Homologs in group_1888

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_08170 EHELCC_08170 100.0 Morganella morganii S2 nuoM NADH-quinone oxidoreductase subunit M
NLDBIP_08495 NLDBIP_08495 100.0 Morganella morganii S4 nuoM NADH-quinone oxidoreductase subunit M
LHKJJB_05770 LHKJJB_05770 100.0 Morganella morganii S3 nuoM NADH-quinone oxidoreductase subunit M
HKOGLL_05145 HKOGLL_05145 100.0 Morganella morganii S5 nuoM NADH-quinone oxidoreductase subunit M
F4V73_RS02825 F4V73_RS02825 95.1 Morganella psychrotolerans nuoM NADH-quinone oxidoreductase subunit M
PMI_RS08590 PMI_RS08590 71.3 Proteus mirabilis HI4320 nuoM NADH-quinone oxidoreductase subunit M

Distribution of the homologs in the orthogroup group_1888

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1888

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFE8 0.0 796 78 1 507 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 0.0 796 78 1 507 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q9I0J0 0.0 688 69 2 505 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57263 2.66e-169 490 46 1 501 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X6 4.28e-167 484 48 0 490 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AT5 6.89e-142 421 42 2 508 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P29925 1.03e-99 312 36 8 511 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
P93313 1.54e-99 311 37 5 492 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
P26848 8.1e-98 307 35 5 472 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
P50974 9.17e-97 305 37 10 487 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
Q92G96 3.62e-94 297 36 9 469 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P27572 4.27e-94 297 36 5 492 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
Q3AGZ9 9.78e-93 295 37 11 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
A5GQH5 2e-92 295 38 10 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
Q7U413 6.4e-92 293 37 11 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q8YZV7 1.2e-91 292 37 10 510 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9ZCG0 3.25e-91 290 34 10 499 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q3M9C7 7.81e-91 290 37 11 511 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5N060 1.27e-90 290 36 11 515 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 1.27e-90 290 36 11 515 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q37617 1.97e-90 289 38 4 410 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q46HM4 3.77e-90 288 35 12 531 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
Q1RKE5 3.96e-90 287 35 9 469 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
A2BZX6 1.33e-89 287 37 11 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
Q68VV6 3.59e-89 285 34 10 498 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UK26 5.35e-89 284 35 8 461 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3MCB9 1.27e-88 284 36 12 495 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DKY0 1.69e-88 284 36 13 493 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5N5W1 2.82e-87 281 38 10 504 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 2.82e-87 281 38 10 504 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A8G2F5 5.43e-87 280 36 11 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
A2BNU4 7.39e-87 280 35 12 516 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
Q8YQ78 7.69e-87 280 36 12 495 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3B063 1.48e-86 279 38 11 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
B0C4B4 4.02e-86 278 35 11 491 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
Q118H6 4.18e-86 278 34 10 512 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
Q7V4E4 4.26e-86 278 36 11 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
A3PAL7 6.89e-86 277 35 12 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
A2CD41 8.49e-86 278 36 11 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q31D31 9.63e-86 277 35 11 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
Q85BG0 1.09e-85 276 35 10 504 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
Q6YXQ3 1.12e-85 276 35 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Physcomitrium patens
B0JPG4 2.09e-85 276 36 10 491 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8M9U1 8.86e-85 273 34 7 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
A2BUC6 1.71e-84 274 36 11 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
P32421 2.44e-84 273 35 13 516 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7V3C8 2.93e-84 273 35 11 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q04050 3.16e-84 272 35 5 492 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Brassica campestris
B1XHP2 8.67e-84 272 35 9 506 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q1ACE9 1.15e-83 270 37 7 440 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
A5GP41 2.01e-83 271 35 11 529 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
Q2JTD6 2.72e-83 270 35 12 500 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
A9BD08 4.38e-83 271 36 10 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
A7Y3L2 5.44e-83 269 34 10 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
Q19V61 7.13e-83 269 35 9 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
B0JS85 9.83e-83 270 35 13 536 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q7VE41 1.51e-82 269 36 10 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q0I6X0 2.49e-82 269 36 10 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
Q8WHX8 2.79e-82 267 34 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Psilotum nudum
Q8S8U7 8.35e-82 266 33 11 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Atropa belladonna
Q8DHX4 1.49e-81 266 36 12 491 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8KX53 1.7e-81 265 34 11 515 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q09FR0 2.27e-81 265 33 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nandina domestica
B1XJL9 3.62e-81 265 35 11 516 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A8SEF4 7.88e-81 263 33 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ceratophyllum demersum
Q09MC6 1.06e-80 263 34 11 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Citrus sinensis
A1XGU1 1.08e-80 263 31 9 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ranunculus macranthus
Q2A7B8 1.37e-80 262 33 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum lycopersicum
P48915 2.1e-80 261 35 5 492 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
P06262 2.94e-80 261 33 9 496 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tabacum
Q3C1Q4 2.94e-80 261 33 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana sylvestris
Q33BX2 5.4e-80 261 33 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tomentosiformis
Q2JK43 7.21e-80 261 35 13 487 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q1KXG6 7.42e-80 260 33 10 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lactuca sativa
Q32RL9 7.53e-80 261 34 11 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
Q2VED0 7.75e-80 260 33 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum tuberosum
Q1KXQ3 8.17e-80 260 33 10 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Helianthus annuus
Q9TKV8 9.79e-80 260 35 11 489 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
Q2PMN2 1.08e-79 260 32 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
Q0G9R2 1.51e-79 259 33 13 501 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
Q09WW8 1.61e-79 259 33 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
B2LMP8 2.19e-79 259 32 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Guizotia abyssinica
O47497 4.32e-79 258 35 7 462 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
A2T383 5.34e-79 258 34 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
Q2JWW3 5.7e-79 259 39 11 446 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
A4GGE6 9.41e-79 258 32 9 503 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
Q5SCZ6 1.39e-78 257 34 14 512 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Huperzia lucidula
A4QJQ0 1.45e-78 257 33 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema grandiflorum
Q2JPJ1 1.9e-78 258 37 12 480 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q85FH5 3.5e-78 256 33 9 507 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q09FZ6 3.78e-78 256 33 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Platanus occidentalis
A6MMZ5 4.62e-78 256 33 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Illicium oligandrum
B0Z5H7 8.65e-78 255 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera parviflora
P72823 1.11e-77 256 36 8 453 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1VKI4 1.22e-77 254 33 9 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cryptomeria japonica
A9L9E7 1.52e-77 254 31 9 511 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
P58419 1.63e-77 254 32 9 511 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera elata subsp. hookeri
F1SVH9 2.22e-77 254 34 8 488 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B0Z4S5 2.28e-77 254 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera argillicola
B0Z593 2.45e-77 254 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera glazioviana
B0Z509 2.45e-77 254 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera biennis
A4QJG6 3.86e-77 253 32 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema cordifolium
Q68RV6 4.25e-77 253 32 10 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Panax ginseng
Q32S08 7.71e-77 253 35 8 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
Q8YM86 1.31e-76 254 34 13 540 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MAR0 2.07e-76 253 34 13 540 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q06GU6 2.84e-76 251 32 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Drimys granadensis
Q49KU8 4.08e-76 251 32 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Eucalyptus globulus subsp. globulus
Q7NP39 5.74e-76 251 34 10 519 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B1NWJ9 9.48e-76 250 33 13 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Manihot esculenta
Q06R80 1.02e-75 249 33 9 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Jasminum nudiflorum
P06263 1.13e-75 249 35 10 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
Q14FA8 1.2e-75 249 32 11 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus alba
Q0H8X6 1.42e-75 249 30 11 507 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
Q9BBP3 1.73e-75 249 34 8 460 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
Q70XV2 1.83e-75 249 33 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Amborella trichopoda
Q10ZG8 2.62e-75 250 35 11 482 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
Q9MUM8 3.95e-75 248 34 10 493 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
Q6EW00 4.65e-75 248 33 9 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nymphaea alba
Q9M3J0 5.8e-75 248 33 8 507 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Spinacia oleracea
P58420 1.67e-74 246 33 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Triticum aestivum
A6MMH7 2.23e-74 246 32 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chloranthus spicatus
A4GYW6 2.96e-74 246 32 11 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus trichocarpa
P9WIW5 3.44e-74 247 33 13 536 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 3.44e-74 247 33 13 536 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A9LYF0 4.77e-74 245 31 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
B1A984 5.36e-74 245 32 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Carica papaya
O03060 5.65e-74 245 33 10 506 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Hordeum vulgare
Q7YJT3 6.53e-74 245 31 9 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
Q0G9G9 9.39e-74 244 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Liriodendron tulipifera
Q3V4Y4 1.45e-73 244 31 9 507 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
Q06FQ4 2.67e-73 243 33 10 500 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Pelargonium hortorum
A1E9X4 3.37e-73 243 33 10 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Sorghum bicolor
Q0ZIW8 6.3e-73 242 33 11 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Vitis vinifera
Q6L3E0 6.5e-73 242 33 9 496 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Saccharum hybrid
A8Y9D7 7.05e-73 242 32 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lolium perenne
Q4VZL8 7.38e-73 242 32 9 509 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cucumis sativus
A1EA59 8.74e-73 242 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Agrostis stolonifera
Q6ENP7 1.15e-72 242 33 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Saccharum officinarum
Q2L955 1.87e-72 241 33 10 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium hirsutum
A0ZZ85 1.87e-72 241 33 10 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium barbadense
P0CY44 2e-72 242 33 6 461 3 ndh-4 NADH-ubiquinone oxidoreductase chain 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P03913 4.62e-72 240 35 10 464 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Aspergillus amstelodami
A6MM87 5.46e-72 240 32 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Buxus microphylla
P26288 6.24e-72 240 33 10 470 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabidopsis thaliana
A4QLP7 2.57e-71 238 34 8 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lobularia maritima
A0A385 4.49e-71 238 32 9 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Coffea arabica
A1XG05 6.64e-71 237 33 7 448 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nuphar advena
A4QLF9 9.11e-71 237 34 8 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lepidium virginicum
A4QKP5 1.15e-70 236 33 8 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Capsella bursa-pastoris
A4QK70 1.58e-70 236 34 8 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabis hirsuta
A6H5P2 1.73e-70 236 32 10 501 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cycas taitungensis
P0C325 2.16e-70 236 32 10 506 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa subsp. japonica
P0C324 2.16e-70 236 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa subsp. indica
P0C323 2.16e-70 236 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa
Q6ENA7 2.16e-70 236 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza nivara
A4QL71 3.3e-70 235 32 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Draba nemorosa
A4QLY5 6.02e-70 234 34 8 455 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nasturtium officinale
A4QKF7 6.54e-70 234 34 8 455 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Barbarea verna
A4QJY2 7.12e-70 234 33 8 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Olimarabidopsis pumila
P11647 2.11e-69 233 33 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zea mays
A4QKY4 1.42e-68 231 33 8 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Crucihimalaya wallichii
A6MMR3 7.05e-68 229 31 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Dioscorea elephantipes
Q37375 1.89e-67 228 34 3 380 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Acanthamoeba castellanii
Q36834 1.98e-66 225 33 8 462 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Trichophyton rubrum
P15582 4.61e-58 204 32 7 461 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
O21047 2.23e-53 191 32 8 375 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
A9RAH8 4.29e-51 184 29 10 429 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9B8C8 4.18e-50 181 29 7 426 3 NAD4 NADH-ubiquinone oxidoreductase chain 4 Candida albicans (strain SC5314 / ATCC MYA-2876)
O79436 1.94e-48 176 33 5 356 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oryctolagus cuniculus
Q2LCP7 2.08e-48 175 32 5 320 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium citrinum
Q9B6D6 2.63e-48 176 32 7 405 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q56228 2.65e-48 176 32 6 413 1 nqo13 NADH-quinone oxidoreductase subunit 13 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P03910 6.57e-48 175 33 5 369 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos taurus
Q576B5 7.43e-48 175 33 5 369 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos indicus
P48655 9.4e-48 174 33 6 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Equus caballus
P41298 1.64e-47 174 32 7 406 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera musculus
Q9ZZY2 1.83e-47 174 34 4 319 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Hippopotamus amphibius
O79677 2.93e-47 173 31 12 432 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pelomedusa subrufa
Q5Y4Q1 2.96e-47 173 33 5 369 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos mutus grunniens
P24975 3.64e-47 173 31 8 408 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera physalus
P20113 7.72e-47 172 30 7 403 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chlamydomonas reinhardtii
Q00506 8.59e-47 172 34 4 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Phoca vitulina
P92484 1.87e-46 171 32 6 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Equus asinus
P38601 2.22e-46 171 34 4 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Halichoerus grypus
O78755 4.59e-46 170 32 5 369 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ovis aries
O79881 6.3e-46 169 32 5 368 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Sus scrofa
Q598S9 9.29e-46 169 33 5 356 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Caperea marginata
P24998 1.78e-45 168 32 12 435 3 NAD4 NADH-ubiquinone oxidoreductase chain 4 Pisaster ochraceus
P05508 2.5e-45 168 30 7 406 3 Mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Rattus norvegicus
Q96068 2.66e-45 168 34 6 323 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Rhinoceros unicornis
P48916 4.47e-45 167 32 6 380 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Felis catus
Q95917 5.31e-45 167 29 7 413 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Polypterus ornatipinnis
O21334 6.38e-45 167 30 6 406 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dasypus novemcinctus
Q9T9W6 6.58e-45 167 34 6 369 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pan paniscus
Q591Y7 6.58e-45 167 34 7 323 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus sambiranensis
P03908 7.36e-45 167 29 8 406 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pongo pygmaeus
O03204 9.89e-45 166 34 6 322 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ceratotherium simum
Q34878 1.68e-44 166 31 7 373 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lemur catta
P41308 1.85e-44 166 31 6 358 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Didelphis virginiana
Q591M5 2.55e-44 165 33 6 325 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus simmonsi
Q3L6Y5 4.79e-44 164 32 4 319 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Canis lupus
P92698 6.23e-44 164 31 7 377 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pongo abelii
P03905 6.3e-44 164 34 5 322 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Homo sapiens
A8DQI9 1.08e-43 163 31 7 359 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Avahi unicolor
Q38PR3 2.65e-43 162 34 5 329 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Mammuthus primigenius
P03907 3.65e-43 162 34 8 325 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gorilla gorilla gorilla
Q2I3F2 3.83e-43 162 32 7 380 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Loxodonta africana
P03906 3.91e-43 162 33 7 378 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pan troglodytes
A8DQK9 4.24e-43 162 32 5 320 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Avahi cleesei
Q2I3G5 5.69e-43 161 32 7 380 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Elephas maximus
P11992 6.23e-43 161 32 11 430 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Patiria pectinifera
Q8W9M7 6.97e-43 161 31 6 363 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dugong dugon
Q9ZZ58 8.8e-43 161 32 4 319 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Canis lupus familiaris
P03909 1.21e-42 160 33 5 343 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Hylobates lar
Q34048 4.99e-42 159 32 11 399 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ceratitis capitata
O79410 5.89e-42 159 31 8 411 3 MTND4 NADH-ubiquinone oxidoreductase chain 4 Scyliorhinus canicula
Q9MIY1 9.66e-42 158 32 13 429 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Danio rerio
P07707 1.28e-41 157 34 10 377 3 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Drosophila yakuba
Q85DA7 1.65e-41 157 31 8 370 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lepilemur septentrionalis
Q35542 7.99e-41 155 29 4 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Petromyzon marinus
O03173 1.05e-40 155 31 7 390 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Latimeria chalumnae
Q8W9G4 1.12e-40 155 31 6 386 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tachyglossus aculeatus aculeatus
Q36458 1.41e-40 155 31 5 329 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ornithorhynchus anatinus
Q4JQH8 2.22e-40 154 31 6 385 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tetraodon nigroviridis
O78687 2.43e-40 154 33 12 415 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Carassius auratus
P34194 3.56e-40 154 31 12 435 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Formosania lacustris
P18931 3.92e-40 153 35 9 321 1 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Drosophila melanogaster
P48917 8.76e-40 154 29 6 392 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Wickerhamomyces canadensis
Q9ZZ45 1.53e-39 152 31 11 416 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Squalus acanthias
P92668 1.78e-39 152 30 8 410 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Osphranter robustus
O79421 1.82e-39 152 32 10 372 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Branchiostoma lanceolatum
O79555 2.63e-39 151 30 6 355 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lycodon semicarinatus
O21406 3.91e-39 151 30 10 410 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Struthio camelus
Q34949 4.49e-39 150 29 8 407 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Lumbricus terrestris
P03911 4.85e-39 150 28 7 417 1 Mtnd4 NADH-ubiquinone oxidoreductase chain 4 Mus musculus
Q5ZNA1 5.1e-39 150 30 6 383 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Zaglossus bruijni
O47423 6.12e-39 150 32 10 372 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Branchiostoma floridae
P55781 1.11e-38 150 30 9 384 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gadus morhua
P18939 1.18e-38 149 30 11 411 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gallus gallus
P11631 5.89e-38 147 31 9 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oncorhynchus mykiss
O99825 1.02e-37 146 31 13 397 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Rhipicephalus sanguineus
P12775 1.41e-37 147 32 10 388 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Paracentrotus lividus
P34941 2.48e-37 146 34 13 356 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Arbacia lixula
Q36424 1.17e-36 144 31 11 349 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Locusta migratoria
Q9ZZM4 1.74e-36 144 33 9 349 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Salmo salar
P03912 7.08e-35 139 30 11 415 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Xenopus laevis
B1I6I5 1.34e-34 139 28 14 438 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q9G2W9 2.32e-34 137 30 7 363 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Myxine glutinosa
Q1HR20 7.62e-34 136 32 11 399 2 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Aedes aegypti
P03914 7.76e-34 130 35 2 207 3 nd4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Emericella nidulans
P34852 1.06e-33 135 35 10 348 3 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Anopheles gambiae
P15551 3.02e-33 134 31 9 378 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Strongylocentrotus purpuratus
Q8CPU8 2.23e-32 135 27 18 538 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 2.23e-32 135 27 18 538 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P33511 6.32e-32 130 34 11 346 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Anopheles quadrimaculatus
Q37711 5.85e-30 124 27 4 332 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Artemia franciscana
Q4L4W7 7.35e-30 127 26 18 538 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q00231 5.41e-29 122 34 0 184 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Mytilus edulis
P34853 1.32e-28 121 28 6 341 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Apis mellifera ligustica
P48914 1.7e-28 120 28 6 343 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Albinaria caerulea
A9QPJ1 1.96e-28 121 31 3 255 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q52978 2.13e-28 123 28 14 464 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
Q9RGZ2 3.37e-28 120 25 12 496 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q0Q2K0 3.55e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 3.55e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 3.55e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 3.55e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 3.55e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 3.55e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q6GJ47 3.71e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q8NXT2 3.92e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 3.92e-27 119 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q9K2S2 6.64e-27 118 28 14 417 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q99VZ2 6.82e-27 118 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 6.82e-27 118 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 6.82e-27 118 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 6.82e-27 118 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 6.82e-27 118 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YST2 1.24e-26 117 27 23 505 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
O05229 1.7e-26 115 27 7 349 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
P60675 7.97e-26 115 27 13 447 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 7.97e-26 115 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 7.97e-26 115 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 7.97e-26 115 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 7.97e-26 115 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YWT4 1.38e-25 114 27 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXF6 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
Q9ZNG6 2.68e-25 113 27 13 447 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
A8Z059 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 2.68e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q6GID6 2.73e-25 113 27 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q9RGZ5 6.29e-25 112 26 18 515 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q5HRB2 6.48e-25 112 26 21 477 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 6.84e-25 112 26 21 477 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O03704 1.12e-24 105 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus lepidus
P23482 1.41e-24 111 28 8 350 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
P92681 2.05e-24 104 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Ovophis okinavensis
Q49W91 2.52e-24 110 25 15 449 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O03701 3.84e-24 103 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothriechis schlegelii
Q49VG9 4.88e-24 109 26 14 440 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P92503 5.8e-24 103 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Agkistrodon piscivorus piscivorus
P92492 6.65e-24 103 32 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Agkistrodon contortrix contortrix
P77437 9.09e-24 108 26 11 418 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
O03710 1.14e-23 102 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus concolor
O03780 1.33e-23 102 32 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus albolabris
P92623 1.37e-23 102 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Deinagkistrodon acutus
P92759 1.66e-23 102 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus stejnegeri
O03792 1.67e-23 102 32 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus cantori
O03733 2.68e-23 101 29 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Hypnale hypnale
O03778 2.7e-23 101 32 5 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Sistrurus miliarius
O03807 3.07e-23 101 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Tropidolaemus wagleri
B4U8J0 3.69e-23 105 25 5 280 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Hydrogenobaculum sp. (strain Y04AAS1)
Q4UK27 3.73e-23 106 25 13 443 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P92793 3.77e-23 101 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Protobothrops elegans
Q4L443 3.77e-23 107 25 20 446 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
O03702 4.2e-23 101 31 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus adamanteus
O03700 4.72e-23 100 31 4 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothriechis lateralis
P15581 5.47e-23 105 28 11 347 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Paramecium tetraurelia
O03763 8.08e-23 100 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrocophias hyoprora
Q6GID9 2.43e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
O03727 2.58e-22 99 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Gloydius intermedius
O03773 2.79e-22 99 32 7 240 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Porthidium ophryomegas
Q5HHD6 2.81e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
P92794 3.04e-22 98 31 4 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Protobothrops flavoviridis
P60687 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 3.05e-22 103 26 15 382 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
Q2YWT7 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IRC7 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 3.05e-22 103 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P92649 3.96e-22 98 31 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Lachesis muta muta
P92613 4e-22 98 31 5 231 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Calloselasma rhodostoma
Q4L4W4 4.56e-22 102 26 12 396 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
O03698 4.91e-22 98 29 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops bilineatus
O03703 5.73e-22 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Cerrophidion godmani
O03695 5.96e-22 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Atropoides picadoi
O03692 6.32e-22 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Metlapilcoatlus nummifer
P92494 6.38e-22 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Azemiops feae
O03699 6.44e-22 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops erythromelas
A8Z056 8.76e-22 101 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 8.76e-22 101 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
O03707 1.06e-21 97 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Causus rhombeatus
Q0Q2J7 1.21e-21 101 25 14 504 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
O03697 1.27e-21 97 32 6 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops asper
O03772 1.34e-21 97 32 7 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Porthidium nasutum
O03726 1.7e-21 96 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Gloydius blomhoffii
Q6GJ44 1.96e-21 100 24 16 517 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
Q7A725 2.68e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 2.68e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 2.68e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NXT1 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 3.07e-21 100 25 15 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
B7GME1 1.29e-20 98 26 8 358 3 nuoN NADH-quinone oxidoreductase subunit N Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A6LXP5 1.95e-20 97 27 10 392 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C1AZG0 3.56e-20 97 29 3 225 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
Q49W88 5.81e-20 96 25 12 403 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQ47 6.02e-20 96 25 14 458 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRA9 6.51e-20 96 25 14 458 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A4GGE3 8.89e-20 96 27 13 360 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
P9WIW8 1.1e-19 95 25 14 410 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WIW9 1.34e-19 95 25 14 408 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 1.34e-19 95 25 14 408 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1VKJ3 1.49e-19 95 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q9ZCG1 1.64e-19 95 23 14 464 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q31HE7 2.32e-19 94 25 12 391 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A8M609 2.76e-19 94 28 12 384 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
Q92G97 3.09e-19 94 23 15 515 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6ANN6 4.16e-19 93 26 9 293 3 nuoN NADH-quinone oxidoreductase subunit N Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q2RJT7 4.54e-19 93 27 2 256 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B1W506 6.51e-19 93 27 11 392 3 nuoN3 NADH-quinone oxidoreductase subunit N 3 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
C0QR92 6.77e-19 92 26 16 475 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
Q8CPV1 8.38e-19 92 24 12 398 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL3 8.38e-19 92 24 13 400 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5GS15 8.44e-19 92 23 9 358 3 nuoN NADH-quinone oxidoreductase subunit N Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q859V1 1.12e-18 93 26 13 420 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q32516 1.14e-18 93 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
B5YKJ2 1.14e-18 92 26 14 375 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q2VED3 1.21e-18 92 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
B3TN96 1.27e-18 92 27 12 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q31952 1.58e-18 92 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q7N2J9 1.7e-18 91 26 14 419 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2MIE0 1.94e-18 92 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q32880 1.97e-18 92 26 13 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q09FR3 2.22e-18 92 27 15 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
P50939 2.26e-18 92 24 14 447 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
A8Y9D4 2.92e-18 91 26 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
A0LRJ4 2.97e-18 91 27 15 387 3 nuoN NADH-quinone oxidoreductase subunit N Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q95H46 3.13e-18 91 27 13 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
A8LC88 3.38e-18 90 26 5 263 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
A1EA56 3.42e-18 91 26 13 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
P51099 3.95e-18 91 25 14 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
A7Y3K7 4.43e-18 91 26 16 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
Q85FH9 4.49e-18 91 26 16 429 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q8S8V0 5.63e-18 90 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q49VH2 6e-18 90 23 11 466 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q32S06 6.15e-18 90 26 16 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q9TKV7 6.56e-18 90 25 9 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
B3E9V6 6.77e-18 89 26 9 386 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B8J1C7 7.16e-18 89 26 16 436 3 nuoN NADH-quinone oxidoreductase subunit N Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q32440 7.2e-18 90 27 13 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
P24880 8.04e-18 89 32 2 185 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ascaris suum
Q32091 8.49e-18 90 25 11 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q4L446 8.68e-18 89 24 10 432 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q32551 8.88e-18 90 25 11 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
B1MAF7 9.95e-18 89 26 5 267 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q2LCP6 1.34e-17 89 23 16 485 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q31849 1.35e-17 89 25 14 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
Q3C1N9 1.35e-17 89 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
P06265 1.36e-17 89 25 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
A7NEJ7 1.4e-17 89 24 12 369 3 nuoN NADH-quinone oxidoreductase subunit N Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q33BX5 1.44e-17 89 25 15 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q64Y15 1.44e-17 89 23 9 376 3 nuoN NADH-quinone oxidoreductase subunit N Bacteroides fragilis (strain YCH46)
Q33066 1.65e-17 89 25 15 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
A0KJ55 1.66e-17 88 25 19 447 3 nuoN NADH-quinone oxidoreductase subunit N Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6YXQ6 1.9e-17 89 26 14 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q9B6D3 1.99e-17 89 25 14 416 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
P46620 2.08e-17 89 26 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
Q6ENQ0 2.14e-17 89 25 15 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q32539 2.15e-17 89 25 11 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q6L3E3 2.16e-17 89 26 17 422 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q85T01 2.32e-17 89 24 11 394 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q8HHD2 2.38e-17 89 23 15 457 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q9MUK8 2.39e-17 89 25 23 512 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q32238 2.54e-17 89 25 14 422 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
P51100 2.71e-17 88 25 13 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
B4U8I1 2.72e-17 88 29 6 217 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Hydrogenobaculum sp. (strain Y04AAS1)
Q0G9R5 2.75e-17 88 26 12 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q55429 2.8e-17 88 26 11 357 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2L960 2.91e-17 88 26 17 430 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q2QD43 3.05e-17 88 25 14 444 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
B2LMQ1 3.28e-17 88 24 14 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
A4QKP2 3.33e-17 88 25 16 466 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
Q32384 4.03e-17 88 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q32007 4.09e-17 88 25 13 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q9XAR5 4.46e-17 87 25 16 461 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q06R83 4.49e-17 88 26 14 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q1RKE6 4.5e-17 87 22 13 467 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q9TDR1 5.05e-17 87 27 14 350 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
P31971 5.08e-17 87 26 18 432 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q1ACF3 5.44e-17 87 26 21 446 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
P51098 5.68e-17 87 25 14 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
P0C328 5.94e-17 87 25 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 5.94e-17 87 25 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 5.94e-17 87 25 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 5.94e-17 87 25 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
A7HY36 6.03e-17 87 26 9 289 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q34313 6.45e-17 87 23 16 483 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
Q8W8H5 6.48e-17 87 25 14 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
A6H5N8 6.53e-17 87 26 14 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
A4QLF6 6.57e-17 87 25 15 469 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
A0ZZ82 6.92e-17 87 25 17 430 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
C5C0R4 7.47e-17 87 26 11 392 3 nuoN NADH-quinone oxidoreductase subunit N Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
P51096 8.16e-17 87 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q49KV1 8.61e-17 87 27 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q68RV9 8.68e-17 87 25 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q02CT1 9.06e-17 86 24 14 430 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
Q8W9M6 9.51e-17 86 27 15 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q32126 1e-16 87 26 17 434 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
A4QLP4 1.07e-16 87 26 17 472 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q3AC87 1.08e-16 86 26 7 264 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q5F629 1.09e-16 86 27 11 385 3 nuoN NADH-quinone oxidoreductase subunit N Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P51095 1.22e-16 86 24 14 421 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
A7NPD6 1.25e-16 85 25 16 444 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A4QJX9 1.33e-16 86 25 15 469 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
O67342 1.36e-16 85 29 2 185 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
A0LJL8 1.36e-16 85 29 8 269 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A1XG02 1.51e-16 86 25 13 361 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q32131 1.52e-16 86 26 13 360 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
A0A382 1.59e-16 86 25 14 418 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
B2TW57 1.75e-16 85 28 19 438 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P24978 1.81e-16 85 27 13 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
P51898 1.83e-16 82 36 4 151 3 ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Anopheles arabiensis
P11993 1.94e-16 85 25 13 359 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
A4QKY1 2.02e-16 85 26 16 459 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q68VV7 2.12e-16 85 24 11 409 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P20679 2.17e-16 85 24 19 463 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q8K9X7 2.18e-16 85 26 19 413 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
C5D978 2.46e-16 85 24 11 393 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
A8ADW3 2.53e-16 85 27 20 429 3 nuoN NADH-quinone oxidoreductase subunit N Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P56752 2.56e-16 85 25 14 466 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
P51097 2.62e-16 85 26 16 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q1QSU4 2.92e-16 84 25 9 388 3 nuoN NADH-quinone oxidoreductase subunit N Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_14110
Feature type CDS
Gene nuoM
Product NADH-quinone oxidoreductase subunit M
Location 16180 - 17700 (strand: -1)
Length 1521 (nucleotides) / 506 (amino acids)

Contig

Accession contig_18
Length 100673 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1888
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1008 Energy production and conversion (C) C NADH:ubiquinone oxidoreductase subunit 4 (chain M)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00342 NADH-quinone oxidoreductase subunit M [EC:7.1.1.2] Oxidative phosphorylation
Metabolic pathways
NADH:quinone oxidoreductase, prokaryotes

Protein Sequence

MLLPWLILLPFIGGLLCWQAERFGTKLPRWIALLAMGITLFLSLYLWMQGNYSLVNPKGVPDWQEQYFLEWIPRFGINIHLALDGLSLLMVVLTALLGLLAILCSWGENQPYQGFFHLNLLWILGGVMGVFLAMDLFLFFFFWEMMLVPMYFLIALWGHSGSDGKTRIGAATKFFIYTQASGLVMLIAIMALAIVHHNATGQWSFAYEDLLNTPMSYGVQYMLMLGFFIAFAVKMPVVPLHGWLPDAHSQAPTAGSVDLAGILLKTAAYGLLRFSLPLFPEASADFTPIAMWLGVVGIFYGAWMAFKQTDIKRLIAYTSVSHMGFVLIAIYSASMLAYQGAVVQMIAHGLSAAGLFILCGQLYERLGTRDMRQMGGLWKRIKFLPALSLFFAVATLGMPGTGNFVGEFMILFGSFGSYTLITVISSAGLVFASVYALWMMQQAYYGAPKSEEPIAGMNLREFSIVMLLVVLLVILGVYPQPVLDTSSAAMANIQQWYTASISNTGL

Flanking regions ( +/- flanking 50bp)

GCTGGTTCTCGCTCTGCTGTTTTTGGTTTAAATAAGGGACACATTGCGCCATGCTATTACCCTGGCTGATTTTACTTCCCTTCATCGGCGGCCTGCTGTGCTGGCAGGCTGAGCGCTTCGGCACAAAGCTGCCGCGCTGGATCGCGCTGCTGGCGATGGGGATCACGTTATTTCTTTCTCTGTATCTGTGGATGCAGGGGAACTACAGCTTAGTTAACCCGAAAGGCGTTCCGGACTGGCAGGAGCAGTATTTCCTGGAGTGGATCCCGCGTTTCGGTATCAATATTCATCTGGCTCTGGATGGTCTGTCGCTGCTGATGGTGGTGCTGACCGCGCTGCTCGGTCTGCTGGCTATCCTCTGTTCCTGGGGTGAAAACCAGCCGTATCAGGGCTTCTTCCATCTGAACCTGCTGTGGATCCTCGGCGGTGTGATGGGCGTGTTCCTGGCAATGGATCTTTTCCTGTTCTTCTTCTTCTGGGAAATGATGCTGGTGCCGATGTACTTCCTGATCGCACTGTGGGGACACAGCGGTTCCGACGGCAAAACCCGTATCGGGGCGGCGACCAAGTTCTTCATCTATACCCAGGCGAGCGGTCTGGTGATGCTGATTGCCATTATGGCACTGGCGATTGTTCATCATAACGCCACCGGCCAGTGGAGCTTCGCGTATGAAGATCTGCTGAACACGCCGATGAGTTACGGTGTGCAGTATATGCTGATGCTGGGCTTCTTTATCGCGTTTGCGGTCAAGATGCCGGTGGTTCCGCTGCACGGCTGGCTGCCGGATGCACACAGTCAGGCGCCGACAGCAGGTTCTGTCGACCTGGCGGGTATTCTGCTGAAAACCGCTGCTTATGGTCTGCTGCGTTTCAGTCTGCCGCTATTCCCGGAAGCCTCTGCGGACTTCACACCAATCGCCATGTGGCTGGGTGTCGTCGGTATCTTCTACGGCGCGTGGATGGCGTTCAAACAGACGGATATCAAGCGTCTGATCGCCTACACCAGCGTGTCGCATATGGGCTTTGTGCTGATTGCGATTTACTCGGCGAGTATGCTGGCGTATCAGGGTGCGGTGGTGCAGATGATTGCACACGGTCTGTCGGCGGCGGGTCTGTTTATTCTGTGCGGTCAGTTATATGAGCGCCTCGGCACCCGTGATATGCGTCAGATGGGCGGTCTGTGGAAGCGGATTAAATTCCTGCCGGCACTGTCACTGTTCTTTGCGGTGGCAACGCTCGGGATGCCGGGTACGGGTAACTTCGTCGGTGAATTCATGATCCTGTTCGGCAGCTTCGGCAGCTACACCCTGATCACTGTGATTTCCTCTGCGGGTCTGGTGTTTGCTTCCGTTTACGCGCTGTGGATGATGCAGCAGGCGTATTACGGTGCACCGAAGTCTGAAGAGCCAATCGCGGGCATGAATCTGCGTGAATTTTCCATCGTGATGCTGCTGGTGGTCTTACTGGTGATTCTGGGTGTTTACCCGCAGCCGGTGCTGGATACCTCGTCAGCGGCGATGGCAAACATTCAGCAGTGGTACACTGCTTCAATTTCAAATACAGGGTTGTAACGCGCCATGACAATAACTCCTCAACAACTGATCGCACTCTCACCACTGCT