8Z2F8 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T8 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q6GG72 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MRSA252)
P60910 1.22e-99 306 42 7 421 1 hisS Histidine--tRNA ligase Staphylococcus aureus (strain N315)
P60909 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHH3 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Newman)
Q5HFD2 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YT99 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITF5 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH9)
Q2FXU4 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG96 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300)
A6U299 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH1)
A7X345 1.22e-99 306 42 7 421 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B8E1C1 1.51e-99 306 48 4 326 3 hisS Histidine--tRNA ligase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q5WHP4 1.58e-99 306 40 8 427 3 hisS1 Histidine--tRNA ligase 1 Shouchella clausii (strain KSM-K16)
C6BVJ9 2.06e-99 305 39 9 416 3 hisS Histidine--tRNA ligase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q30RH3 2.16e-99 305 39 5 411 3 hisS Histidine--tRNA ligase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A2BVT6 2.25e-99 306 41 4 391 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
P60915 2.39e-99 305 41 4 387 3 hisS Histidine--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q038S0 2.6e-99 305 40 7 419 3 hisS Histidine--tRNA ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEM3 2.6e-99 305 40 7 419 3 hisS Histidine--tRNA ligase Lacticaseibacillus casei (strain BL23)
Q7V263 3.95e-99 305 41 4 394 3 hisS Histidine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B1L097 4.05e-99 305 41 6 397 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
C1FKE6 4.76e-99 305 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Kyoto / Type A2)
A5D3E2 5.27e-99 305 40 6 420 3 hisS Histidine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8EPR9 6.42e-99 305 41 4 390 3 hisS Histidine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B1IMD8 6.81e-99 304 41 6 397 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
Q65GR3 7.14e-99 304 43 7 390 3 hisS Histidine--tRNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A8EZE6 7.5e-99 304 46 1 315 3 hisS Histidine--tRNA ligase Rickettsia canadensis (strain McKiel)
B8CXE6 7.61e-99 304 43 6 386 3 hisS Histidine--tRNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A6Q371 7.87e-99 303 42 6 387 3 hisS Histidine--tRNA ligase Nitratiruptor sp. (strain SB155-2)
C3KTB7 8.18e-99 304 41 5 388 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain 657 / Type Ba4)
A7Z751 8.4e-99 304 42 7 407 3 hisS Histidine--tRNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P62379 8.51e-99 304 42 7 421 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A7GHS3 1.05e-98 303 41 6 397 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C0MB21 1.06e-98 304 41 4 421 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. equi (strain 4047)
A5I6D6 1.3e-98 303 41 6 397 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY04 1.3e-98 303 41 6 397 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
Q88VQ7 1.6e-98 303 39 6 412 3 hisS Histidine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B0K0N4 2.37e-98 303 39 5 418 3 hisS Histidine--tRNA ligase Thermoanaerobacter sp. (strain X514)
B1HV72 2.38e-98 303 41 7 413 3 hisS Histidine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
Q5FUR8 2.6e-98 303 40 2 388 3 hisS Histidine--tRNA ligase Gluconobacter oxydans (strain 621H)
A1V9B1 3.58e-98 302 42 7 421 3 hisS Histidine--tRNA ligase Nitratidesulfovibrio vulgaris (strain DP4)
B9MPF7 4.18e-98 302 40 3 388 3 hisS Histidine--tRNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B0TF88 5.32e-98 302 39 6 424 3 hisS Histidine--tRNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q3AQK2 5.32e-98 302 40 7 418 3 hisS Histidine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
B9DNF9 1.06e-97 301 40 5 423 3 hisS Histidine--tRNA ligase Staphylococcus carnosus (strain TM300)
Q8RGJ5 1.08e-97 301 37 5 417 3 hisS Histidine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q4L6X6 1.08e-97 301 41 7 420 3 hisS Histidine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
C4L534 1.09e-97 301 39 6 403 3 hisS Histidine--tRNA ligase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B3QS95 1.27e-97 301 39 6 391 3 hisS Histidine--tRNA ligase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A6Q9Z9 1.55e-97 300 40 5 407 3 hisS Histidine--tRNA ligase Sulfurovum sp. (strain NBC37-1)
B3ELN3 1.99e-97 301 43 5 355 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain BS1)
C0MGD4 3.09e-97 300 40 4 421 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain H70)
B3QQI7 6.74e-97 300 39 7 418 3 hisS Histidine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q38XB7 6.97e-97 300 40 8 407 3 hisS Histidine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
A8GMY5 7.34e-97 299 45 1 314 3 hisS Histidine--tRNA ligase Rickettsia akari (strain Hartford)
B4U0K6 7.74e-97 299 40 4 421 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q03F51 8.11e-97 299 41 8 398 3 hisS Histidine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q6ME90 8.11e-97 299 43 7 406 3 hisS Histidine--tRNA ligase Protochlamydia amoebophila (strain UWE25)
Q3AA16 1.19e-96 298 40 6 415 3 hisS Histidine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3B1Z1 1.26e-96 299 40 6 411 3 hisS Histidine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
P30053 1.74e-96 298 40 4 421 1 hisS Histidine--tRNA ligase Streptococcus dysgalactiae subsp. equisimilis
Q8KFT6 3.79e-96 298 39 7 418 3 hisS Histidine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q6HDC2 4.34e-96 297 37 5 424 3 hisS2 Histidine--tRNA ligase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E2 4.34e-96 297 37 5 424 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ZK / E33L)
Q81LI6 4.34e-96 297 37 5 424 3 hisS-2 Histidine--tRNA ligase 2 Bacillus anthracis
A1BDE6 4.42e-96 297 40 9 427 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A9F907 8.94e-96 296 40 7 426 3 hisS Histidine--tRNA ligase Sorangium cellulosum (strain So ce56)
A0PZW9 1.16e-95 296 40 4 383 3 hisS Histidine--tRNA ligase Clostridium novyi (strain NT)
O32039 1.32e-95 296 42 7 390 3 hisS Histidine--tRNA ligase Bacillus subtilis (strain 168)
Q817X7 1.33e-95 296 37 5 424 3 hisS-2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A5N1Y9 1.44e-95 296 39 9 421 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5P3 1.44e-95 296 39 9 421 3 hisS Histidine--tRNA ligase Clostridium kluyveri (strain NBRC 12016)
Q04AV4 1.52e-95 296 42 4 390 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAG8 1.84e-95 296 42 4 390 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q92IK8 2.03e-95 295 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P62370 2.14e-95 295 37 5 424 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q183H5 2.77e-95 295 40 5 385 3 hisS Histidine--tRNA ligase Clostridioides difficile (strain 630)
Q8D1Y2 2.84e-95 295 42 1 317 3 hisS Histidine--tRNA ligase Wigglesworthia glossinidia brevipalpis
Q1ISE2 5.53e-95 295 39 8 427 3 hisS Histidine--tRNA ligase Koribacter versatilis (strain Ellin345)
O66522 6.87e-95 293 41 7 389 3 hisS Histidine--tRNA ligase Aquifex aeolicus (strain VF5)
Q39UD2 7.03e-95 294 39 5 415 3 hisS Histidine--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
C3PN13 8.43e-95 293 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia africae (strain ESF-5)
A9HJ49 1.18e-94 293 43 1 346 3 hisS Histidine--tRNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q1RJ50 1.41e-94 293 40 6 393 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain RML369-C)
A8GVU9 1.41e-94 293 40 6 393 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain OSU 85-389)
B2A2F9 1.54e-94 293 40 7 388 3 hisS Histidine--tRNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B1I363 1.81e-94 293 40 4 402 3 hisS Histidine--tRNA ligase Desulforudis audaxviator (strain MP104C)
Q043X4 3.43e-94 292 41 6 394 3 hisS Histidine--tRNA ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B0BWZ9 4.59e-94 291 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia rickettsii (strain Iowa)
Q68X64 5.6e-94 291 45 0 314 3 hisS Histidine--tRNA ligase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B3EFA6 7.19e-94 291 43 5 355 3 hisS Histidine--tRNA ligase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q9ZDL9 7.81e-94 291 45 0 314 3 hisS Histidine--tRNA ligase Rickettsia prowazekii (strain Madrid E)
A8YUZ9 1.04e-93 291 41 4 390 3 hisS Histidine--tRNA ligase Lactobacillus helveticus (strain DPC 4571)
Q9KDG2 2.01e-93 290 40 4 390 3 hisS Histidine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C0QFI0 2.66e-93 290 42 4 349 3 hisS Histidine--tRNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q2GBN6 2.7e-93 290 40 4 392 3 hisS Histidine--tRNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B4S4H1 3.99e-93 290 40 7 412 3 hisS Histidine--tRNA ligase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q03SE4 4.03e-93 290 38 6 415 3 hisS Histidine--tRNA ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
C4K1W2 4.29e-93 289 44 1 314 3 hisS Histidine--tRNA ligase Rickettsia peacockii (strain Rustic)
Q2RHW0 7.69e-93 289 39 4 401 3 hisS Histidine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A7ZDK1 2.81e-92 287 40 5 374 3 hisS Histidine--tRNA ligase Campylobacter concisus (strain 13826)
P60916 3.05e-92 287 41 4 390 3 hisS Histidine--tRNA ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B8FKS7 4.04e-92 287 43 3 331 3 hisS Histidine--tRNA ligase Desulfatibacillum aliphaticivorans
A0RPD3 4.19e-92 286 43 3 327 3 hisS Histidine--tRNA ligase Campylobacter fetus subsp. fetus (strain 82-40)
B3CLR6 1.2e-91 285 46 1 311 3 hisS Histidine--tRNA ligase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q5FKI5 1.44e-91 286 39 4 390 3 hisS Histidine--tRNA ligase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B7IHK5 1.92e-91 285 41 6 386 3 hisS Histidine--tRNA ligase Thermosipho africanus (strain TCF52B)
Q317R4 2.21e-91 285 38 6 419 3 hisS Histidine--tRNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5FX98 3.38e-91 284 44 0 315 3 hisS Histidine--tRNA ligase Acidiphilium cryptum (strain JF-5)
Q0AYS2 4.64e-91 284 39 3 381 3 hisS Histidine--tRNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P60917 1.26e-90 283 39 8 423 3 hisS Histidine--tRNA ligase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P46696 2.65e-90 282 38 6 416 3 hisS Histidine--tRNA ligase Mycobacterium leprae (strain TN)
A6LL06 3.26e-90 282 41 4 348 3 hisS Histidine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A8ZUR6 7.88e-90 281 45 2 313 3 hisS Histidine--tRNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
P62351 1.17e-89 280 43 3 347 3 hisS Histidine--tRNA ligase Wolbachia pipientis wMel
B1L829 1.26e-89 280 39 5 415 3 hisS Histidine--tRNA ligase Thermotoga sp. (strain RQ2)
A5IN85 1.26e-89 280 41 4 384 3 hisS Histidine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A7I1U5 1.63e-89 280 42 2 315 3 hisS Histidine--tRNA ligase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A1T898 3.11e-89 280 39 6 405 3 hisS Histidine--tRNA ligase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A8F593 4.38e-89 280 39 5 378 3 hisS Histidine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q9X0H5 6.29e-89 279 39 5 415 3 hisS Histidine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q028M4 6.54e-89 278 39 6 414 3 hisS Histidine--tRNA ligase Solibacter usitatus (strain Ellin6076)
A0PPE8 1.28e-88 278 38 6 422 3 hisS Histidine--tRNA ligase Mycobacterium ulcerans (strain Agy99)
B9KG88 1.83e-88 277 39 5 387 3 hisS Histidine--tRNA ligase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B2HN79 2.13e-88 277 37 6 422 3 hisS Histidine--tRNA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q5HAI0 2.43e-88 277 46 2 313 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Welgevonden)
Q3ZWB6 2.51e-88 277 39 3 386 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
A5FSR7 2.51e-88 277 39 3 386 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
P9WFV5 2.67e-88 277 38 6 415 1 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFV4 2.67e-88 277 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5T0 2.67e-88 277 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AF49 2.67e-88 277 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLS8 2.67e-88 277 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67484 2.67e-88 277 38 6 415 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5FG57 6.56e-88 276 46 2 313 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Gardel)
C0R4G6 1e-87 275 43 3 347 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A5CEP8 1.16e-87 275 40 5 385 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Boryong)
Q4JVE8 1.28e-87 276 43 3 318 3 hisS Histidine--tRNA ligase Corynebacterium jeikeium (strain K411)
C0ZZ58 1.6e-87 275 39 7 412 3 hisS Histidine--tRNA ligase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B3CTK8 1.92e-87 275 40 6 385 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Ikeda)
Q5HV27 8.03e-87 273 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni (strain RM1221)
Q9PPF4 8.03e-87 273 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P56194 1.73e-86 272 37 5 419 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62374 1.73e-86 272 37 5 419 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q827T0 2.56e-86 272 38 9 406 3 hisS Histidine--tRNA ligase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B1VDK9 2.67e-86 272 40 5 353 3 hisS Histidine--tRNA ligase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q1AWC4 2.88e-86 272 40 6 378 3 hisS Histidine--tRNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q3YRB1 3.39e-86 271 46 1 313 3 hisS Histidine--tRNA ligase Ehrlichia canis (strain Jake)
Q3ZAI8 3.6e-86 271 42 2 331 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q0TP27 4.91e-86 271 40 6 388 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SRP7 5.71e-86 271 40 6 388 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
B9KHM7 5.74e-86 271 47 2 312 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain Florida)
Q2GLK4 6.82e-86 271 44 1 312 3 hisS Histidine--tRNA ligase Anaplasma phagocytophilum (strain HZ)
Q8XJ27 7.97e-86 270 40 6 388 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q9KXP2 1.03e-85 271 38 8 403 3 hisS Histidine--tRNA ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P60914 1.14e-85 270 44 3 318 3 hisS Histidine--tRNA ligase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A4FBB7 1.8e-85 270 37 6 418 3 hisS Histidine--tRNA ligase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q8NQ07 4.17e-85 269 43 5 324 3 hisS Histidine--tRNA ligase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A9NGF8 6.97e-85 268 40 6 385 3 hisS Histidine--tRNA ligase Acholeplasma laidlawii (strain PG-8A)
Q0S1B6 7.52e-85 268 37 6 410 3 hisS Histidine--tRNA ligase Rhodococcus jostii (strain RHA1)
C4LIW5 9.43e-85 268 38 6 390 3 hisS Histidine--tRNA ligase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
Q5PBP9 1e-84 268 46 2 312 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain St. Maries)
Q5GSM4 1.13e-84 268 42 4 347 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q67LN9 6.06e-84 266 38 8 425 3 hisS Histidine--tRNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C1B4E1 7.19e-84 266 38 7 410 3 hisS Histidine--tRNA ligase Rhodococcus opacus (strain B4)
B1H0I8 2.81e-83 264 41 5 358 3 hisS Histidine--tRNA ligase Endomicrobium trichonymphae
B1W3H3 3.85e-83 264 37 8 405 3 hisS Histidine--tRNA ligase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A1VZB3 2.01e-82 261 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H477 2.99e-82 261 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FLH8 4.36e-82 261 39 5 376 3 hisS Histidine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5YTH9 4.57e-82 261 38 5 395 3 hisS Histidine--tRNA ligase Nocardia farcinica (strain IFM 10152)
Q2GCZ0 1.24e-81 259 41 1 321 3 hisS Histidine--tRNA ligase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q2GHH1 1.66e-81 259 44 3 316 3 hisS Histidine--tRNA ligase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q5L735 2.55e-81 259 45 3 302 3 hisS Histidine--tRNA ligase Chlamydia abortus (strain DSM 27085 / S26/3)
Q2N5U7 2.86e-81 260 41 2 328 3 hisS Histidine--tRNA ligase Erythrobacter litoralis (strain HTCC2594)
Q8FPL5 4.29e-81 259 37 10 427 3 hisS Histidine--tRNA ligase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q824R3 4.6e-81 259 44 3 302 3 hisS Histidine--tRNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q2NIN2 6.93e-81 258 40 6 351 3 hisS Histidine--tRNA ligase Aster yellows witches'-broom phytoplasma (strain AYWB)
Q9PQK6 7.93e-81 258 38 8 415 3 hisS Histidine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_10245
Feature type CDS
Gene hisS
Product histidine--tRNA ligase
Location 82805 - 84076 (strand: -1)
Length 1272 (nucleotides) / 423 (amino acids)
In genomic island -

Contig

Accession ZDB_219
Length 213167 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_44
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF13393 Histidyl-tRNA synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0124 Translation, ribosomal structure and biogenesis (J) J Histidyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01892 histidyl-tRNA synthetase [EC:6.1.1.21] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MEKIQSIRGMRSVLPEETPVWQWLENRIRNITSRYGYQEVRLPILEPVALFERAVGESTDIVSKEMYNFLDKSGEHITLRPEGTSGCVRTVIENNMCYNTTQRLWYQGPMFRYERPQKGRLRQFTQFGVETFGMPGADVDAELIFMVKDIFKALGVDKHVRLEINSLGTPEERSEHRQQLVNYFMQHKALLDEDSLRRLETNPLRILDSKNPDMQEMIEAAPRLLDFLGEESQQHFDDLRRLLDSENIAYVVNPRLVRGLDYYTRTVFEWITEELGSQGTVCGGGRYDGLVELFSGKQLPASGFAIGIERLLLLIQTLGLDKDIVNQPDIVVTYEDPAQNVEALLLANTLRHQLPQYKILNDFTSAKLKRQHSNALKSGCRYIVTLNRDGQVGLWDLAANTNETLTADTLANAFLNKTITAMA

Flanking regions ( +/- flanking 50bp)

TGATGACAGCCGGAATTTCTCACAGAGAAACTGTATATAGAGGACTAAAAATGGAAAAGATTCAGTCAATCAGAGGGATGAGAAGTGTGCTTCCGGAAGAAACACCGGTCTGGCAGTGGCTGGAAAACCGGATCCGGAATATCACTTCCCGCTACGGCTATCAGGAGGTCAGGCTGCCGATTCTGGAACCGGTTGCCCTGTTTGAGCGCGCGGTCGGTGAATCCACCGATATCGTCTCAAAAGAGATGTATAACTTCCTCGATAAAAGCGGCGAGCACATCACCCTGCGTCCGGAAGGTACCAGTGGTTGCGTCCGGACCGTGATTGAGAACAACATGTGCTACAACACCACGCAGCGCCTGTGGTATCAGGGCCCGATGTTCCGTTATGAGCGTCCGCAGAAAGGCCGTCTGCGTCAGTTCACTCAGTTCGGGGTGGAAACCTTCGGCATGCCGGGGGCGGATGTGGATGCAGAGCTTATCTTTATGGTGAAAGATATCTTTAAGGCGCTCGGCGTGGATAAACACGTCCGCCTGGAGATTAACTCCCTCGGGACACCGGAAGAGCGCTCAGAGCACCGTCAGCAGCTGGTGAATTACTTTATGCAGCACAAAGCGCTGCTGGATGAGGACAGCCTGCGCCGTCTGGAAACCAACCCGCTGCGTATCCTGGACAGCAAAAACCCGGATATGCAGGAGATGATTGAAGCAGCACCGCGCCTGCTGGACTTCCTCGGTGAGGAATCACAGCAGCACTTTGATGATCTGCGCCGTCTGCTGGACAGTGAAAATATTGCTTATGTGGTCAACCCGCGTCTGGTCCGCGGACTGGATTACTACACCCGTACCGTATTTGAGTGGATCACGGAAGAGCTGGGTTCACAGGGGACAGTCTGCGGCGGTGGCCGTTACGATGGTCTGGTTGAATTGTTCAGCGGCAAACAGTTACCGGCTTCCGGGTTTGCTATCGGGATCGAACGGCTGTTACTGCTGATCCAGACTCTCGGCCTGGATAAAGATATTGTGAATCAGCCGGATATTGTGGTGACTTATGAAGATCCGGCACAGAATGTGGAAGCGCTGTTACTGGCTAACACACTGCGCCATCAGTTGCCGCAATATAAAATCCTCAATGATTTCACCAGTGCCAAACTGAAGCGTCAGCACAGCAATGCGCTGAAATCCGGCTGCCGTTACATCGTGACGCTCAACCGTGACGGCCAGGTCGGCCTGTGGGATCTGGCGGCGAACACCAATGAAACCCTCACCGCAGACACCCTCGCCAATGCGTTTCTGAATAAAACCATCACTGCGATGGCCTGATAAACAGCAACGTAATATAAACAAAAGCACTGTTTTTACAGTGCTTTTTT