Homologs in group_1926

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14110 FBDBKF_14110 95.1 Morganella morganii S1 nuoM NADH-quinone oxidoreductase subunit M
EHELCC_08170 EHELCC_08170 95.1 Morganella morganii S2 nuoM NADH-quinone oxidoreductase subunit M
NLDBIP_08495 NLDBIP_08495 95.1 Morganella morganii S4 nuoM NADH-quinone oxidoreductase subunit M
LHKJJB_05770 LHKJJB_05770 95.1 Morganella morganii S3 nuoM NADH-quinone oxidoreductase subunit M
HKOGLL_05145 HKOGLL_05145 95.1 Morganella morganii S5 nuoM NADH-quinone oxidoreductase subunit M
PMI_RS08590 PMI_RS08590 70.8 Proteus mirabilis HI4320 nuoM NADH-quinone oxidoreductase subunit M

Distribution of the homologs in the orthogroup group_1926

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1926

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFE8 0.0 800 78 1 507 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 0.0 800 78 1 507 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q9I0J0 0.0 690 69 2 505 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57263 5.48e-172 497 47 1 501 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X6 2.81e-168 488 48 0 490 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AT5 1.86e-143 424 42 3 509 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P29925 3.85e-101 316 37 7 502 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
P93313 5.93e-100 312 37 5 492 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
P26848 6.96e-100 312 36 5 472 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
P50974 1.38e-96 304 37 10 487 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
P27572 3.5e-96 303 36 4 492 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
A5GQH5 1.89e-94 300 37 10 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
Q3AGZ9 1.18e-93 297 37 11 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q7U413 1.2e-93 298 38 11 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q92G96 2.12e-92 293 36 7 469 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A2BZX6 2.24e-92 294 37 10 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
Q46HM4 9.18e-92 293 37 11 499 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
Q1RKE5 1.53e-90 288 36 9 471 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q37617 3.15e-90 288 36 6 487 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q5N060 4.24e-90 288 35 11 516 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 4.24e-90 288 35 11 516 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZCG0 9.44e-90 286 34 10 489 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q8YZV7 1.73e-89 286 38 5 435 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8G2F5 5.37e-89 285 36 11 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
Q7V4E4 6.97e-89 286 37 11 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
A2BNU4 9.55e-89 285 36 12 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
Q3M9C7 2.16e-88 284 38 5 434 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4UK26 3.62e-88 282 35 7 461 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A2CD41 3.63e-88 284 37 11 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q3B063 4.01e-88 283 38 10 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q3MCB9 4.81e-88 283 34 9 514 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A3PAL7 5.35e-88 283 36 12 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
A2BUC6 1.08e-87 282 36 11 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
Q31D31 1.25e-87 282 36 12 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
Q5N5W1 1.35e-87 281 41 7 435 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 1.35e-87 281 41 7 435 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q68VV6 2.55e-87 280 33 7 487 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q6YXQ3 3.25e-87 280 36 12 499 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Physcomitrium patens
Q7V3C8 9.7e-87 280 37 11 505 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8DKY0 1.13e-86 279 35 11 493 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q85BG0 1.15e-86 278 35 11 504 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
Q8YQ78 3.45e-86 278 34 9 514 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q118H6 6.9e-86 277 35 11 513 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
Q8M9U1 9.97e-86 276 34 8 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
A5GP41 1.27e-85 277 35 10 515 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A9BD08 1.57e-85 277 36 10 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
B1XHP2 6.07e-85 275 36 13 511 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B0JPG4 9.78e-85 274 35 10 491 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B0C4B4 1.21e-84 274 34 8 490 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
Q7VE41 1.4e-84 275 36 10 514 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q04050 2.02e-84 272 34 5 495 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Brassica campestris
Q0I6X0 3.5e-83 271 36 11 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
Q1ACE9 4.58e-83 269 35 10 502 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
A7Y3L2 6.18e-83 268 33 7 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
Q2JTD6 1.6e-82 268 34 11 502 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
P32421 2.04e-82 268 33 11 516 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DHX4 2.14e-82 268 36 12 489 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8WHX8 3.53e-82 266 34 9 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Psilotum nudum
Q8S8U7 6.13e-82 266 33 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Atropa belladonna
B0JS85 6.36e-82 267 33 11 540 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q19V61 6.38e-82 266 35 11 523 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
Q09FR0 8.35e-82 266 33 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nandina domestica
B1XJL9 2.78e-81 266 34 11 516 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A1XGU1 3.02e-81 264 32 8 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ranunculus macranthus
Q32RL9 3.39e-81 264 35 11 519 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
A8SEF4 4.99e-81 263 33 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ceratophyllum demersum
Q8KX53 7.05e-81 264 34 12 521 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q1KXG6 1.62e-80 262 33 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lactuca sativa
Q09MC6 3.29e-80 261 33 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Citrus sinensis
Q2A7B8 3.76e-80 261 33 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum lycopersicum
Q1KXQ3 4.65e-80 261 33 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Helianthus annuus
Q9TKV8 5.17e-80 261 35 11 490 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
Q5SCZ6 5.51e-80 261 34 11 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Huperzia lucidula
Q0G9R2 7.5e-80 260 33 11 499 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
P06262 8.34e-80 260 33 9 497 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tabacum
Q3C1Q4 8.34e-80 260 33 9 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana sylvestris
Q2PMN2 1.08e-79 260 32 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
P48915 1.14e-79 260 35 6 498 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
B2LMP8 1.21e-79 260 32 9 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Guizotia abyssinica
Q33BX2 1.37e-79 260 33 9 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tomentosiformis
A2T383 1.4e-79 259 34 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
Q2VED0 1.81e-79 259 33 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum tuberosum
A9L9E7 2.1e-79 259 33 8 507 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
Q2JK43 2.17e-79 260 34 11 489 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q32S08 3.94e-79 259 36 8 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
A4GGE6 6.03e-79 258 32 9 505 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
Q85FH5 6.06e-79 258 33 9 507 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
A6MMZ5 1.52e-78 257 33 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Illicium oligandrum
O47497 2.63e-78 256 36 7 462 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
Q09WW8 2.75e-78 256 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
Q2JWW3 5.06e-78 256 37 7 447 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
A4QJQ0 5.14e-78 256 33 10 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema grandiflorum
F1SVH9 7.76e-78 255 33 9 489 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q09FZ6 1.25e-77 254 33 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Platanus occidentalis
A4QJG6 1.45e-77 254 33 10 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema cordifolium
B1VKI4 2.14e-77 254 32 10 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cryptomeria japonica
B0Z5H7 3.43e-77 253 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera parviflora
Q68RV6 3.62e-77 253 32 9 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Panax ginseng
Q2JPJ1 4.51e-77 254 37 11 478 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
P58419 7.6e-77 253 33 9 511 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera elata subsp. hookeri
B0Z593 8.73e-77 253 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera glazioviana
B0Z509 8.73e-77 253 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera biennis
B0Z4S5 1.11e-76 253 33 9 503 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera argillicola
Q70XV2 1.23e-76 252 33 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Amborella trichopoda
Q14FA8 2.89e-76 251 32 9 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus alba
Q6EW00 2.99e-76 251 33 8 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nymphaea alba
P72823 3.71e-76 253 36 10 455 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06GU6 4.77e-76 251 32 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Drimys granadensis
P06263 5.74e-76 250 35 10 497 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
Q49KU8 8.94e-76 250 32 9 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Eucalyptus globulus subsp. globulus
Q7NP39 1.22e-75 250 35 12 500 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8YM86 2.59e-75 250 33 12 540 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MAR0 2.74e-75 250 33 12 540 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q0H8X6 2.83e-75 248 31 12 508 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
B1NWJ9 5e-75 248 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Manihot esculenta
Q9M3J0 5.68e-75 248 33 9 510 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Spinacia oleracea
P9WIW5 7.08e-75 249 33 11 532 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 7.08e-75 249 33 11 532 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q10ZG8 8.46e-75 249 36 8 446 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
A4GYW6 9.65e-75 247 32 10 509 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus trichocarpa
Q06R80 1.18e-74 247 32 9 499 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Jasminum nudiflorum
Q9MUM8 1.28e-74 247 35 10 493 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
Q06FQ4 2.23e-74 246 33 9 498 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Pelargonium hortorum
P58420 2.32e-74 246 33 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Triticum aestivum
Q9BBP3 3.65e-74 246 34 7 460 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
A6MMH7 4.57e-74 245 32 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chloranthus spicatus
B1A984 5.3e-74 245 32 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Carica papaya
O03060 5.89e-74 245 33 10 506 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Hordeum vulgare
A9LYF0 6.15e-74 245 31 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
Q7YJT3 9.56e-74 244 32 7 486 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
Q3V4Y4 2.73e-73 243 31 8 507 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
A8Y9D7 3e-73 243 32 9 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lolium perenne
Q0ZIW8 4.83e-73 243 32 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Vitis vinifera
Q0G9G9 5.04e-73 243 32 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Liriodendron tulipifera
Q4VZL8 1.14e-72 242 32 9 511 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cucumis sativus
A1EA59 1.38e-72 241 32 10 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Agrostis stolonifera
Q6L3E0 1.51e-72 241 32 8 496 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Saccharum hybrid
A1E9X4 1.91e-72 241 32 9 506 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Sorghum bicolor
Q6ENP7 2.06e-72 241 32 8 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Saccharum officinarum
Q2L955 2.79e-72 241 33 10 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium hirsutum
A0ZZ85 2.79e-72 241 33 10 504 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium barbadense
P03913 3.62e-72 240 35 10 465 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Aspergillus amstelodami
P26288 1.14e-71 239 33 11 511 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabidopsis thaliana
A6H5P2 1.31e-71 239 32 10 501 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cycas taitungensis
A6MM87 1.55e-71 239 32 8 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Buxus microphylla
A1XG05 2.49e-71 238 32 7 502 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nuphar advena
A4QLP7 3.75e-71 238 33 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lobularia maritima
A4QK70 4.08e-71 238 33 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabis hirsuta
P0CY44 6.59e-71 238 34 7 461 3 ndh-4 NADH-ubiquinone oxidoreductase chain 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P0C325 1.01e-70 236 32 10 508 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa subsp. japonica
P0C324 1.01e-70 236 32 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa subsp. indica
P0C323 1.01e-70 236 32 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza sativa
Q6ENA7 1.01e-70 236 32 10 508 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oryza nivara
A4QL71 1.36e-70 236 32 10 507 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Draba nemorosa
A0A385 1.39e-70 236 31 8 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Coffea arabica
A4QKP5 1.58e-70 236 32 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Capsella bursa-pastoris
A4QLF9 1.72e-70 236 33 9 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lepidium virginicum
A4QLY5 4.62e-70 235 33 10 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nasturtium officinale
A4QKF7 5.36e-70 234 33 10 513 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Barbarea verna
A4QJY2 9.37e-70 234 32 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Olimarabidopsis pumila
P11647 2.22e-69 233 32 8 496 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zea mays
A6MMR3 7.98e-69 231 31 8 510 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Dioscorea elephantipes
A4QKY4 1.71e-68 231 32 10 511 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Crucihimalaya wallichii
Q37375 9.56e-67 226 34 6 401 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Acanthamoeba castellanii
Q36834 2.17e-65 222 32 10 488 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Trichophyton rubrum
P15582 5.93e-56 198 32 7 461 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
O21047 1.25e-53 192 33 8 378 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
A9RAH8 3.6e-51 184 30 9 414 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9B6D6 3.33e-49 179 33 8 405 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9B8C8 4.19e-49 178 29 9 415 3 NAD4 NADH-ubiquinone oxidoreductase chain 4 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2LCP7 2.38e-48 175 32 3 319 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium citrinum
Q56228 6.8e-48 175 32 9 449 1 nqo13 NADH-quinone oxidoreductase subunit 13 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O79436 6.58e-47 172 34 4 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oryctolagus cuniculus
P20113 2.89e-46 170 30 6 403 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chlamydomonas reinhardtii
P03910 3.86e-46 170 32 5 368 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos taurus
P48655 4.19e-46 170 33 6 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Equus caballus
Q576B5 4.5e-46 170 32 5 368 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos indicus
Q9ZZY2 4.88e-46 170 34 4 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Hippopotamus amphibius
P41298 6.11e-46 169 32 8 407 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera musculus
Q5Y4Q1 1.58e-45 168 32 5 368 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos mutus grunniens
P24975 3.22e-45 167 31 8 408 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera physalus
Q00506 3.29e-45 167 33 4 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Phoca vitulina
O79677 6.85e-45 167 31 9 414 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pelomedusa subrufa
P38601 8.66e-45 166 34 4 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Halichoerus grypus
Q96068 1.18e-44 166 34 7 323 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Rhinoceros unicornis
P92484 1.49e-44 166 32 6 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Equus asinus
O78755 2.68e-44 165 32 5 368 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ovis aries
Q598S9 3.22e-44 165 32 6 358 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Caperea marginata
P24998 3.59e-44 165 32 12 425 3 NAD4 NADH-ubiquinone oxidoreductase chain 4 Pisaster ochraceus
P92698 5.52e-44 164 32 8 375 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pongo abelii
Q95917 5.69e-44 164 29 7 413 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Polypterus ornatipinnis
O03204 6.17e-44 164 34 7 323 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ceratotherium simum
O79881 6.83e-44 164 31 5 368 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Sus scrofa
Q591M5 7.11e-44 164 30 5 361 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus simmonsi
Q38PR3 8.68e-44 164 34 6 334 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Mammuthus primigenius
O21334 9.17e-44 164 30 7 409 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dasypus novemcinctus
P03908 1.65e-43 163 30 10 409 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pongo pygmaeus
P05508 1.7e-43 163 30 7 406 3 Mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Rattus norvegicus
P48916 2.5e-43 162 31 6 380 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Felis catus
Q34878 2.64e-43 162 31 8 373 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lemur catta
Q591Y7 3.07e-43 162 30 6 359 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus sambiranensis
Q8W9M7 3.16e-43 162 31 6 363 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dugong dugon
Q2I3G5 3.76e-43 162 34 6 334 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Elephas maximus
A8DQK9 7.12e-43 161 32 5 324 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Avahi cleesei
Q2I3F2 8.37e-43 161 34 5 329 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Loxodonta africana
A8DQI9 1.37e-42 160 31 7 364 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Avahi unicolor
P11992 2.81e-42 159 32 11 430 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Patiria pectinifera
Q9T9W6 3.94e-42 159 34 7 369 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pan paniscus
O79410 5.65e-42 159 31 8 411 3 MTND4 NADH-ubiquinone oxidoreductase chain 4 Scyliorhinus canicula
Q3L6Y5 6.94e-42 159 33 5 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Canis lupus
P41308 1.35e-41 158 30 7 360 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Didelphis virginiana
P03907 2.02e-41 157 33 9 330 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gorilla gorilla gorilla
P03905 4.31e-41 156 34 6 322 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Homo sapiens
P03909 5.22e-41 156 32 5 354 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Hylobates lar
P48917 9.21e-41 156 30 6 392 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Wickerhamomyces canadensis
Q9ZZ58 1.25e-40 155 33 5 318 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Canis lupus familiaris
Q8W9G4 1.37e-40 155 31 6 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tachyglossus aculeatus aculeatus
Q36458 1.48e-40 155 31 5 329 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ornithorhynchus anatinus
Q85DA7 1.52e-40 155 30 8 369 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lepilemur septentrionalis
Q9MIY1 1.59e-40 155 32 14 417 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Danio rerio
Q34048 1.72e-40 154 32 11 393 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ceratitis capitata
P03906 1.88e-40 154 33 8 378 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Pan troglodytes
P07707 2.52e-40 154 35 9 313 3 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Drosophila yakuba
Q35542 4.04e-40 154 29 4 357 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Petromyzon marinus
O78687 6e-40 153 30 11 430 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Carassius auratus
Q4JQH8 1.34e-39 152 31 6 380 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tetraodon nigroviridis
O03173 1.86e-39 152 30 6 379 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Latimeria chalumnae
O79555 2.05e-39 151 30 6 355 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lycodon semicarinatus
P34194 2.3e-39 152 31 11 428 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Formosania lacustris
P18931 4.7e-39 150 34 10 330 1 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Drosophila melanogaster
Q5ZNA1 5.1e-39 150 30 6 382 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Zaglossus bruijni
O79421 1.05e-38 149 33 10 363 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Branchiostoma lanceolatum
Q9ZZ45 1.43e-38 149 31 9 385 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Squalus acanthias
P18939 2.53e-38 149 30 12 424 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gallus gallus
Q34949 2.72e-38 148 28 8 407 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Lumbricus terrestris
P12775 3.42e-38 148 32 10 388 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Paracentrotus lividus
O47423 4.58e-38 148 32 10 363 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Branchiostoma floridae
O99825 9.86e-38 146 32 16 404 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Rhipicephalus sanguineus
O21406 1.14e-37 147 30 10 410 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Struthio camelus
P55781 1.66e-37 146 31 9 377 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gadus morhua
P03911 2.72e-37 146 27 7 417 1 Mtnd4 NADH-ubiquinone oxidoreductase chain 4 Mus musculus
P34941 4e-37 145 34 13 355 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Arbacia lixula
P11631 7.55e-37 144 30 10 393 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oncorhynchus mykiss
P92668 8.62e-37 144 30 8 410 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Osphranter robustus
Q9ZZM4 9.57e-36 141 33 9 349 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Salmo salar
Q36424 5.36e-35 139 31 11 349 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Locusta migratoria
P03912 3.63e-34 137 29 11 415 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Xenopus laevis
Q9G2W9 3.11e-33 134 30 7 363 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Myxine glutinosa
B1I6I5 3.5e-33 135 27 13 431 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
P15551 3.75e-33 134 32 9 378 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Strongylocentrotus purpuratus
P03914 3.82e-32 125 34 2 207 3 nd4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Emericella nidulans
P34852 6.88e-32 130 34 10 348 3 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Anopheles gambiae
Q1HR20 1.22e-31 130 32 10 381 2 mt:ND4 NADH-ubiquinone oxidoreductase chain 4 Aedes aegypti
Q8CPU8 1.75e-31 132 28 15 467 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.75e-31 132 28 15 467 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P33511 3.52e-31 128 34 10 344 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Anopheles quadrimaculatus
Q37711 3.8e-30 124 28 4 331 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Artemia franciscana
Q4L4W7 2.18e-29 125 26 14 468 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
P48914 5.66e-29 122 31 2 234 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Albinaria caerulea
Q00231 5.85e-29 122 34 0 184 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Mytilus edulis
Q52978 7.97e-29 124 27 14 464 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
A9QPJ1 1.16e-28 122 32 3 255 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
P34853 4.03e-28 120 27 7 324 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Apis mellifera ligustica
Q9RGZ2 7.4e-28 119 25 13 500 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q0Q2K0 2.56e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 2.56e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 2.56e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 2.56e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 2.56e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 2.56e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q8NXT2 2.7e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 2.7e-27 119 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q6GJ47 7.27e-27 118 27 18 441 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q99VZ2 8.48e-27 118 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 8.48e-27 118 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 8.48e-27 118 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 8.48e-27 118 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 8.48e-27 118 27 17 426 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YST2 1.02e-26 117 27 20 486 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
O05229 2.2e-26 115 25 10 451 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
Q49W91 2.27e-26 117 26 13 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9K2S2 1.28e-25 114 26 17 485 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
P60675 1.35e-25 114 27 12 450 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 1.35e-25 114 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 1.35e-25 114 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 1.35e-25 114 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 1.35e-25 114 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YWT4 1.97e-25 114 28 13 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXF6 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 3.61e-25 113 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q6GID6 4.44e-25 112 27 12 450 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q9ZNG6 4.6e-25 112 27 12 450 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q8CQ50 1.23e-24 111 27 19 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRB2 1.23e-24 111 27 19 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9RGZ5 2.26e-24 110 25 18 514 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
O03704 3.22e-24 104 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus lepidus
P92681 3.52e-24 104 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Ovophis okinavensis
P23482 3.84e-24 109 27 8 350 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
Q49VG9 7.94e-24 108 27 14 421 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O03701 9.02e-24 103 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothriechis schlegelii
P92503 1.26e-23 102 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Agkistrodon piscivorus piscivorus
P77437 1.58e-23 107 26 14 498 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
P92492 1.76e-23 102 32 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Agkistrodon contortrix contortrix
O03710 2.33e-23 102 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus concolor
B4U8J0 2.59e-23 106 26 7 281 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Hydrogenobaculum sp. (strain Y04AAS1)
O03780 2.92e-23 101 32 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus albolabris
O03792 3.42e-23 101 32 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus cantori
P92623 4.11e-23 101 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Deinagkistrodon acutus
P92793 4.15e-23 101 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Protobothrops elegans
P92759 4.24e-23 101 32 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Trimeresurus stejnegeri
O03733 4.81e-23 100 29 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Hypnale hypnale
O03778 6.84e-23 100 32 5 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Sistrurus miliarius
O03702 9.44e-23 100 31 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Crotalus adamanteus
O03700 1.34e-22 99 31 4 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothriechis lateralis
Q4UK27 1.37e-22 105 24 12 443 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P15581 1.63e-22 103 28 11 347 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Paramecium tetraurelia
O03807 1.7e-22 99 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Tropidolaemus wagleri
O03763 1.83e-22 99 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrocophias hyoprora
P92794 2.14e-22 99 31 4 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Protobothrops flavoviridis
Q7A725 2.36e-22 103 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 2.36e-22 103 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 2.36e-22 103 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L443 2.46e-22 104 26 18 427 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q0Q2J7 2.49e-22 103 25 13 504 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
O03773 7.31e-22 97 32 7 240 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Porthidium ophryomegas
O03727 7.75e-22 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Gloydius intermedius
Q8NXT1 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 8e-22 102 24 14 501 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
P92613 8.8e-22 97 31 5 231 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Calloselasma rhodostoma
P92649 1.03e-21 97 31 5 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Lachesis muta muta
O03703 1.2e-21 97 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Cerrophidion godmani
O03698 1.2e-21 97 29 3 233 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops bilineatus
P9WIW8 1.31e-21 101 26 14 410 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P92494 1.36e-21 96 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Azemiops feae
O03695 1.38e-21 96 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Atropoides picadoi
O03699 1.39e-21 96 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops erythromelas
P9WIW9 1.56e-21 101 26 14 408 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 1.56e-21 101 26 14 408 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O03707 1.7e-21 96 30 3 236 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Causus rhombeatus
O03697 2.72e-21 95 32 6 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Bothrops asper
O03772 3.27e-21 95 32 7 237 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Porthidium nasutum
O03692 4.04e-21 95 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Metlapilcoatlus nummifer
O03726 4.12e-21 95 31 5 234 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 (Fragment) Gloydius blomhoffii
B7GME1 4.35e-21 99 26 10 371 3 nuoN NADH-quinone oxidoreductase subunit N Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q6GJ44 7.04e-21 99 24 17 518 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
Q49W88 8.84e-21 99 26 12 403 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
C1AZG0 1.01e-20 99 29 3 225 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
Q6GID9 1.13e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
P60687 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 1.19e-20 98 25 16 410 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 1.19e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HHD6 1.28e-20 98 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
Q2YWT7 1.36e-20 98 25 16 410 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L4W4 1.77e-20 97 26 12 396 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
Q5HRA9 2.05e-20 97 25 14 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ47 2.45e-20 97 25 15 462 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A8Z056 3.37e-20 97 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 3.37e-20 97 26 15 382 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
C0QR92 4.38e-20 96 26 15 475 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
Q2RJT7 1.13e-19 95 28 3 265 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A6LXP5 1.28e-19 95 26 9 393 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A4GGE3 1.44e-19 95 28 13 360 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q31HE7 1.54e-19 94 24 12 387 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5GS15 1.57e-19 94 23 9 378 3 nuoN NADH-quinone oxidoreductase subunit N Wolbachia sp. subsp. Brugia malayi (strain TRS)
B1W506 1.74e-19 95 27 11 392 3 nuoN3 NADH-quinone oxidoreductase subunit N 3 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q9ZCG1 2.37e-19 95 23 12 444 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q6ANN6 2.81e-19 94 25 12 393 3 nuoN NADH-quinone oxidoreductase subunit N Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q32516 3.3e-19 94 26 16 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
B1VKJ3 3.56e-19 94 27 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
B1MAF7 4.02e-19 94 26 7 271 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q31952 6.61e-19 93 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q32880 7.9e-19 93 27 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q859V1 8.42e-19 93 26 12 399 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q2VED3 8.8e-19 93 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q92G97 8.84e-19 93 23 11 444 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8M609 9.49e-19 92 26 12 388 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
B3TN96 1.03e-18 93 27 15 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q33066 1.04e-18 93 27 15 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q6L3E3 1.26e-18 92 27 15 390 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q6ENQ0 1.31e-18 92 27 15 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
P46620 1.36e-18 92 27 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
Q2MIE0 1.49e-18 92 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
A8Y9D4 1.5e-18 92 27 14 382 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
Q49VH2 1.61e-18 92 24 9 429 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q95H46 1.82e-18 92 27 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
Q09FR3 1.96e-18 92 27 15 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
B8J1C7 2.19e-18 91 24 15 433 3 nuoN NADH-quinone oxidoreductase subunit N Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A7Y3K7 2.22e-18 92 27 16 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
A8LC88 2.67e-18 91 27 6 266 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
P51099 2.75e-18 92 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q32S06 2.82e-18 91 27 16 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q8S8V0 2.87e-18 91 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q32440 3.05e-18 91 27 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
A1EA56 3.36e-18 91 27 15 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q7N2J9 3.47e-18 90 26 14 420 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q55429 3.48e-18 91 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2QD43 3.78e-18 91 25 16 468 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q9B6D3 4.11e-18 91 25 16 418 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9XAR5 4.44e-18 90 25 17 480 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6YXQ6 4.61e-18 91 26 22 492 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q8W8H5 4.88e-18 91 26 14 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
A0KJ55 4.89e-18 90 26 18 445 3 nuoN NADH-quinone oxidoreductase subunit N Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q33BX5 5.63e-18 90 25 15 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
P06265 5.88e-18 90 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
P24880 5.94e-18 89 34 4 188 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ascaris suum
Q3C1N9 5.99e-18 90 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q9TKV7 6.56e-18 90 24 13 433 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
C5C0R4 7.31e-18 90 26 11 392 3 nuoN NADH-quinone oxidoreductase subunit N Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
A1XG02 7.34e-18 90 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q8CPV1 8.12e-18 89 26 9 315 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A7NEJ7 8.33e-18 89 24 12 369 3 nuoN NADH-quinone oxidoreductase subunit N Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B5YKJ2 8.57e-18 89 26 15 375 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q5HQL3 9.29e-18 89 26 9 315 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q32091 1.05e-17 90 26 11 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q32551 1.08e-17 90 25 11 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q31849 1.23e-17 89 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51100 1.25e-17 89 25 13 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q32539 1.42e-17 89 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q6EW03 1.45e-17 89 26 15 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
A6H5N8 1.53e-17 89 26 14 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P0C328 1.59e-17 89 26 14 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 1.59e-17 89 26 14 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 1.59e-17 89 26 14 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 1.59e-17 89 26 14 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q32238 1.88e-17 89 26 15 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
A0LRJ4 1.88e-17 88 27 15 387 3 nuoN NADH-quinone oxidoreductase subunit N Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q0G9R5 2.09e-17 89 26 14 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
B1X491 2.21e-17 89 25 20 491 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q32007 2.41e-17 89 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
C5D978 2.55e-17 88 25 12 391 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
P11993 2.74e-17 88 25 13 359 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q32131 2.79e-17 88 26 15 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q32384 2.88e-17 88 25 14 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q2LCP6 3.11e-17 88 24 18 484 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q06R83 3.15e-17 88 26 14 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q5F629 3.16e-17 87 27 11 385 3 nuoN NADH-quinone oxidoreductase subunit N Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q49KV1 3.37e-17 88 28 16 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
P15584 4.28e-17 87 28 11 300 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
B3E9V6 4.47e-17 87 26 9 369 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
P51098 4.84e-17 87 25 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
P51096 4.97e-17 87 25 13 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
B2LMQ1 5.02e-17 87 24 14 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q68RV9 5.2e-17 87 25 12 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q8HHD2 5.58e-17 87 23 15 462 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q85T01 5.94e-17 87 24 11 394 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q1QSU4 6.01e-17 87 25 8 386 3 nuoN NADH-quinone oxidoreductase subunit N Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
O67342 6.33e-17 86 26 5 259 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
B4U8I1 6.45e-17 87 29 6 217 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Hydrogenobaculum sp. (strain Y04AAS1)
Q32126 6.86e-17 87 25 18 472 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
P51095 7.17e-17 87 25 13 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
P50939 7.63e-17 87 24 14 447 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q8K9X7 8.14e-17 87 27 15 359 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A4QKP2 8.64e-17 87 26 17 442 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
A7HY36 8.79e-17 86 26 11 306 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A7NPD6 1.04e-16 86 24 16 444 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
O03205 1.14e-16 86 25 15 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
Q2L960 1.32e-16 86 27 16 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q6A6H1 1.43e-16 85 25 13 403 3 nuoN NADH-quinone oxidoreductase subunit N Cutibacterium acnes (strain DSM 16379 / KPA171202)
P31971 1.46e-16 86 27 12 359 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A4QKF4 1.65e-16 86 26 16 445 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
A0A382 1.65e-16 86 25 15 434 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q32RH9 1.7e-16 86 27 15 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
A4QLF6 1.83e-16 86 25 16 445 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q9MUK8 1.83e-16 85 25 23 511 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
A4QLP4 1.85e-16 86 26 16 445 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q02CT1 2.05e-16 85 23 12 432 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
P24892 2.25e-16 84 31 2 188 3 nduo-4 NADH-ubiquinone oxidoreductase chain 4 Caenorhabditis elegans
P51097 2.35e-16 85 26 16 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q4L446 2.39e-16 85 23 10 432 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q0G9H2 2.4e-16 85 26 17 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
A4QKY1 2.56e-16 85 26 16 435 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
O78688 2.77e-16 85 26 15 407 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q3AC87 2.92e-16 84 26 7 264 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A6MMZ2 2.96e-16 85 27 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q94RJ2 3.11e-16 85 25 13 392 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
B9LGS9 3.14e-16 85 25 16 418 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A4J650 3.19e-16 84 25 6 266 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q01UN3 3.35e-16 84 24 4 260 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solibacter usitatus (strain Ellin6076)
Q1RKE6 3.63e-16 85 23 15 475 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
A4QK67 3.79e-16 85 25 12 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02825
Feature type CDS
Gene nuoM
Product NADH-quinone oxidoreductase subunit M
Location 596664 - 598184 (strand: 1)
Length 1521 (nucleotides) / 506 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1926
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1008 Energy production and conversion (C) C NADH:ubiquinone oxidoreductase subunit 4 (chain M)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00342 NADH-quinone oxidoreductase subunit M [EC:7.1.1.2] Oxidative phosphorylation
Metabolic pathways
NADH:quinone oxidoreductase, prokaryotes

Protein Sequence

MLLPWLILIPFIGGLLCWQTERFGTKLPRWIALLTMGITLLLALYLWIQGNYSLINPKGIPDWQAEYFLSWIPRFGINIHLALDGLSLLMVVLTALLGLLAILCSWGENQPYQGFFHLNLLWILGGVMGVFLAMDLFLFFFFWEMMLVPMYFLIALWGHSGSDGKTRIGAATKFFIYTQSSGLVMLISIMALAIVHFNATGQWSFGYEDLLNTPMSYGVQYMLMLGFFIAFAVKMPVVPLHGWLPDAHSQAPTAGSVDLAGILLKTAAYGLLRFALPLFPEASADFTPIAMWLGVIGIFYGAWMAFKQTDIKRLIAYTSVSHMGFVLIAIYSASMLAYQGAVVQMIAHGLSAAGLFILCGQLYERLGTRDMRQMGGLWKRIKYLPALSLFFAVATLGMPGTGNFVGEFMILFGSFGSYTLITVISSAGLVFASVYALWMMQQVYYGTPKSDKPIAGMNLREISIVMLLVVLLVILGVYPQPVLDTSSAAMANIQQWYSASISTTGL

Flanking regions ( +/- flanking 50bp)

GCTGGTTCTCGCTCTGCTGCTTTTGGTTTAAATAAGGGACACACTGCGCCATGCTATTACCCTGGCTGATTTTAATTCCCTTCATCGGCGGTCTGCTGTGCTGGCAGACCGAGCGCTTCGGCACAAAGTTGCCGCGTTGGATAGCGCTGCTGACGATGGGGATCACGTTACTTCTTGCTCTGTATCTGTGGATACAGGGGAATTACAGCTTAATTAACCCGAAAGGTATCCCGGACTGGCAGGCAGAATATTTCCTGTCATGGATACCCCGCTTCGGCATCAATATCCACCTGGCACTGGATGGTTTATCACTGCTGATGGTGGTGCTGACCGCACTTCTTGGTTTGCTGGCTATCCTCTGTTCGTGGGGTGAAAACCAGCCGTATCAGGGCTTCTTCCATCTGAACCTGCTGTGGATTTTAGGCGGTGTGATGGGCGTGTTCCTGGCAATGGATCTTTTCCTGTTCTTCTTCTTCTGGGAAATGATGCTGGTGCCGATGTACTTCCTGATAGCGCTCTGGGGACACAGCGGCTCTGACGGTAAAACCCGTATTGGTGCGGCAACGAAATTCTTCATCTATACCCAGTCCAGTGGTCTGGTGATGCTGATTTCCATTATGGCGCTGGCGATTGTGCACTTTAACGCGACGGGTCAGTGGAGCTTCGGTTATGAAGATCTGCTGAATACGCCGATGAGCTATGGTGTGCAGTATATGCTGATGCTGGGCTTTTTTATCGCCTTTGCGGTCAAAATGCCGGTAGTGCCGTTACACGGCTGGCTGCCGGATGCACACAGCCAGGCACCGACTGCCGGTTCTGTTGACCTCGCCGGTATTCTGCTGAAAACAGCGGCCTATGGTCTGCTGCGTTTTGCGCTGCCGCTGTTCCCTGAAGCCTCTGCGGATTTCACCCCGATTGCTATGTGGCTGGGTGTGATCGGCATCTTCTACGGTGCGTGGATGGCGTTTAAACAGACAGATATCAAACGGCTTATCGCGTACACCAGTGTGTCGCACATGGGCTTTGTCCTGATTGCAATTTACTCGGCAAGTATGCTGGCGTATCAGGGGGCGGTGGTGCAGATGATTGCTCACGGTCTTTCTGCTGCGGGTCTGTTTATCCTGTGTGGTCAGCTCTATGAGCGTCTGGGTACCCGTGATATGCGCCAGATGGGCGGGTTGTGGAAACGGATTAAATATCTGCCTGCACTCTCCCTGTTCTTTGCAGTGGCAACACTCGGGATGCCGGGCACCGGTAACTTCGTTGGTGAATTTATGATCCTGTTCGGCAGCTTCGGCAGCTACACACTGATCACGGTAATTTCATCGGCGGGACTGGTTTTTGCTTCCGTATACGCGCTGTGGATGATGCAGCAGGTGTATTACGGCACACCGAAATCGGATAAACCTATTGCAGGCATGAATCTGCGTGAAATCTCTATCGTGATGTTATTAGTGGTATTACTGGTTATTCTGGGTGTTTACCCGCAGCCGGTTCTGGATACCTCTTCGGCCGCGATGGCGAATATTCAGCAGTGGTATTCTGCTTCCATTTCAACTACAGGGTTGTAATTCGCCATGACAATAACTCCTCAACAACTGATCGCACTCTTACCACTGCT