Homologs in group_3660

Help

3 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12595 FBDBKF_12595 39.2 Morganella morganii S1 ygiQ Radical SAM superfamily enzyme YgiQ, UPF0313 family
F4V73_RS07790 F4V73_RS07790 82.8 Morganella psychrotolerans - radical SAM protein
F4V73_RS07830 F4V73_RS07830 40.8 Morganella psychrotolerans - radical SAM protein

Distribution of the homologs in the orthogroup group_3660

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3660

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q55914 2.42e-76 249 35 9 414 3 slr0309 Uncharacterized methyltransferase slr0309 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8KCU0 1.16e-53 189 28 7 426 1 bchR Bacteriochlorophyllide d C-12(1)-methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KBK9 6.7e-48 173 26 9 434 1 bchQ Bacteriochlorophyllide d C-8(2)-methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
O58549 2.11e-39 150 25 12 466 3 PH0819 Uncharacterized methyltransferase PH0819 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P42349 1.51e-26 115 25 11 378 4 sll1242 Uncharacterized methyltransferase sll1242 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B3QHD1 5.2e-23 105 24 10 397 1 hpnP Hopanoid C-2 methylase Rhodopseudomonas palustris (strain TIE-1)
Q9RFD3 8.77e-15 80 26 10 256 3 bchE Anaerobic magnesium-protoporphyrin IX monomethyl ester cyclase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q7X2C7 6.61e-12 71 23 9 275 1 bchE Anaerobic magnesium-protoporphyrin IX monomethyl ester cyclase Rubrivivax gelatinosus
P26168 9.28e-12 70 24 12 294 1 bchE Anaerobic magnesium-protoporphyrin IX monomethyl ester cyclase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q60AV6 9.5e-12 70 24 10 361 1 hpnR Hopanoid C-3 methylase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q56184 1.13e-09 63 23 4 189 1 fom3 Cytidylyl-2-hydroxyethylphosphonate methyltransferase Streptomyces wedmorensis
A4YJD7 3.78e-09 62 26 15 333 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bradyrhizobium sp. (strain ORS 278)
Q55373 8.71e-09 61 23 4 215 3 bchE Anaerobic magnesium-protoporphyrin IX monomethyl ester cyclase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0KN81 2.65e-08 59 28 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SJX4 2.7e-08 59 28 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aeromonas salmonicida (strain A449)
Q58275 5.18e-08 58 22 7 266 3 MJ0865 Putative methylthiotransferase MJ0865 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A5E855 1.01e-07 57 25 14 333 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q6LNA5 6.25e-07 55 24 12 277 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Photobacterium profundum (strain SS9)
A3D7M8 1.36e-06 54 27 8 227 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q07V68 1.68e-06 53 26 11 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain BisA53)
B0BQR0 1.91e-06 53 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GYA4 2.19e-06 53 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1X3 2.19e-06 53 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q5QYC5 2.63e-06 53 27 9 193 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1RGV4 2.88e-06 53 26 9 248 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella sp. (strain W3-18-1)
Q87RP4 3e-06 53 27 8 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4Y9E1 3.03e-06 53 26 9 248 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q7MN00 3.34e-06 53 26 8 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Vibrio vulnificus (strain YJ016)
Q4ZN97 4.24e-06 52 25 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas syringae pv. syringae (strain B728a)
Q48DN8 4.35e-06 52 25 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A6WWX6 4.78e-06 52 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A4VQY3 4.83e-06 52 26 11 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Stutzerimonas stutzeri (strain A1501)
Q9KTE0 5.79e-06 52 26 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2X6 5.79e-06 52 26 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7N1G9 6.61e-06 52 26 8 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Vibrio campbellii (strain ATCC BAA-1116)
Q57AB1 7.08e-06 52 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQS8 7.08e-06 52 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain 2308)
B2S9E5 7.08e-06 52 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain S19)
Q4K5I3 7.3e-06 52 26 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4XYW1 7.69e-06 52 26 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas mendocina (strain ymp)
Q3K6B7 9.67e-06 51 26 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas fluorescens (strain Pf0-1)
Q8DFE8 9.8e-06 51 25 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Vibrio vulnificus (strain CMCP6)
A9KZZ3 9.97e-06 51 26 8 227 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella baltica (strain OS195)
A6WRJ1 9.97e-06 51 26 8 227 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella baltica (strain OS185)
Q87VY1 1.33e-05 51 25 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q13EK7 1.4e-05 51 24 16 335 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain BisB5)
Q0HXT7 1.5e-05 50 26 9 248 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella sp. (strain MR-7)
Q0HLI3 1.5e-05 50 26 9 248 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella sp. (strain MR-4)
Q8FXU4 1.52e-05 50 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis biovar 1 (strain 1330)
A9M9Y3 1.52e-05 50 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8YEA2 1.53e-05 50 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A0KTX4 1.91e-05 50 26 9 248 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella sp. (strain ANA-3)
Q47Y80 2.01e-05 50 25 10 231 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7VP74 2.1e-05 50 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5FPF1 2.61e-05 50 24 9 221 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Gluconobacter oxydans (strain 621H)
A5VTA1 3.28e-05 49 25 15 337 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8CX45 3.67e-05 49 26 8 227 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6U5H0 3.76e-05 49 25 11 239 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sinorhizobium medicae (strain WSM419)
B0VQX2 3.91e-05 49 23 10 280 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acinetobacter baumannii (strain SDF)
A1U494 4.22e-05 49 25 8 193 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1S8S1 4.65e-05 49 25 9 246 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q3SMT7 6.01e-05 48 23 13 333 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q11BD9 6.1e-05 48 27 11 231 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Chelativorans sp. (strain BNC1)
Q92SI7 6.19e-05 48 25 11 239 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium meliloti (strain 1021)
Q3IK75 6.49e-05 48 26 10 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudoalteromonas translucida (strain TAC 125)
A1A280 7e-05 48 24 16 315 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q9L699 0.00011 48 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pasteurella multocida (strain Pm70)
Q2NUT9 0.000115 48 26 9 219 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sodalis glossinidius (strain morsitans)
B0UUU9 0.000141 47 25 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Histophilus somni (strain 2336)
Q0I3Z1 0.000141 47 25 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Histophilus somni (strain 129Pt)
Q1LU21 0.000157 47 27 9 196 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
B1JG95 0.000158 47 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DD3 0.000159 47 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K896 0.000159 47 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FKU9 0.000159 47 26 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B0CK00 0.000162 47 25 15 318 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
B4EV28 0.000182 47 25 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Proteus mirabilis (strain HI4320)
Q51470 0.000216 47 23 8 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02SE8 0.000216 47 23 8 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V0C9 0.00022 47 23 8 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudomonas aeruginosa (strain PA7)
Q57163 0.000228 47 27 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFJ1 0.000228 47 27 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Haemophilus influenzae (strain PittGG)
Q1CKP3 0.000232 47 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WDR2 0.000232 47 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pestis
Q1C531 0.000232 47 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pestis bv. Antiqua (strain Antiqua)
Q1QS74 0.000234 47 23 17 335 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A4TNY6 0.000234 47 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pestis (strain Pestoides F)
A9R6X8 0.000234 47 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia pestis bv. Antiqua (strain Angola)
Q3JEH9 0.000245 47 26 8 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1JQA3 0.000267 47 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2HZ55 0.000281 47 23 10 280 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acinetobacter baumannii (strain ACICU)
B0V6R4 0.000289 47 23 10 280 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acinetobacter baumannii (strain AYE)
B7I9D5 0.000289 47 23 10 280 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acinetobacter baumannii (strain AB0057)
B7GW55 0.000289 47 23 10 280 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acinetobacter baumannii (strain AB307-0294)
Q7MB63 0.000289 47 26 8 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B6EIN8 0.000304 47 25 10 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aliivibrio salmonicida (strain LFI1238)
B7MPH7 0.000409 46 27 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O81 (strain ED1a)
Q6NCM4 0.000418 46 26 11 219 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0BVY6 0.00044 46 25 7 211 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B0UNY0 0.000443 46 25 7 208 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylobacterium sp. (strain 4-46)
A6T6B5 0.000462 46 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZQ0 0.000462 46 25 10 219 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Klebsiella pneumoniae (strain 342)
A1KS33 0.000468 46 24 7 210 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JXV8 0.000468 46 24 7 210 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M1G4 0.000476 46 24 8 213 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Neisseria meningitidis serogroup C (strain 053442)
B4RNW8 0.000485 46 24 7 210 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Neisseria gonorrhoeae (strain NCCP11945)
B2TU59 0.000487 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3Z4D1 0.000496 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shigella sonnei (strain Ss046)
Q324N4 0.000496 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shigella boydii serotype 4 (strain Sb227)
A1IQ34 0.000502 46 24 7 210 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q83LY3 0.000504 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shigella flexneri
Q0T6S0 0.000504 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shigella flexneri serotype 5b (strain 8401)
B6HYN0 0.000504 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli (strain SE11)
Q32IR1 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shigella dysenteriae serotype 1 (strain Sd197)
B7LKU3 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLB3 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli (strain SMS-3-5 / SECEC)
B7N9R6 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AEI1 0.000513 46 26 10 225 1 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli (strain K12)
B1IYE7 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AEI2 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TK19 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZXT0 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O9:H4 (strain HS)
B1X656 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli (strain K12 / DH10B)
B7M5I8 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O8 (strain IAI1)
B7NM12 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YQL3 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AEI3 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O157:H7
B7L9K8 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli (strain 55989 / EAEC)
A7ZJ54 0.000513 46 26 10 225 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B3QAC6 0.00052 46 23 16 335 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain TIE-1)
Q5FAI1 0.000529 45 24 7 210 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q15TR4 0.000587 45 24 7 214 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2J2K9 0.000645 45 25 9 219 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain HaA2)
Q6D7K6 0.000715 45 26 9 218 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q97I18 0.000718 45 21 9 256 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q087J4 0.00074 45 26 10 228 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Shewanella frigidimarina (strain NCIMB 400)
B2V930 0.000746 45 24 8 199 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
A9MKB7 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5FBL3 0.001 45 24 11 275 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aliivibrio fischeri (strain MJ11)
Q5E6U2 0.001 45 24 11 275 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5BCD1 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella paratyphi A (strain AKU_12601)
Q5PLT0 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7MQS5 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Cronobacter sakazakii (strain ATCC BAA-894)
Q9RCI2 0.001 45 25 9 215 1 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z8G5 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella typhi
B4TPZ0 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella schwarzengrund (strain CVM19633)
A9MUH8 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYN0 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella newport (strain SL254)
B4TB74 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella heidelberg (strain SL476)
B5FNB2 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella dublin (strain CT_02021853)
Q57RQ7 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella choleraesuis (strain SC-B67)
B5EZB2 0.001 45 25 9 215 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Salmonella agona (strain SL483)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_12555
Feature type CDS
Gene ygiQ
Product Radical SAM superfamily enzyme YgiQ, UPF0313 family
Location 25973 - 27346 (strand: 1)
Length 1374 (nucleotides) / 457 (amino acids)

Contig

Accession contig_15
Length 114235 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3660
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF04055 Radical SAM superfamily
PF13282 Domain of unknown function (DUF4070)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1032 General function prediction only (R) R Radical SAM superfamily enzyme YgiQ, UPF0313 family

Protein Sequence

MSAAEQEAPVRILLILPFDRTYRYRKSAFSVAISYAPLTLITLAALVPPHLNAELTLCDEGVSPPVTAGDFDLVVITATASSSPRAYALCRYWRERGARTAMGGAHVTLQPDEAAQHADTVLIGAGELIWPRFLQDMADGHPQPRYQHRSERGFLPMPVPRRDLLPSRAYMNIATIIADRGCPLACEFCSVQHQWGRKGTARPVADVINEIKQSGRQRWIFLDPNLYADRQYSLELFRALIPLKIRWSGLATLNVTDDDEVFRAMCDSGCEGLLIGLENLSQQTMTATGKNCNQVSEYRRQIRRLRDNRIAALGCFVLGFDQDTPESIRDTIRQIPSLGLDLVRFSVLTPLPGTRLWQRMAENGRLITQDLSLYDNEHVVFQPQNMSPETLQSLLHEAWRETYRLTAILRRVLHRPGSRFIRLAANLGFRLYARRLRHEKSGLFNPAIVTNNTRKTD

Flanking regions ( +/- flanking 50bp)

GATCCGGCACAGTGCGTCCCCAGACGTACTGTGCCATTGTAAAAGTCCTTATGTCAGCTGCGGAGCAGGAAGCACCGGTGAGAATATTACTGATTTTGCCGTTTGACAGGACTTACCGCTACCGGAAAAGTGCTTTTTCCGTGGCGATCAGCTATGCCCCGCTGACCCTTATCACCCTCGCCGCCCTGGTTCCCCCGCATCTGAATGCCGAACTGACCCTTTGTGATGAAGGCGTTTCCCCGCCGGTCACTGCCGGGGATTTTGATCTGGTGGTGATCACCGCCACCGCCTCCTCTTCCCCCCGCGCCTATGCACTGTGCCGCTACTGGCGCGAACGCGGGGCAAGAACCGCAATGGGCGGCGCGCACGTCACACTGCAGCCGGATGAAGCCGCACAGCATGCCGATACCGTCCTTATCGGCGCCGGTGAACTCATCTGGCCCCGGTTTCTGCAGGATATGGCTGACGGACATCCGCAGCCGCGTTATCAGCACCGCTCTGAGCGCGGCTTTCTGCCGATGCCGGTGCCGCGTCGTGATCTGCTGCCGTCCCGCGCCTATATGAATATCGCCACTATTATTGCCGACCGTGGCTGTCCGCTTGCCTGTGAATTCTGTTCAGTGCAGCATCAGTGGGGACGAAAAGGCACCGCACGTCCGGTGGCAGATGTGATTAACGAGATAAAACAGAGCGGCAGACAGCGCTGGATATTCCTCGACCCTAATCTGTACGCCGACCGGCAGTACAGTCTGGAACTGTTCCGGGCACTGATCCCGCTGAAAATCCGCTGGTCGGGACTGGCGACCCTCAATGTGACGGATGACGACGAGGTTTTCCGGGCGATGTGTGACAGCGGCTGCGAAGGGCTGCTTATCGGGCTGGAAAACCTCAGTCAGCAGACCATGACAGCCACCGGCAAGAATTGTAACCAGGTCAGCGAATACCGCCGTCAGATCCGGCGGCTGCGCGATAACCGGATTGCCGCACTCGGCTGTTTTGTGCTCGGGTTTGATCAAGACACCCCGGAGAGCATCCGCGATACGATACGGCAGATCCCGTCTCTCGGGCTCGATCTGGTGCGTTTTTCTGTCCTCACTCCGCTGCCGGGTACACGACTGTGGCAGCGGATGGCGGAAAACGGCCGCTTAATCACACAGGACCTGAGCCTGTATGACAACGAGCATGTGGTTTTTCAGCCGCAAAATATGTCACCGGAAACCCTGCAATCCTTACTGCACGAGGCCTGGCGGGAAACATACCGTCTGACGGCCATTCTGCGCCGGGTATTACACCGTCCGGGCAGCCGTTTTATCCGCCTGGCGGCCAATCTCGGCTTCCGGCTGTACGCCCGCCGGTTACGCCATGAAAAAAGCGGGCTGTTCAACCCGGCAATAGTGACGAATAACACAAGGAAAACAGACTGATGCGTCTTTTACTCAACAGTATTCTGCTGATTTTTTCGATGACTGCGGCA