Homologs in group_1926

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14110 FBDBKF_14110 71.3 Morganella morganii S1 nuoM NADH-quinone oxidoreductase subunit M
EHELCC_08170 EHELCC_08170 71.3 Morganella morganii S2 nuoM NADH-quinone oxidoreductase subunit M
NLDBIP_08495 NLDBIP_08495 71.3 Morganella morganii S4 nuoM NADH-quinone oxidoreductase subunit M
LHKJJB_05770 LHKJJB_05770 71.3 Morganella morganii S3 nuoM NADH-quinone oxidoreductase subunit M
HKOGLL_05145 HKOGLL_05145 71.3 Morganella morganii S5 nuoM NADH-quinone oxidoreductase subunit M
F4V73_RS02825 F4V73_RS02825 70.8 Morganella psychrotolerans nuoM NADH-quinone oxidoreductase subunit M

Distribution of the homologs in the orthogroup group_1926

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1926

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFE8 0.0 682 66 2 510 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 0.0 682 66 2 510 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q9I0J0 0.0 608 62 4 509 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8K9X6 3.37e-162 472 48 2 494 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57263 3.82e-158 462 44 3 508 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AT5 4.19e-135 403 42 3 507 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P29925 1.11e-92 294 36 12 497 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q3AGZ9 4.15e-88 283 37 14 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
P26848 6.27e-88 281 35 4 429 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
P93313 6.61e-88 281 35 8 498 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
A2BZX6 8.6e-88 282 35 10 519 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
Q7U413 1.27e-87 282 37 14 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q46HM4 3.19e-87 281 35 10 520 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
A7Y3L2 1.13e-85 276 35 13 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
P27572 2e-85 275 35 10 499 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
Q37617 4.27e-85 275 36 5 412 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q8M9U1 6.38e-85 274 34 11 512 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
Q6YXQ3 1.98e-84 273 36 14 500 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Physcomitrium patens
A5GQH5 4.74e-84 273 35 13 524 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
P50974 1.12e-83 271 35 10 490 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
F1SVH9 2.55e-83 270 33 9 499 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9ZCG0 6.17e-83 268 32 5 483 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q92G96 7.02e-83 268 34 6 468 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q85BG0 9.07e-83 268 35 14 513 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
Q8YQ78 2.08e-82 268 36 16 496 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3B063 2.79e-82 268 38 15 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q8YZV7 2.79e-82 268 34 14 503 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M9C7 4.29e-82 268 36 9 431 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q1RKE5 5.01e-82 266 32 7 480 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
A2CD41 1.03e-81 267 36 13 522 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q3MCB9 1.13e-81 266 36 16 496 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A1XGU1 2.24e-81 265 32 11 516 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ranunculus macranthus
P06262 2.34e-81 265 33 12 509 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tabacum
Q3C1Q4 2.34e-81 265 33 12 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana sylvestris
A8G2F5 2.72e-81 265 35 13 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
Q8DHX4 3.1e-81 265 36 15 484 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q68VV6 3.12e-81 264 33 6 481 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8S8U7 3.86e-81 264 33 12 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Atropa belladonna
Q7VE41 4.08e-81 265 36 13 520 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A2BNU4 5.3e-81 265 35 14 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
A3PAL7 5.58e-81 265 35 14 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
Q7V4E4 6.86e-81 265 36 13 522 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
Q31D31 7.13e-81 264 35 14 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
Q2A7B8 1.43e-80 262 33 12 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum lycopersicum
Q5N060 2.27e-80 263 35 16 497 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 2.27e-80 263 35 16 497 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q118H6 4.25e-80 262 34 12 494 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
Q09WW8 8.33e-80 260 33 12 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
B0JPG4 1.32e-79 261 35 15 510 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q2VED0 1.68e-79 259 32 12 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum tuberosum
Q33BX2 1.87e-79 259 32 12 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tomentosiformis
A8SEF4 2.39e-79 259 32 13 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ceratophyllum demersum
Q5N5W1 2.67e-79 260 39 12 437 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 2.67e-79 260 39 12 437 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q0G9R2 2.71e-79 259 34 16 512 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
Q4UK26 2.94e-79 259 33 6 468 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8DKY0 3.5e-79 259 34 15 495 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8KX53 1.03e-78 258 34 13 521 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q1KXG6 1.14e-78 258 33 12 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lactuca sativa
Q19V61 2.2e-78 257 35 19 533 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
Q09FR0 2.63e-78 256 32 12 522 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nandina domestica
A5GP41 2.96e-78 258 35 13 521 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A9BD08 3.02e-78 258 35 11 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
Q1KXQ3 3.28e-78 256 33 12 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Helianthus annuus
B0C4B4 4.17e-78 257 33 14 522 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
A9L9E7 4.42e-78 256 32 13 522 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
B2LMP8 9.9e-78 255 32 13 523 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Guizotia abyssinica
Q2PMN2 1.91e-77 254 33 13 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
P32421 2.17e-77 255 36 9 423 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2JTD6 2.23e-77 255 35 15 494 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
A4GGE6 3.19e-77 254 33 13 509 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
Q7V3C8 4.4e-77 254 34 14 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q06GU6 8.28e-77 253 32 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Drimys granadensis
Q1ACE9 1.2e-76 252 36 10 430 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
B1VKI4 1.26e-76 252 33 12 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cryptomeria japonica
Q06FQ4 1.7e-76 252 33 11 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Pelargonium hortorum
A4QJG6 2.71e-76 251 33 11 520 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema cordifolium
Q9TKV8 4.01e-76 251 35 17 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
Q85FH5 4.69e-76 251 34 14 511 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
A2T383 4.89e-76 251 33 11 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
A2BUC6 5.74e-76 252 34 12 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
Q32S08 1.1e-75 250 35 17 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
B1NWJ9 1.26e-75 249 31 11 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Manihot esculenta
B1XHP2 1.31e-75 250 36 11 435 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P48915 1.38e-75 249 35 6 492 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
B0Z5H7 1.59e-75 249 33 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera parviflora
A4QJQ0 1.67e-75 249 32 9 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema grandiflorum
Q04050 1.69e-75 249 35 6 428 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Brassica campestris
B0Z593 2.7e-75 249 33 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera glazioviana
B0Z509 2.7e-75 249 33 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera biennis
Q09MC6 3.08e-75 248 33 11 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Citrus sinensis
B0JS85 3.24e-75 250 33 16 519 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0I6X0 4.18e-75 250 36 14 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
B0Z4S5 4.58e-75 248 33 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera argillicola
P58419 4.81e-75 248 33 9 506 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera elata subsp. hookeri
Q7YJT3 5.13e-75 248 31 13 518 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
B1XJL9 5.32e-75 249 33 16 539 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q2JK43 5.77e-75 249 35 12 439 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
A6MMZ5 6.56e-75 248 32 12 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Illicium oligandrum
Q14FA8 7.14e-75 248 31 12 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus alba
Q68RV6 9.11e-75 247 32 13 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Panax ginseng
Q32RL9 1.03e-74 248 35 15 495 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
A9LYF0 1.33e-74 247 31 12 516 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
Q8WHX8 2.06e-74 246 34 17 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Psilotum nudum
Q3V4Y4 3.46e-74 246 31 12 516 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
Q09FZ6 3.49e-74 246 31 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Platanus occidentalis
A4GYW6 8.15e-74 245 31 12 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus trichocarpa
P06263 8.83e-74 244 35 13 501 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
Q9M3J0 1.02e-73 244 32 11 514 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Spinacia oleracea
Q06R80 1.2e-73 244 32 11 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Jasminum nudiflorum
Q2JPJ1 3.06e-73 244 36 13 469 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6EW00 4.47e-73 243 32 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nymphaea alba
Q7NP39 5.26e-73 243 33 12 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9BBP3 7.74e-73 242 32 11 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
A6MMH7 7.91e-73 242 32 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chloranthus spicatus
B1A984 9.67e-73 242 32 12 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Carica papaya
O47497 1.27e-72 241 35 8 465 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
Q49KU8 1.5e-72 241 32 11 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Eucalyptus globulus subsp. globulus
Q5SCZ6 3.02e-72 241 33 13 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Huperzia lucidula
Q4VZL8 8.98e-72 239 33 12 512 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cucumis sativus
Q0G9G9 1.43e-71 239 32 12 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Liriodendron tulipifera
Q0ZIW8 1.9e-71 239 33 11 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Vitis vinifera
Q6L3E0 2.16e-71 238 31 11 514 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Saccharum hybrid
Q70XV2 3.89e-71 238 32 12 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Amborella trichopoda
P72823 4.63e-71 239 35 15 460 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6MM87 5.42e-71 237 32 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Buxus microphylla
A1E9X4 1.12e-70 236 31 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Sorghum bicolor
Q6ENP7 1.57e-70 236 31 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Saccharum officinarum
O03060 1.86e-70 236 32 11 511 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Hordeum vulgare
A0A385 2.11e-70 236 31 12 516 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Coffea arabica
Q9MUM8 2.37e-70 236 33 15 518 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
P26288 3.72e-70 235 33 9 475 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabidopsis thaliana
A4QLP7 5.67e-70 234 33 9 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lobularia maritima
A8Y9D7 7.12e-70 234 32 11 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lolium perenne
A1EA59 1.07e-69 234 32 11 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Agrostis stolonifera
P58420 1.68e-69 233 32 11 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Triticum aestivum
Q2JWW3 3.19e-69 233 37 12 426 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
A1XG05 5.7e-69 232 32 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nuphar advena
A4QLF9 5.82e-69 232 33 9 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lepidium virginicum
Q0H8X6 8.96e-69 231 31 11 510 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
A4QKF7 1.07e-68 231 33 9 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Barbarea verna
P9WIW5 1.42e-68 233 31 9 534 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 1.42e-68 233 31 9 534 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A4QKY4 1.5e-68 231 33 9 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Crucihimalaya wallichii
A4QKP5 1.53e-68 231 33 10 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Capsella bursa-pastoris
Q8YM86 1.55e-68 233 33 8 450 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A4QLY5 1.69e-68 231 33 9 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nasturtium officinale
A4QJY2 2.57e-68 230 33 9 475 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Olimarabidopsis pumila
P0C325 2.79e-68 230 31 12 518 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa subsp. japonica
P0C324 2.79e-68 230 31 12 518 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa subsp. indica
P0C323 2.79e-68 230 31 12 518 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa
Q6ENA7 2.79e-68 230 31 12 518 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza nivara
A4QK70 3.41e-68 230 33 9 474 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabis hirsuta
Q3MAR0 5.38e-68 231 33 8 450 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q10ZG8 7.84e-68 231 33 9 449 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
Q2L955 1.43e-67 228 32 12 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium hirsutum
A0ZZ85 1.43e-67 228 32 12 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium barbadense
A4QL71 1.67e-67 228 33 9 458 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Draba nemorosa
A6H5P2 2.17e-67 228 31 11 517 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cycas taitungensis
P11647 1.05e-66 226 31 12 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zea mays
A6MMR3 2.4e-65 223 30 11 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Dioscorea elephantipes
P0CY44 7.74e-62 214 32 8 468 3 ndh-4 NADH-ubiquinone oxidoreductase chain 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q37375 8.7e-61 210 31 6 417 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Acanthamoeba castellanii
P03913 1.39e-59 207 32 11 467 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Aspergillus amstelodami
O21047 4.18e-59 207 34 8 377 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
Q36834 1.17e-55 197 30 10 463 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Trichophyton rubrum
Q2LCP7 1.33e-54 192 35 7 340 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium citrinum
P15582 8.09e-54 192 32 9 466 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q9B8C8 2.12e-50 182 31 9 418 3 NAD4 NADH-ubiquinone oxidoreductase chain 4 Candida albicans (strain SC5314 / ATCC MYA-2876)
A9RAH8 1.44e-49 179 28 7 413 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9B6D6 1.39e-48 177 32 7 409 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Yarrowia lipolytica (strain CLIB 122 / E 150)
P20113 1.01e-44 166 30 5 374 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chlamydomonas reinhardtii
Q9T9W6 1.58e-43 163 30 6 405 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pan paniscus
P48917 2.25e-43 164 31 9 400 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Wickerhamomyces canadensis
P92698 3.7e-43 162 29 7 408 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pongo abelii
P05508 5.49e-43 162 29 5 414 3 Mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Rattus norvegicus
O79677 9.77e-43 161 29 7 417 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pelomedusa subrufa
Q591Y7 1.03e-42 161 30 4 358 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus sambiranensis
P03908 1.7e-42 160 28 8 408 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pongo pygmaeus
O21334 2.91e-42 159 29 8 419 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dasypus novemcinctus
P03905 1.38e-41 158 32 6 358 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Homo sapiens
P24998 2.63e-41 157 31 10 433 3 NAD4 NADH-ubiquinone oxidoreductase chain 4 Pisaster ochraceus
Q591M5 3.06e-41 157 30 5 361 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus simmonsi
P03906 3.13e-41 157 30 7 413 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pan troglodytes
P03910 3.6e-41 157 30 6 382 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos taurus
O78755 3.75e-41 156 30 6 382 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ovis aries
Q576B5 3.75e-41 156 30 6 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos indicus
Q00506 4.72e-41 156 31 5 335 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Phoca vitulina
O79436 7.29e-41 155 32 4 321 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oryctolagus cuniculus
P38601 9.95e-41 155 31 5 335 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Halichoerus grypus
Q96068 1.22e-40 155 31 8 399 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Rhinoceros unicornis
Q5Y4Q1 1.36e-40 155 30 6 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos mutus grunniens
P24975 1.68e-40 155 29 7 415 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera physalus
Q9ZZY2 2.34e-40 154 30 7 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Hippopotamus amphibius
Q56228 2.46e-40 154 31 5 391 1 nqo13 NADH-quinone oxidoreductase subunit 13 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O03204 2.86e-40 154 30 6 380 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ceratotherium simum
O79881 2.95e-40 154 28 8 399 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Sus scrofa
P48655 3.2e-40 154 29 7 419 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Equus caballus
P41308 4.69e-40 154 30 7 365 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Didelphis virginiana
Q95917 5.02e-40 153 29 8 413 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Polypterus ornatipinnis
P41298 6.33e-40 153 30 9 414 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera musculus
Q8W9M7 7.82e-40 153 28 6 425 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dugong dugon
P03907 9.27e-40 152 30 8 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gorilla gorilla gorilla
Q598S9 5.52e-39 150 29 7 418 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Caperea marginata
A8DQK9 5.52e-39 150 31 4 321 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Avahi cleesei
Q34048 5.92e-39 150 31 13 405 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ceratitis capitata
P92484 7.68e-39 150 28 7 419 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Equus asinus
Q38PR3 8.35e-39 150 28 5 411 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Mammuthus primigenius
Q34878 1.06e-38 150 29 5 334 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lemur catta
Q9MIY1 1.31e-38 149 31 7 410 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Danio rerio
O78687 1.85e-38 149 31 8 411 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Carassius auratus
A8DQI9 1.89e-38 149 30 6 363 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Avahi unicolor
Q8W9G4 2.03e-38 149 30 7 402 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tachyglossus aculeatus aculeatus
O21406 2.32e-38 149 30 7 409 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Struthio camelus
Q2I3G5 3.11e-38 149 28 7 413 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Elephas maximus
O03173 3.28e-38 148 27 5 413 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Latimeria chalumnae
O99825 7.58e-38 147 30 10 400 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Rhipicephalus sanguineus
P03909 8.11e-38 147 29 5 368 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Hylobates lar
Q2I3F2 9.81e-38 147 27 5 416 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Loxodonta africana
Q5ZNA1 1.02e-37 147 30 7 402 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Zaglossus bruijni
O79421 1.06e-37 147 29 9 410 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Branchiostoma lanceolatum
P48916 1.38e-37 147 30 7 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Felis catus
Q3L6Y5 1.84e-37 146 29 5 337 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Canis lupus
O47423 4.96e-37 145 28 7 407 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Branchiostoma floridae
Q85DA7 5.38e-37 145 29 7 371 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lepilemur septentrionalis
P03911 6.12e-37 145 28 5 408 1 Mtnd4 NADH-ubiquinone oxidoreductase chain 4 Mus musculus
P11992 7.52e-37 145 32 9 424 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Patiria pectinifera
Q36458 1.49e-36 144 31 5 341 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ornithorhynchus anatinus
Q9ZZ58 3.25e-36 143 29 5 337 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Canis lupus familiaris
O79555 3.91e-36 142 30 8 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lycodon semicarinatus
Q34949 6.97e-36 142 31 10 365 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Lumbricus terrestris
P18939 8.92e-36 142 28 8 419 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gallus gallus
P55781 9.24e-36 142 30 9 383 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gadus morhua
O79410 1.81e-35 141 29 7 407 3 MTND4 NADH-ubiquinone oxidoreductase chain 4 Scyliorhinus canicula
P11631 2.1e-35 140 31 6 368 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oncorhynchus mykiss
Q4JQH8 2.51e-35 140 31 7 372 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tetraodon nigroviridis
P34194 5.75e-35 139 31 9 412 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Formosania lacustris
P07707 7.04e-35 139 32 8 340 3 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Drosophila yakuba
Q9ZZ45 1.05e-34 139 28 6 410 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Squalus acanthias
P92668 3.68e-34 137 29 9 414 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Osphranter robustus
P18931 4.12e-34 137 31 8 343 1 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Drosophila melanogaster
Q9ZZM4 1.12e-33 135 32 6 345 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Salmo salar
P12775 9e-33 133 31 13 393 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Paracentrotus lividus
Q9G2W9 3.69e-32 131 28 11 434 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Myxine glutinosa
Q35542 4.53e-32 131 28 6 360 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Petromyzon marinus
P03912 6.69e-31 128 28 8 412 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Xenopus laevis
P34941 6.87e-31 128 31 13 380 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Arbacia lixula
Q8CPU8 3.22e-30 128 29 16 454 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 3.22e-30 128 29 16 454 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L4W7 3.64e-30 128 29 17 474 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q36424 7.42e-30 125 29 8 350 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Locusta migratoria
A9QPJ1 2.49e-29 124 34 2 241 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q0Q2K0 2.84e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 2.84e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 2.84e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 2.84e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 2.84e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 2.84e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q8NXT2 3.17e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 3.17e-29 125 29 18 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q99VZ2 4.24e-29 125 28 16 453 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 4.24e-29 125 28 16 453 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 4.24e-29 125 28 16 453 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 4.24e-29 125 28 16 453 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 4.24e-29 125 28 16 453 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
B1I6I5 6.72e-29 122 25 14 456 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
P15551 8.25e-29 122 29 9 412 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Strongylocentrotus purpuratus
P34853 9.84e-29 121 28 8 342 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Apis mellifera ligustica
Q2YST2 1.24e-28 124 28 16 453 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q00231 7.52e-28 119 31 6 248 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Mytilus edulis
Q6GJ47 1.19e-27 120 28 19 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q9RGZ5 1.3e-27 120 27 15 454 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q1HR20 1.4e-27 118 30 9 357 2 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Aedes aegypti
P03914 2.18e-27 112 32 4 199 3 nd4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Emericella nidulans
P48914 2.55e-27 117 31 2 229 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Albinaria caerulea
Q37711 4.48e-27 115 26 8 352 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Artemia franciscana
Q4L443 6.39e-27 118 24 14 478 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q9K2S2 7.74e-27 118 27 15 445 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q5HRB2 9.78e-27 118 27 15 474 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 1.09e-26 117 27 13 424 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q49VG9 1.3e-26 117 27 12 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9RGZ2 3.61e-26 114 26 8 424 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q49W91 4.08e-26 116 28 15 451 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P34852 1.04e-25 112 31 12 398 3 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Anopheles gambiae
P33511 1.85e-25 112 30 12 398 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Anopheles quadrimaculatus
Q8NXT1 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 2.09e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q0Q2J7 2.14e-25 112 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q7A725 5.5e-25 111 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 5.5e-25 111 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 5.5e-25 111 26 16 502 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
O05229 1.19e-24 110 27 8 393 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
P15581 1.86e-24 109 28 9 339 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Paramecium tetraurelia
Q6GJ44 4.41e-24 108 25 14 499 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
O03704 4.27e-23 101 30 2 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus lepidus
Q64Y15 8.89e-23 104 27 8 357 3 nuoN NADH-quinone oxidoreductase subunit N Bacteroides fragilis (strain YCH46)
Q6GID6 1.34e-22 105 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
P60675 1.87e-22 104 28 14 447 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 1.87e-22 104 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 1.87e-22 104 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 1.87e-22 104 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 1.87e-22 104 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9B6D3 1.98e-22 104 27 16 423 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q2YWT4 3.06e-22 104 28 15 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P92681 3.44e-22 98 31 2 230 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Ovophis okinavensis
Q8NXF6 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 5e-22 103 28 14 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q9ZNG6 5.23e-22 103 28 14 447 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q52978 8.15e-22 103 27 14 431 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
A4GGE3 2.59e-21 101 28 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
O03778 2.84e-21 95 30 2 230 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Sistrurus miliarius
P92503 3.55e-21 95 29 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Agkistrodon piscivorus piscivorus
Q8CQ47 3.67e-21 100 25 17 469 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O03733 3.87e-21 95 29 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Hypnale hypnale
Q5HRA9 3.89e-21 99 25 17 469 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P92492 4.31e-21 95 29 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Agkistrodon contortrix contortrix
Q32440 5.56e-21 100 26 17 478 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
A1EA56 5.56e-21 100 27 12 419 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
O03701 5.6e-21 95 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothriechis schlegelii
Q95H46 6.02e-21 100 26 16 476 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
P92623 7.78e-21 94 29 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Deinagkistrodon acutus
B1VKJ3 8.11e-21 99 27 14 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
P92793 1.03e-20 94 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Protobothrops elegans
P92794 1.12e-20 94 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Protobothrops flavoviridis
P20679 1.24e-20 99 24 17 468 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q32551 1.52e-20 99 27 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
A7Y3K7 2.06e-20 98 27 13 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
P33607 2.38e-20 98 27 22 505 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
P51099 2.48e-20 98 27 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q6YXQ6 2.63e-20 98 28 10 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
A8Y9D4 2.66e-20 98 26 12 419 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
P77437 2.82e-20 97 29 5 267 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
B3TN96 2.93e-20 98 27 13 420 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
O03710 3.01e-20 93 29 2 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus concolor
A1XG02 3.86e-20 97 25 14 450 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q6L3E3 3.95e-20 97 27 13 392 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q6ENQ0 4.64e-20 97 27 13 392 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
O03792 4.79e-20 92 28 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus cantori
O03807 4.93e-20 92 28 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Tropidolaemus wagleri
O03780 5.08e-20 92 28 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus albolabris
P92759 5.18e-20 92 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus stejnegeri
A6LXP5 5.23e-20 96 27 10 404 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P92494 5.59e-20 92 29 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Azemiops feae
P05510 5.64e-20 97 23 15 477 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P0C328 5.88e-20 97 25 16 476 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 5.88e-20 97 25 16 476 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 5.88e-20 97 25 16 476 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 5.88e-20 97 25 16 476 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
P92649 6.1e-20 92 28 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Lachesis muta muta
O03702 6.28e-20 92 28 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus adamanteus
O03699 6.78e-20 92 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops erythromelas
Q32516 7.11e-20 96 27 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q32091 7.76e-20 96 27 12 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
O03763 7.99e-20 91 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrocophias hyoprora
Q33066 7.99e-20 96 27 13 392 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q33BX5 8.53e-20 96 26 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q68RV9 8.54e-20 96 26 9 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q32238 9.85e-20 96 27 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q4UK27 1.1e-19 95 25 11 401 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q32880 1.19e-19 95 26 12 419 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
O03703 1.2e-19 91 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Cerrophidion godmani
Q31849 1.32e-19 95 26 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
Q8S8V0 1.33e-19 95 27 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
O03700 1.34e-19 91 27 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothriechis lateralis
Q32539 1.46e-19 95 27 12 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
P23482 1.46e-19 95 25 6 299 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
P51095 1.5e-19 95 27 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
P9WIW1 1.52e-19 95 28 13 372 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 1.52e-19 95 28 13 372 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2VED3 1.53e-19 95 26 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
A6H5N8 1.53e-19 95 27 14 419 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P51100 1.57e-19 95 28 13 375 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
P46620 1.61e-19 95 27 13 392 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
Q6EW03 1.77e-19 95 24 14 467 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
O03698 1.81e-19 90 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops bilineatus
O03692 2.12e-19 90 29 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Metlapilcoatlus nummifer
P06265 2.13e-19 95 26 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q3C1N9 2.17e-19 95 26 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q9ZCG1 2.32e-19 95 25 9 401 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q2MIE0 2.37e-19 95 26 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q8W8H5 2.37e-19 95 27 14 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q09FR3 2.89e-19 95 26 11 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q32007 2.94e-19 94 27 11 332 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q2L960 2.97e-19 94 26 13 382 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
A9L9E4 3.13e-19 94 29 12 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
O03695 3.14e-19 90 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Atropoides picadoi
Q0G9R5 3.19e-19 94 24 9 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q32126 3.96e-19 94 26 12 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
O03727 4.03e-19 89 27 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Gloydius intermedius
B2LMQ1 4.35e-19 94 26 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q859V1 4.54e-19 94 28 13 355 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
B4U8J0 4.56e-19 93 28 6 268 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Hydrogenobaculum sp. (strain Y04AAS1)
Q32384 4.76e-19 94 25 11 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q8M9U5 5.31e-19 94 27 18 456 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
P51098 5.48e-19 94 26 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
P15958 5.56e-19 94 27 9 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
Q8SHP7 6.1e-19 94 25 16 421 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
O03697 6.46e-19 89 28 2 230 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops asper
O03772 7.83e-19 89 28 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Porthidium nasutum
B3QY38 7.91e-19 92 26 16 443 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q31952 7.92e-19 93 26 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
A0ZZ82 8.97e-19 93 25 13 382 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q01561 1.02e-18 93 23 20 501 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
Q49VH2 1.05e-18 92 27 14 395 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q34313 1.08e-18 93 24 17 473 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
O03707 1.13e-18 88 29 2 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Causus rhombeatus
P92613 1.24e-18 88 28 1 224 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Calloselasma rhodostoma
P51097 1.26e-18 92 27 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q0G9H2 1.32e-18 92 24 12 447 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q06R83 1.4e-18 92 26 13 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q2QD43 1.45e-18 92 27 11 375 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
P51096 1.6e-18 92 27 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q2LCP6 1.73e-18 92 24 17 473 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q9XAR5 1.78e-18 92 26 16 431 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O03726 1.89e-18 87 27 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Gloydius blomhoffii
Q1ACF3 1.91e-18 92 26 19 436 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q92G97 2.53e-18 92 24 12 448 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9I0J1 3.15e-18 91 27 14 418 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O03773 3.21e-18 87 27 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Porthidium ophryomegas
Q32RH9 3.68e-18 91 29 18 429 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q32S06 4.29e-18 91 26 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
B5LMS9 4.34e-18 91 27 8 322 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
Q4L446 5.06e-18 90 25 11 438 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q6QU67 5.72e-18 90 23 16 489 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q6GID9 6.36e-18 90 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q8HHD2 7.67e-18 90 22 17 489 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q2YWT7 7.75e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P60687 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 7.82e-18 89 25 11 401 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 7.82e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HHD6 8.04e-18 89 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
Q9B8C9 8.22e-18 90 26 12 423 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q32131 8.67e-18 90 26 11 337 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q6V9D9 8.87e-18 90 24 15 434 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
Q5SCZ9 1.32e-17 89 25 14 422 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q9MUK8 1.39e-17 89 24 22 521 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q9TLA3 1.54e-17 89 27 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q9TLC2 1.64e-17 89 28 11 339 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
Q85FH9 1.83e-17 89 28 14 362 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q7N2J9 1.89e-17 88 25 14 445 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P06264 1.89e-17 89 26 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
A8Z056 1.97e-17 88 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 1.97e-17 88 25 11 401 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q49KV1 3.07e-17 88 28 12 337 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q06FL7 3.13e-17 88 27 10 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
B0Z5H4 3.3e-17 88 26 11 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 3.3e-17 88 26 11 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 3.3e-17 88 26 11 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 3.3e-17 88 26 11 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q9MTI4 3.32e-17 88 26 11 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
F1SVK0 3.71e-17 88 23 11 414 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q49W88 3.97e-17 87 26 7 346 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A7NEJ7 6.17e-17 87 25 17 406 3 nuoN NADH-quinone oxidoreductase subunit N Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B1X491 6.31e-17 87 26 22 497 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q94RJ2 7.21e-17 87 26 13 391 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q09MC9 8.33e-17 87 26 10 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
P48919 9.69e-17 86 24 14 418 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
A4GYW4 1.03e-16 87 25 12 419 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q14FB0 1.09e-16 87 26 10 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
Q33113 1.14e-16 86 26 10 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
P29924 1.23e-16 86 26 20 479 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
P15584 1.46e-16 86 27 21 422 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q06GK2 1.47e-16 86 27 12 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q55429 1.59e-16 86 25 18 435 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1NWJ6 1.69e-16 86 25 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
A1AVS5 1.82e-16 85 26 11 349 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
A7NPD6 2.12e-16 85 25 12 397 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
O67391 2.29e-16 85 26 14 419 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Aquifex aeolicus (strain VF5)
B1A981 2.37e-16 85 27 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
B8J1C7 2.5e-16 85 24 14 434 3 nuoN NADH-quinone oxidoreductase subunit N Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q9TKV7 2.71e-16 85 26 10 342 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
A0A382 2.83e-16 85 26 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
A4QKP2 3.46e-16 85 27 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
A0KJ55 3.6e-16 84 25 15 428 3 nuoN NADH-quinone oxidoreductase subunit N Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P57262 3.93e-16 84 26 15 432 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X7 4.26e-16 84 27 17 427 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A4QKF4 4.67e-16 84 27 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
B2XWI8 4.81e-16 84 26 11 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
Q4L4W4 4.92e-16 84 24 16 488 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
B4U8I1 5.61e-16 84 31 6 219 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Hydrogenobaculum sp. (strain Y04AAS1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08590
Feature type CDS
Gene nuoM
Product NADH-quinone oxidoreductase subunit M
Location 1875169 - 1876698 (strand: -1)
Length 1530 (nucleotides) / 509 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1926
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1008 Energy production and conversion (C) C NADH:ubiquinone oxidoreductase subunit 4 (chain M)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00342 NADH-quinone oxidoreductase subunit M [EC:7.1.1.2] Oxidative phosphorylation
Metabolic pathways
NADH:quinone oxidoreductase, prokaryotes

Protein Sequence

MLLPWLILIPFIGGLLSWQAERIGSQVPRWVALLTMGLTLVISVQLWLQGDYQLISVDGAPRWTEFYFVPWIPALGINIQFALDGMSLLMVVLTAILGILAVLSSWSENQPSQGAFHFNLLWILAGVMGVFLATDLFLFFFFWEMMLIPMYFLISLWGHKGSSDEKHVSAATKFFIYTQASGLLMLLAIIGLAVAFYSKTGIWTFNYDTLLQAHTLLGSELQFILMLGFFAAFAVKMPIVPVHGWLADAHAEAPTAGSVDLSGILLKTAAYGLLRFNLPLFPEASALLAPVAMWLGLITVFYAALLAFRQTDIKRLAAYSSISHMGFIVIAIYAGSVLAYQGAIIQMITNGLSAAGLFIMCGMLYERLGTRDMNQMGGLWKSIRFLPAFSLFFAVASLGMPGTGNFVGEFMILFGTYGHFKLITIISVFGLVFASVYALWMMQQAYYGSPKTAERTYKGLNLREFLILFILVVLLVILGFFPQPVLDTSISAMENLQTWYSASLSTVRL

Flanking regions ( +/- flanking 50bp)

GCTGGTTATCGCTCTGCTGCTTCTGGTTTAATTAAGGGACACATTGCGCCATGTTATTACCCTGGCTAATACTTATTCCCTTCATCGGTGGCCTGCTAAGTTGGCAGGCTGAACGAATCGGCTCGCAAGTTCCTCGCTGGGTTGCGTTGCTGACGATGGGATTAACACTCGTTATTTCTGTGCAACTGTGGTTGCAAGGTGACTATCAACTGATTAGTGTTGATGGAGCACCTCGCTGGACAGAGTTTTACTTTGTACCGTGGATCCCTGCTTTGGGGATTAATATTCAGTTTGCACTTGATGGCATGTCATTATTGATGGTGGTATTAACTGCTATTTTAGGTATTTTAGCGGTGCTCTCTTCATGGAGCGAAAATCAACCATCACAAGGGGCTTTCCATTTCAACCTGCTGTGGATCTTAGCAGGTGTTATGGGGGTATTCTTAGCGACTGACTTGTTCTTATTCTTCTTCTTTTGGGAAATGATGTTGATCCCAATGTATTTCCTTATCTCTCTTTGGGGACATAAAGGAAGTAGTGATGAGAAACATGTTAGTGCAGCAACTAAGTTCTTTATTTATACACAGGCGAGTGGCTTGTTAATGTTGCTGGCCATTATCGGTTTAGCTGTCGCTTTTTACAGCAAAACAGGTATTTGGACGTTTAATTATGACACCTTACTACAAGCGCACACCTTATTAGGTAGTGAACTGCAATTTATTCTGATGCTTGGCTTCTTTGCTGCATTCGCAGTAAAAATGCCAATTGTCCCCGTTCATGGCTGGCTAGCTGATGCACATGCAGAAGCACCAACGGCGGGCTCTGTTGACTTATCAGGTATTTTGCTAAAAACAGCCGCTTACGGTTTATTACGTTTTAACTTACCGTTATTCCCAGAAGCGTCTGCATTACTGGCACCTGTTGCGATGTGGCTAGGCTTAATCACCGTATTCTACGCTGCACTGTTAGCATTCCGTCAAACGGATATTAAACGTCTGGCCGCTTACAGTAGTATTTCTCACATGGGCTTTATCGTGATTGCGATTTATGCTGGCTCTGTTTTGGCTTACCAAGGTGCGATTATTCAAATGATCACCAATGGTTTGTCTGCTGCCGGTCTGTTTATCATGTGTGGCATGCTGTATGAGCGTTTAGGTACGCGTGATATGAATCAAATGGGTGGATTGTGGAAAAGCATCCGTTTCTTACCAGCATTTTCACTGTTCTTTGCGGTTGCCTCTTTAGGTATGCCAGGAACAGGTAACTTTGTTGGTGAGTTTATGATCCTATTTGGTACTTATGGCCACTTTAAGCTGATCACTATTATTTCGGTCTTTGGGTTAGTTTTTGCTTCTGTCTACGCTTTGTGGATGATGCAACAGGCTTACTATGGTTCACCGAAAACAGCAGAAAGAACCTATAAAGGGTTAAATCTGAGAGAATTTTTGATCCTGTTTATCTTGGTGGTTTTATTGGTTATTTTGGGCTTCTTCCCACAACCAGTATTAGATACTTCGATATCAGCAATGGAAAATCTCCAGACTTGGTATTCCGCTTCTCTTTCAACAGTAAGGCTGTAATTCGCCATGACAATAACTCCTGAACAATTGATCGCAATGCTACCGCTGTT