Homologs in group_2849

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_14945 EHELCC_14945 100.0 Morganella morganii S2 paaJ Acetyl-CoA acetyltransferase
NLDBIP_14775 NLDBIP_14775 100.0 Morganella morganii S4 paaJ Acetyl-CoA acetyltransferase
LHKJJB_14570 LHKJJB_14570 100.0 Morganella morganii S3 paaJ Acetyl-CoA acetyltransferase
HKOGLL_13190 HKOGLL_13190 100.0 Morganella morganii S5 paaJ Acetyl-CoA acetyltransferase
F4V73_RS14320 F4V73_RS14320 84.0 Morganella psychrotolerans - acetyl-CoA C-acetyltransferase

Distribution of the homologs in the orthogroup group_2849

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2849

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76461 0.0 570 73 0 393 1 atoB Acetyl-CoA acetyltransferase Escherichia coli (strain K12)
P44873 0.0 552 68 0 393 3 atoB Acetyl-CoA acetyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45359 1.02e-173 493 61 1 392 1 thlA Acetyl-CoA acetyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P45369 2.34e-169 481 59 2 393 3 phaA Acetyl-CoA acetyltransferase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q9I2A8 9.35e-169 480 61 2 393 1 atoB Acetyl-CoA acetyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45363 7.8e-165 470 58 2 393 3 phaA Acetyl-CoA acetyltransferase Thiocystis violacea
Q18AR0 4.72e-163 466 58 1 392 1 thlA Acetyl-CoA acetyltransferase Clostridioides difficile (strain 630)
Q46939 5.2e-161 460 59 1 392 3 yqeF Probable acetyl-CoA acetyltransferase Escherichia coli (strain K12)
Q0AVM3 2.78e-160 459 58 4 395 1 Swol_1934 Acetyl-CoA acetyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P50174 5.69e-160 457 57 1 391 3 phaA Acetyl-CoA acetyltransferase Rhizobium meliloti (strain 1021)
P07097 5.98e-155 445 56 1 389 1 phaA Acetyl-CoA acetyltransferase Shinella zoogloeoides
Q9ZHI1 6.4e-154 442 59 2 391 3 phaA Acetyl-CoA acetyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P54810 1.85e-151 436 54 1 392 3 phaA Acetyl-CoA acetyltransferase Paracoccus denitrificans
P14611 1.52e-150 434 55 2 393 1 phaA Acetyl-CoA acetyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5HIU0 6.94e-150 432 54 3 393 3 SACOL0426 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain COL)
Q2G124 2.31e-149 431 54 3 393 3 SAOUHSC_00336 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ9 2.31e-149 431 54 3 393 3 SAUSA300_0355 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain USA300)
Q8CQN7 5.18e-149 430 53 3 393 3 SE_2384 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HS07 5.18e-149 430 53 3 393 3 SERP0032 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NY95 8.64e-149 429 54 3 393 3 MW0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MW2)
Q6GCB8 8.64e-149 429 54 3 393 3 SAS0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MSSA476)
Q7A7L2 1.76e-148 429 54 3 393 1 SA0342 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain N315)
Q99WM3 1.76e-148 429 54 3 393 3 SAV0354 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GJW4 3e-148 428 54 3 393 3 SAR0351 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MRSA252)
Q2YVF5 1.07e-146 424 53 3 393 3 SAB0304 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9BWD1 1.62e-143 416 53 2 393 1 ACAT2 Acetyl-CoA acetyltransferase, cytosolic Homo sapiens
Q8CAY6 1.8e-140 408 54 2 391 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Mus musculus
Q5XI22 5.95e-139 404 53 2 391 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Rattus norvegicus
Q0KBP1 6.79e-122 361 49 5 398 1 bktB Beta-ketothiolase BktB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3T0R7 2.9e-115 344 45 2 392 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Bos taurus
Q6L8K7 7.39e-115 343 48 3 388 3 PAT1 Acetyl-CoA acetyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
P42765 1.17e-113 340 45 4 396 1 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Homo sapiens
Q5RES5 2.7e-113 339 45 4 396 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Pongo abelii
Q8BWT1 7.82e-113 338 44 4 396 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Mus musculus
P45855 1.12e-112 337 46 2 392 1 mmgA Acetyl-CoA acetyltransferase Bacillus subtilis (strain 168)
P13437 4.85e-112 336 44 4 396 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Rattus norvegicus
Q9I6R0 1.09e-108 327 46 5 401 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q86AD9 1.37e-108 328 44 3 394 2 DDB_G0271544 Probable acetyl-CoA acetyltransferase Dictyostelium discoideum
P73825 1.69e-108 327 46 1 396 3 phaA Acetyl-CoA acetyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8VPF1 2.13e-107 324 46 4 399 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas knackmussii (strain DSM 6978 / CCUG 54928 / LMG 23759 / B13)
Q9FIK7 5.18e-107 324 45 5 396 1 ACCT1 Acetyl-CoA acetyltransferase 1 Arabidopsis thaliana
Q51956 5.42e-106 321 46 5 401 3 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas putida
Q9UQW6 8.04e-106 320 44 3 392 2 erg10 Acetyl-CoA acetyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6AZA0 2.95e-104 317 45 5 395 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Danio rerio
Q12598 2.01e-103 314 45 6 395 1 PACTA Acetyl-CoA acetyltransferase IA Candida tropicalis
P0C7L3 3.32e-103 313 44 6 401 3 paaJ Beta-ketoadipyl-CoA thiolase Escherichia coli
P0C7L2 3.59e-103 313 44 6 401 1 paaJ 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase Escherichia coli (strain K12)
Q04677 7.81e-103 313 45 6 395 1 PACTB Acetyl-CoA acetyltransferase IB Candida tropicalis
Q43974 2.75e-102 311 44 6 401 1 pcaF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P24752 2.76e-102 312 45 5 395 1 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Homo sapiens
Q8HXY6 1.3e-101 310 45 5 395 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Macaca fascicularis
I1RY81 3.54e-101 308 44 4 392 2 ERG10 Acetyl-CoA acetyltransferase ERG10, cytosolic Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1D8PH52 7.1e-101 308 44 5 394 2 ERG10 Acetyl-CoA acetyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q43935 9.12e-101 307 43 6 401 3 catF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q29RZ0 1.14e-100 308 46 5 395 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Bos taurus
P41338 2.45e-100 306 44 7 398 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0R1Y7 2.46e-100 306 44 2 389 1 MSMEG_4920 Probable acetyl-CoA acetyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A7MQM5 9.33e-100 304 44 8 401 3 fadA 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
Q4WCL5 1.07e-99 305 44 5 394 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0YA65 1.07e-99 305 44 5 394 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q8QZT1 4.05e-99 304 45 6 395 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Mus musculus
Q6NU46 6.94e-99 303 44 6 395 2 acat1-a Acetyl-CoA acetyltransferase A, mitochondrial Xenopus laevis
Q8S4Y1 9.69e-99 302 46 4 371 1 ACCT2 Acetyl-CoA acetyltransferase 2 Arabidopsis thaliana
I1RMA2 1.98e-98 302 44 5 397 3 FG05087 Acetyl-CoA acetyltransferase FG05087, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B6EGU1 5.09e-98 300 43 9 400 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio salmonicida (strain LFI1238)
O32177 5.64e-98 300 44 5 402 2 fadA 3-ketoacyl-CoA thiolase Bacillus subtilis (strain 168)
A1TZR8 7.55e-98 300 44 7 383 3 fadA 3-ketoacyl-CoA thiolase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q6GN02 7.92e-98 300 44 6 395 2 acat1-b Acetyl-CoA acetyltransferase B, mitochondrial Xenopus laevis
Q5BKN8 1.03e-96 298 44 7 396 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Xenopus tropicalis
Q5E8X7 5.48e-96 295 43 8 400 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FEW7 7.74e-96 294 43 8 400 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
A8G8D0 1.78e-95 293 44 8 401 3 fadA 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
Q66FR9 2.41e-95 293 45 9 406 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR28 2.41e-95 293 45 9 406 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CNA0 2.41e-95 293 45 9 406 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAM9 2.41e-95 293 45 9 406 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis
Q1C2C3 2.41e-95 293 45 9 406 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDF1 2.41e-95 293 45 9 406 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6LW07 6.33e-95 292 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
P17764 6.84e-95 293 44 6 395 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Rattus norvegicus
P10551 1.03e-94 291 44 7 401 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces pastorianus (strain ATCC 76670 / Carlsberg bottom yeast no.2 / CBS 1503 / CLIB 180 / NBRC 10610 / NRRL Y-1525)
Q2SD23 1.28e-94 291 42 8 400 3 fadA 3-ketoacyl-CoA thiolase Hahella chejuensis (strain KCTC 2396)
Q9F0Y6 1.79e-94 291 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Enterobacter cloacae
Q08A40 3.31e-94 290 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
Q5QXH8 3.77e-94 290 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q6DAP6 8.49e-94 289 44 8 402 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6TGM3 8.97e-94 289 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8ACZ3 9.64e-94 289 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q4WLA8 2.47e-93 289 43 5 397 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XMC1 2.47e-93 289 43 5 397 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A1JIG3 5.23e-93 287 43 8 403 3 fadA 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4STF3 6.22e-93 287 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
P0A2H7 6.71e-93 286 42 8 401 1 fadA 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2H8 6.71e-93 286 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Salmonella typhi
Q5PKQ3 6.71e-93 286 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1AI32 7.64e-93 286 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
Q0VNZ7 8.01e-93 286 41 8 400 3 fadA 3-ketoacyl-CoA thiolase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A0KEL0 9.38e-93 286 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7LTZ0 1.1e-92 286 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q22100 1.13e-92 287 41 5 393 1 kat-1 Acetyl-CoA acetyltransferase homolog, mitochondrial Caenorhabditis elegans
Q12TB5 1.19e-92 286 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3Q8U3 1.4e-92 286 43 8 400 3 fadA 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8X8J4 1.49e-92 286 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
P46707 1.89e-92 286 43 3 392 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium leprae (strain TN)
Q8DDK5 1.9e-92 285 43 8 400 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
A4Y1B5 2e-92 285 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WH99 2e-92 285 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
Q31UE3 2.48e-92 285 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
Q7MQI0 2.51e-92 285 43 8 400 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
Q1R467 3.36e-92 285 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q3YVC2 3.44e-92 285 43 8 401 3 fadA 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
A4WFX5 4.08e-92 285 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
A3CYJ3 4.31e-92 285 42 8 403 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
C6DI66 5.02e-92 285 43 8 403 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q32A20 7.17e-92 284 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
A7ZU50 7.4e-92 284 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
A0KR49 7.49e-92 284 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
Q57HM7 7.57e-92 284 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
A1RDW3 1.74e-91 283 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
Q0TAL1 1.92e-91 283 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A6V0 2.3e-91 283 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q8FBI3 2.54e-91 283 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1S1I7 3.79e-91 282 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8EKS0 3.83e-91 282 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HPB8 4.36e-91 282 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
P28790 6.25e-91 282 42 9 402 1 fadA 3-ketoacyl-CoA thiolase Pseudomonas fragi
Q7MZ91 8.42e-91 281 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0I0T4 8.71e-91 281 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q4FQC7 1.26e-90 281 41 7 402 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q83PG2 1.4e-90 281 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri
Q0SZ35 1.4e-90 281 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
Q8VCH0 1.43e-90 282 44 7 396 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Mus musculus
Q1Q8K0 1.47e-90 281 41 7 402 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P21151 1.76e-90 280 42 8 401 1 fadA 3-ketoacyl-CoA thiolase FadA Escherichia coli (strain K12)
P07871 1.87e-90 281 44 7 396 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Rattus norvegicus
P21775 8.4e-90 280 44 7 396 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Rattus norvegicus
Q21KB1 1.18e-89 278 42 9 400 3 fadA 3-ketoacyl-CoA thiolase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q87TP0 1.57e-89 278 41 8 398 3 fadA 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3IJ24 2.15e-89 278 41 8 403 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
Q489W4 9.41e-89 276 41 8 400 3 fadA 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9KNI0 1.45e-88 276 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F464 1.94e-88 275 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B2VFE0 2.77e-88 275 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P33291 2.96e-88 275 41 7 399 3 None 3-ketoacyl-CoA thiolase B, peroxisomal Candida tropicalis
Q6FF69 3.52e-88 275 41 7 401 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q87ZB3 3.71e-88 275 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B0VE46 3.72e-88 275 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AYE)
B0VLX5 3.72e-88 275 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain SDF)
B2I2J8 3.72e-88 275 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ACICU)
B7I3P0 3.72e-88 275 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB0057)
B7H1I1 3.72e-88 275 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB307-0294)
P09110 4.3e-88 276 43 6 396 1 ACAA1 3-ketoacyl-CoA thiolase, peroxisomal Homo sapiens
A6VVM8 5.97e-88 274 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Marinomonas sp. (strain MWYL1)
Q48GW4 6.57e-88 274 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZRA1 7.4e-88 274 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. syringae (strain B728a)
Q93Q11 8.61e-88 274 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas oleovorans
A3M1H9 9.51e-88 273 41 8 402 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q3K9D9 9.7e-88 273 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain Pf0-1)
A5W6G9 1.27e-87 273 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88L01 1.42e-87 273 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q921H8 1.55e-87 274 43 7 400 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Mus musculus
Q1QUW9 2.37e-87 273 43 9 401 3 fadA 3-ketoacyl-CoA thiolase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1I7D5 4.95e-87 272 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas entomophila (strain L48)
P9WG69 5.79e-87 271 43 4 393 1 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9R9W0 6.21e-87 271 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida
Q4KFC3 1.71e-86 270 40 9 402 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q02PH7 1.89e-86 270 40 8 401 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V383 1.89e-86 270 40 8 401 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain PA7)
Q9HZJ3 2.24e-86 270 40 8 401 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5WH98 2.35e-86 270 40 7 400 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter sp. (strain PRwf-1)
P9WG68 4.85e-86 269 43 4 389 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66927 4.85e-86 269 43 4 389 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A4VKA4 1.04e-85 268 41 8 399 3 fadA 3-ketoacyl-CoA thiolase Stutzerimonas stutzeri (strain A1501)
Q15ZF4 1.57e-85 268 40 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8LF48 6.58e-85 268 40 7 401 1 KAT1 3-ketoacyl-CoA thiolase 1, peroxisomal Arabidopsis thaliana
I6XHJ3 7.8e-85 266 41 9 409 1 fadA6 Steroid 3-ketoacyl-CoA thiolase FadA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A4XSM9 2.99e-83 262 40 8 399 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas mendocina (strain ymp)
C8YNG6 5.13e-83 264 40 9 407 1 KAT1 3-ketoacyl CoA thiolase 1, peroxisomal Petunia hybrida
Q56WD9 7.64e-83 263 40 10 406 1 PED1 3-ketoacyl-CoA thiolase 2, peroxisomal Arabidopsis thaliana
P33290 1.04e-81 259 41 7 399 3 None 3-ketoacyl-CoA thiolase A, peroxisomal Candida tropicalis
O53871 4.1e-80 254 39 7 416 1 fadA Putative acyltransferase Rv0859 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q570C8 9.97e-79 253 40 8 406 1 KAT5 3-ketoacyl-CoA thiolase 5, peroxisomal Arabidopsis thaliana
Q8SVA6 2.84e-78 249 39 9 394 1 FOX3 3-ketoacyl-CoA thiolase, peroxisomal Encephalitozoon cuniculi (strain GB-M1)
Q05493 8.91e-75 241 39 4 395 3 POT1 3-ketoacyl-CoA thiolase, peroxisomal Yarrowia lipolytica (strain CLIB 122 / E 150)
P27796 5.44e-71 231 38 8 398 1 POT1 3-ketoacyl-CoA thiolase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A4Y898 1.19e-70 231 36 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RI91 1.89e-70 230 36 12 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
A9KTW7 1.32e-69 228 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS195)
A3D685 1.32e-69 228 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE97 1.32e-69 228 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS223)
A6WQ26 1.95e-69 228 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
A0KK76 1.35e-68 226 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SMT9 1.69e-68 225 37 9 424 3 fadI 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
B7LLC9 3.6e-68 224 37 10 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
I6XHI4 1.16e-67 222 39 8 406 1 fadA5 Steroid 3-ketoacyl-CoA thiolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A4WCW7 8.36e-67 221 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
Q47ZB6 1.36e-66 220 36 11 428 3 fadI 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0TL22 2.35e-66 220 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Shewanella halifaxensis (strain HAW-EB4)
B8CPY7 4.95e-66 219 36 11 426 3 fadI 3-ketoacyl-CoA thiolase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q1R971 6.32e-66 219 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q0TFA5 6.32e-66 219 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADI9 6.32e-66 219 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
B7MGV8 6.32e-66 219 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q6LTK4 1.09e-65 218 37 8 425 3 fadI 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
A8A2L1 1.09e-65 218 37 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
B7NP25 1.6e-65 218 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P76503 1.83e-65 218 37 10 426 1 fadI 3-ketoacyl-CoA thiolase FadI Escherichia coli (strain K12)
B1X9L5 1.83e-65 218 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / DH10B)
C4ZVN3 1.83e-65 218 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LBJ6 1.91e-65 218 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain 55989 / EAEC)
B1LME8 2.87e-65 217 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SMS-3-5 / SECEC)
Q7A1P9 3.19e-65 215 34 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MW2)
Q7A768 3.19e-65 215 34 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain N315)
Q7A2W9 3.19e-65 215 34 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KWK4 3.19e-65 215 34 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8H5T2 3.22e-65 217 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B6I6Q5 3.47e-65 217 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SE11)
B7M6M3 3.47e-65 217 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O8 (strain IAI1)
A7ZPF9 3.47e-65 217 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IXA4 4.16e-65 216 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8GH87 4.53e-65 216 36 11 426 3 fadI 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
B7MY17 5.26e-65 216 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O81 (strain ED1a)
Q6GBR1 5.33e-65 214 34 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MSSA476)
B7UFZ9 6.04e-65 216 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TWV5 8.13e-65 216 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N5V3 8.86e-65 216 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5FGB5 1.06e-64 216 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
B1KKT1 1.21e-64 215 35 11 426 3 fadI 3-ketoacyl-CoA thiolase Shewanella woodyi (strain ATCC 51908 / MS32)
Q0T2E5 1.46e-64 215 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
Q7MIS4 2.61e-64 214 37 8 425 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
A1JK23 3.01e-64 214 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8FFG3 3.28e-64 214 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1JGG1 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668V0 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM83 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CHK1 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD46 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis
B2K8J6 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C659 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK0 3.57e-64 214 36 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9MJ36 4.01e-64 214 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ADP1 4.14e-64 214 37 11 426 3 fadI 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6GJ93 5.53e-64 212 33 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MRSA252)
Q5HIA0 5.89e-64 212 33 5 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain COL)
Q31YB6 7.43e-64 213 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
A7MH80 8.26e-64 213 38 12 426 3 fadI 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
B5YXY5 8.9e-64 213 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCN9 8.9e-64 213 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
B5BBA0 1e-63 213 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain AKU_12601)
Q5PCX7 1.04e-63 213 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TCA9 1.04e-63 213 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella heidelberg (strain SL476)
Q8Z4Y9 1.11e-63 213 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhi
Q8DB48 1.18e-63 213 37 8 425 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
C0PZX5 1.7e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi C (strain RKS4594)
Q3YZM1 1.74e-63 212 36 10 431 3 fadI 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
A9N452 1.83e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q83K95 1.87e-63 212 36 8 426 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri
Q8ZNA6 1.91e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TQC3 1.95e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella schwarzengrund (strain CVM19633)
Q57LW5 1.95e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
A3QFP4 2.04e-63 212 35 12 432 3 fadI 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B5R3S0 2.11e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella enteritidis PT4 (strain P125109)
B5FPN2 2.11e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella dublin (strain CT_02021853)
B5EZS0 2.11e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella agona (strain SL483)
B4SZR1 2.27e-63 212 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella newport (strain SL254)
Q07ZP7 2.37e-63 212 34 8 424 3 fadI 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
A9R7W9 2.6e-63 212 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Angola)
Q5E3U0 3.12e-63 212 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7N287 3.29e-63 211 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q32DJ3 3.98e-63 211 37 10 426 3 fadI 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
A8FTR6 1.12e-62 210 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella sediminis (strain HAW-EB3)
Q87MM2 1.24e-62 210 36 10 427 3 fadI 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3IEE3 3.33e-62 209 35 11 427 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
B4RTU9 3.55e-62 209 34 8 426 3 fadI 3-ketoacyl-CoA thiolase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q5HRH3 4.05e-62 207 36 7 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CTR0 4.18e-62 207 36 7 393 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6D2L6 5.99e-62 208 37 10 425 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5XVW1 9.94e-62 207 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae (strain 342)
C6DAL8 2.23e-61 207 37 10 425 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q5QXN5 4.12e-61 206 35 9 424 3 fadI 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q12P12 6.23e-61 206 34 9 426 3 fadI 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0HWN4 6.85e-61 206 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q0HKD2 6.85e-61 206 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A0KV75 6.85e-61 206 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
A6TC20 2.15e-60 204 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A1S7L7 3.58e-60 204 35 11 426 3 fadI 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8ECP6 3.98e-60 204 35 11 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O07618 2.56e-59 199 38 9 364 2 yhfS Putative acetyl-CoA C-acetyltransferase YhfS Bacillus subtilis (strain 168)
B2VJ10 1.62e-58 199 35 9 424 3 fadI 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P34255 2.01e-58 199 33 9 427 3 B0303.3 Probable 3-ketoacyl-CoA thiolase Caenorhabditis elegans
Q99JY0 1e-57 198 34 12 428 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Mus musculus
Q15VA3 1.31e-57 197 33 8 427 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
O46629 5.62e-57 196 33 10 425 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Bos taurus
Q60587 7.95e-57 196 34 10 426 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Rattus norvegicus
A5F2P1 1.03e-56 194 34 10 427 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KT59 1.19e-56 194 34 10 427 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P55084 1.54e-56 195 33 10 425 1 HADHB Trifunctional enzyme subunit beta, mitochondrial Homo sapiens
Q5R1W7 1.59e-56 195 33 10 425 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Pan troglodytes
Q8HXX4 4.75e-56 194 33 10 425 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Macaca fascicularis
Q4L3Q1 4.88e-56 191 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus haemolyticus (strain JCSC1435)
P45362 4.11e-24 99 53 0 94 3 thi Acetyl-CoA acetyltransferase (Fragment) Clostridioides difficile
O62742 1.03e-09 63 25 15 364 1 SCP2 Sterol carrier protein 2 Oryctolagus cuniculus
G5EDP2 1.1e-07 57 23 17 386 1 daf-22 Non-specific lipid-transfer protein-like 2 Caenorhabditis elegans
P32020 1.65e-06 53 23 13 374 1 Scp2 Sterol carrier protein 2 Mus musculus
P22307 1.18e-05 50 25 14 363 1 SCP2 Sterol carrier protein 2 Homo sapiens
P11915 1.33e-05 50 24 15 366 1 Scp2 Sterol carrier protein 2 Rattus norvegicus
O26884 0.000195 47 25 13 301 4 MTH_793 Uncharacterized protein MTH_793 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P07857 0.000216 47 31 1 92 1 SCP2 Sterol carrier protein 2 Bos taurus
Q07598 0.0009 45 23 12 338 2 SCP2 Sterol carrier protein 2 (Fragment) Gallus gallus

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_10610
Feature type CDS
Gene paaJ
Product Acetyl-CoA acetyltransferase
Location 83454 - 84635 (strand: 1)
Length 1182 (nucleotides) / 393 (amino acids)

Contig

Accession contig_12
Length 141735 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2849
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00108 Thiolase, N-terminal domain
PF02803 Thiolase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0183 Lipid transport and metabolism (I) I Acetyl-CoA acetyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00626 acetyl-CoA C-acetyltransferase [EC:2.3.1.9] Fatty acid degradation
Valine, leucine and isoleucine degradation
Lysine degradation
Benzoate degradation
Tryptophan metabolism
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Butanoate metabolism
Carbon fixation pathways in prokaryotes
Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Fatty acid metabolism
Two-component system
Fat digestion and absorption
Ketone body biosynthesis, acetyl-CoA => acetoacetate/3-hydroxybutyrate/acetone
C5 isoprenoid biosynthesis, mevalonate pathway
Ethylmalonyl pathway
Dicarboxylate-hydroxybutyrate cycle
Hydroxypropionate-hydroxybutylate cycle
C5 isoprenoid biosynthesis, mevalonate pathway, archaea
Lysine degradation, bacteria, L-lysine => glutarate => succinate/acetyl-CoA

Protein Sequence

MENIVIVSAVRTAIGNFNGALAGVSAVELGSAVVSALLKKTQLEPGLVDEVIMGNVLQAGLGQNPARQILLRSGIPESACAFTVNKVCGSGLKSVALGAQAISSGDADIIIAGGTENMSQAPYLLDSRARWGYRLGDGAVHDVILRDGLLCAENNYHMGITAENIAKAYNLTREEQDALALSSQQKAVSAIERGAFKAEIVPVTVKSRKGDIVVDTDEFPKAGSTAEGLAKLRPAFDKAGTVTAGNASGINDGAAALMLMTETRAKSLGLTPLARIRGYASGGVSPSMMGLGPVPATRKVLEKTGLSLKDIDLIEANEAFASQFLAVGRDLGFDPDKVNINGGAIALGHPIGASGARILVTLLHALQAQNKTTGLATLCIGGGQGIAMVIERL

Flanking regions ( +/- flanking 50bp)

TTATCGGCCTCGCTTTCTTCTGACAGATACTAAACAGTAAGGATTTCGCAATGGAAAATATCGTTATTGTCAGTGCCGTGCGTACCGCAATCGGCAACTTTAACGGCGCACTGGCGGGTGTCAGTGCCGTGGAACTCGGCTCGGCAGTGGTCAGCGCGTTACTGAAAAAAACGCAGCTGGAACCGGGGCTGGTGGATGAAGTGATTATGGGGAACGTGCTACAGGCCGGACTCGGACAGAACCCTGCGCGCCAGATCCTGCTGCGCAGCGGTATACCGGAAAGCGCCTGTGCTTTCACCGTCAATAAAGTGTGCGGCTCCGGCCTGAAGAGTGTTGCGCTGGGCGCACAGGCGATCAGCAGCGGTGACGCGGACATTATTATCGCGGGCGGCACGGAAAATATGAGTCAGGCGCCGTATCTGCTCGACAGCCGTGCCCGCTGGGGTTACCGCCTGGGCGACGGTGCAGTGCATGATGTGATTCTGCGTGACGGGCTGTTATGTGCCGAGAATAACTATCACATGGGGATCACAGCGGAGAACATCGCCAAAGCCTATAACCTGACCCGCGAAGAGCAGGATGCACTGGCACTGTCATCACAGCAGAAAGCCGTCAGCGCGATTGAGCGCGGCGCCTTTAAGGCTGAAATCGTGCCGGTGACGGTGAAAAGCCGTAAAGGGGATATCGTGGTGGATACCGATGAATTCCCGAAAGCCGGATCAACGGCAGAAGGGCTGGCGAAACTGCGCCCGGCCTTTGATAAAGCGGGAACGGTGACTGCCGGTAATGCCTCCGGTATCAATGACGGTGCGGCAGCTCTGATGCTGATGACGGAAACCCGTGCTAAATCACTGGGACTGACACCGCTTGCCCGCATCCGGGGTTATGCCTCCGGCGGGGTTTCACCGTCGATGATGGGGCTGGGGCCGGTTCCGGCCACGCGGAAAGTGCTGGAGAAAACGGGGCTGTCACTGAAGGATATCGATCTTATCGAAGCCAACGAAGCATTTGCCTCCCAATTTCTCGCGGTCGGCCGTGACCTGGGTTTTGATCCTGACAAAGTAAACATCAACGGCGGGGCGATTGCCCTGGGTCACCCGATTGGTGCGAGTGGTGCCCGTATCCTGGTGACACTGCTGCATGCATTACAGGCTCAGAATAAAACCACCGGTCTGGCGACACTCTGTATCGGTGGCGGGCAGGGGATCGCGATGGTGATTGAACGTCTGTAATCCGGTGAAATAACAGGCGGATATTCAGCCGGTGGCAGGGTAACTGTCAC