Homologs in group_2849

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10610 FBDBKF_10610 84.0 Morganella morganii S1 paaJ Acetyl-CoA acetyltransferase
EHELCC_14945 EHELCC_14945 84.0 Morganella morganii S2 paaJ Acetyl-CoA acetyltransferase
NLDBIP_14775 NLDBIP_14775 84.0 Morganella morganii S4 paaJ Acetyl-CoA acetyltransferase
LHKJJB_14570 LHKJJB_14570 84.0 Morganella morganii S3 paaJ Acetyl-CoA acetyltransferase
HKOGLL_13190 HKOGLL_13190 84.0 Morganella morganii S5 paaJ Acetyl-CoA acetyltransferase

Distribution of the homologs in the orthogroup group_2849

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2849

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76461 0.0 539 69 0 393 1 atoB Acetyl-CoA acetyltransferase Escherichia coli (strain K12)
P44873 0.0 528 64 0 393 3 atoB Acetyl-CoA acetyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45359 1.28e-166 474 58 1 392 1 thlA Acetyl-CoA acetyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P45363 2.89e-163 466 58 2 393 3 phaA Acetyl-CoA acetyltransferase Thiocystis violacea
P45369 3.25e-163 466 58 3 395 3 phaA Acetyl-CoA acetyltransferase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q9I2A8 7.41e-161 460 59 2 393 1 atoB Acetyl-CoA acetyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P50174 1.56e-159 457 57 1 391 3 phaA Acetyl-CoA acetyltransferase Rhizobium meliloti (strain 1021)
P07097 3.87e-157 451 56 1 389 1 phaA Acetyl-CoA acetyltransferase Shinella zoogloeoides
Q46939 8.99e-157 449 58 1 392 3 yqeF Probable acetyl-CoA acetyltransferase Escherichia coli (strain K12)
Q18AR0 5.37e-156 447 56 1 392 1 thlA Acetyl-CoA acetyltransferase Clostridioides difficile (strain 630)
Q0AVM3 6.33e-154 442 56 4 395 1 Swol_1934 Acetyl-CoA acetyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P54810 3.9e-149 430 53 1 392 3 phaA Acetyl-CoA acetyltransferase Paracoccus denitrificans
Q9ZHI1 5.85e-148 427 57 2 391 3 phaA Acetyl-CoA acetyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8CQN7 5.37e-145 420 52 3 395 3 SE_2384 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HS07 5.37e-145 420 52 3 395 3 SERP0032 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9BWD1 1.18e-144 419 52 2 393 1 ACAT2 Acetyl-CoA acetyltransferase, cytosolic Homo sapiens
P14611 1.38e-143 416 54 2 393 1 phaA Acetyl-CoA acetyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5HIU0 1.42e-143 416 53 3 395 3 SACOL0426 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain COL)
Q6GJW4 7.43e-143 414 53 3 395 3 SAR0351 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MRSA252)
Q7A7L2 7.59e-143 414 53 3 395 1 SA0342 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain N315)
Q99WM3 7.59e-143 414 53 3 395 3 SAV0354 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2G124 8.02e-143 414 53 3 395 3 SAOUHSC_00336 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ9 8.02e-143 414 53 3 395 3 SAUSA300_0355 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain USA300)
Q8NY95 1.31e-142 414 53 3 395 3 MW0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MW2)
Q6GCB8 1.31e-142 414 53 3 395 3 SAS0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MSSA476)
Q2YVF5 4.3e-142 412 53 3 395 3 SAB0304 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CAY6 2.5e-140 408 52 2 393 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Mus musculus
Q5XI22 2.26e-139 405 52 2 391 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Rattus norvegicus
Q0KBP1 6.11e-119 353 49 4 394 1 bktB Beta-ketothiolase BktB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6L8K7 4.97e-113 338 47 3 393 3 PAT1 Acetyl-CoA acetyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q3T0R7 6.81e-112 335 43 2 392 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Bos taurus
P13437 7.19e-110 330 43 3 396 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Rattus norvegicus
Q8VPF1 3.65e-109 329 47 6 400 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas knackmussii (strain DSM 6978 / CCUG 54928 / LMG 23759 / B13)
P42765 6.51e-109 328 43 3 396 1 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Homo sapiens
Q8BWT1 6.73e-109 328 42 3 396 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Mus musculus
Q5RES5 2.73e-108 327 43 3 396 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Pongo abelii
Q9I6R0 3.89e-108 326 47 7 403 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45855 1.17e-107 325 45 2 392 1 mmgA Acetyl-CoA acetyltransferase Bacillus subtilis (strain 168)
Q51956 8.38e-106 320 47 6 401 3 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas putida
Q86AD9 1.48e-103 315 43 3 394 2 DDB_G0271544 Probable acetyl-CoA acetyltransferase Dictyostelium discoideum
Q9UQW6 3.62e-103 313 43 4 392 2 erg10 Acetyl-CoA acetyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9FIK7 6.06e-103 313 44 5 396 1 ACCT1 Acetyl-CoA acetyltransferase 1 Arabidopsis thaliana
Q12598 3.53e-102 311 44 6 395 1 PACTA Acetyl-CoA acetyltransferase IA Candida tropicalis
P0C7L2 3.77e-102 311 45 5 401 1 paaJ 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase Escherichia coli (strain K12)
Q04677 4.99e-102 311 44 6 395 1 PACTB Acetyl-CoA acetyltransferase IB Candida tropicalis
P0C7L3 1.43e-101 309 44 5 401 3 paaJ Beta-ketoadipyl-CoA thiolase Escherichia coli
P41338 1.87e-100 306 44 7 397 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q43974 9.58e-100 305 43 5 401 1 pcaF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P73825 1.95e-99 304 43 1 396 3 phaA Acetyl-CoA acetyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6AZA0 8.82e-99 303 43 5 395 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Danio rerio
Q43935 2.78e-98 301 43 5 401 3 catF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A0A1D8PH52 3.72e-98 301 43 5 394 2 ERG10 Acetyl-CoA acetyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
I1RY81 6.74e-98 300 42 4 393 2 ERG10 Acetyl-CoA acetyltransferase ERG10, cytosolic Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8S4Y1 6.83e-97 297 45 4 371 1 ACCT2 Acetyl-CoA acetyltransferase 2 Arabidopsis thaliana
A0R1Y7 2.98e-96 295 42 2 389 1 MSMEG_4920 Probable acetyl-CoA acetyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4WCL5 9.46e-96 294 43 5 394 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0YA65 9.46e-96 294 43 5 394 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
P10551 1.29e-95 294 44 7 397 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces pastorianus (strain ATCC 76670 / Carlsberg bottom yeast no.2 / CBS 1503 / CLIB 180 / NBRC 10610 / NRRL Y-1525)
B6EGU1 4.2e-95 292 43 9 400 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio salmonicida (strain LFI1238)
Q8QZT1 7.15e-95 293 43 5 395 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Mus musculus
Q29RZ0 1.39e-94 292 43 5 395 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Bos taurus
P24752 2.48e-94 292 42 5 395 1 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Homo sapiens
O32177 2.83e-94 290 43 5 402 2 fadA 3-ketoacyl-CoA thiolase Bacillus subtilis (strain 168)
A7MQM5 3.18e-94 290 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
Q6NU46 5.56e-94 291 42 5 395 2 acat1-a Acetyl-CoA acetyltransferase A, mitochondrial Xenopus laevis
Q8HXY6 8.61e-94 290 42 6 396 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Macaca fascicularis
Q6LW07 1.51e-93 288 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
P17764 9.14e-93 288 43 5 395 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Rattus norvegicus
Q6GN02 1.25e-92 287 41 5 395 2 acat1-b Acetyl-CoA acetyltransferase B, mitochondrial Xenopus laevis
I1RMA2 2.04e-92 287 42 5 398 3 FG05087 Acetyl-CoA acetyltransferase FG05087, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q5QXH8 2.33e-92 285 42 9 401 3 fadA 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5E8X7 3.09e-92 285 42 8 400 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KEL0 3.63e-92 285 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1TZR8 3.8e-92 285 43 7 383 3 fadA 3-ketoacyl-CoA thiolase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B5FEW7 4.5e-92 285 42 8 400 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
A4STF3 5.72e-92 284 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
Q5BKN8 1.03e-91 285 41 6 396 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Xenopus tropicalis
Q2SD23 1.12e-91 284 41 9 401 3 fadA 3-ketoacyl-CoA thiolase Hahella chejuensis (strain KCTC 2396)
A8ACZ3 1.37e-91 283 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9F0Y6 1.74e-91 283 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Enterobacter cloacae
A6TGM3 3.05e-91 282 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q4WLA8 1.55e-90 282 42 5 392 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XMC1 1.55e-90 282 42 5 392 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
P0A2H7 6.04e-90 279 41 9 403 1 fadA 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2H8 6.04e-90 279 41 9 403 3 fadA 3-ketoacyl-CoA thiolase Salmonella typhi
Q5PKQ3 6.04e-90 279 41 9 403 3 fadA 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7LTZ0 8.26e-90 279 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8VCH0 8.3e-90 280 43 6 397 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Mus musculus
Q22100 8.51e-90 280 40 4 389 1 kat-1 Acetyl-CoA acetyltransferase homolog, mitochondrial Caenorhabditis elegans
A1AI32 8.81e-90 279 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
Q8X8J4 1.19e-89 278 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
Q8DDK5 1.23e-89 278 42 8 400 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
Q7MQI0 1.63e-89 278 42 8 400 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
P07871 1.66e-89 279 42 6 397 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Rattus norvegicus
A7ZU50 1.88e-89 278 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31UE3 2.54e-89 278 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
Q1R467 3.91e-89 277 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
P21775 4.82e-89 278 42 6 397 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Rattus norvegicus
Q3YVC2 5.13e-89 277 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
Q32A20 5.47e-89 276 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
Q08A40 6.16e-89 276 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
Q57HM7 7.02e-89 276 41 9 403 3 fadA 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
A8G8D0 8.43e-89 276 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
A4WFX5 1.04e-88 276 41 9 403 3 fadA 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
A8A6V0 1.17e-88 276 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q0TAL1 1.9e-88 275 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FBI3 2.38e-88 275 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q87TP0 4.27e-88 275 41 8 398 3 fadA 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q83PG2 6.09e-88 274 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri
Q0SZ35 6.09e-88 274 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
P09110 8.58e-88 275 42 6 396 1 ACAA1 3-ketoacyl-CoA thiolase, peroxisomal Homo sapiens
P21151 9.28e-88 273 42 9 403 1 fadA 3-ketoacyl-CoA thiolase FadA Escherichia coli (strain K12)
A3Q8U3 1.24e-87 273 41 8 400 3 fadA 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12TB5 1.52e-87 273 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0VNZ7 1.92e-87 273 40 8 399 3 fadA 3-ketoacyl-CoA thiolase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q6DAP6 4.03e-87 272 42 8 400 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3IJ24 6.45e-87 271 40 8 404 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
P46707 9.62e-87 271 41 3 392 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium leprae (strain TN)
Q66FR9 1.11e-86 271 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR28 1.11e-86 271 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CNA0 1.11e-86 271 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAM9 1.11e-86 271 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis
Q1C2C3 1.11e-86 271 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDF1 1.11e-86 271 42 9 404 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6DI66 1.11e-86 271 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q0I0T4 1.28e-86 271 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
A4Y1B5 2.64e-86 270 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WH99 2.64e-86 270 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
Q921H8 2.73e-86 271 42 6 401 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Mus musculus
A3CYJ3 5.43e-86 269 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1JIG3 5.8e-86 269 42 9 403 3 fadA 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1S1I7 5.86e-86 269 42 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8EKS0 6.53e-86 269 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HPB8 7.04e-86 269 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
P28790 8.29e-86 269 41 9 399 1 fadA 3-ketoacyl-CoA thiolase Pseudomonas fragi
A1RDW3 1.58e-85 268 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
B2VFE0 1.98e-85 268 41 9 403 3 fadA 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9KNI0 2.16e-85 267 40 8 400 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0KR49 2.21e-85 267 40 8 401 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
Q4FQC7 2.64e-85 267 40 7 397 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P33291 2.76e-85 268 40 7 397 3 None 3-ketoacyl-CoA thiolase B, peroxisomal Candida tropicalis
P9WG69 3.11e-85 267 42 4 394 1 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7MZ91 3.18e-85 267 41 9 403 3 fadA 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A5F464 3.55e-85 267 40 8 400 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VVM8 5.42e-85 266 40 9 402 3 fadA 3-ketoacyl-CoA thiolase Marinomonas sp. (strain MWYL1)
Q15ZF4 1.08e-84 266 39 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q489W4 1.15e-84 266 40 8 400 3 fadA 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P9WG68 4.23e-84 264 42 4 390 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66927 4.23e-84 264 42 4 390 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1Q8K0 5.06e-84 264 39 7 401 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8LF48 3.96e-83 263 40 8 405 1 KAT1 3-ketoacyl-CoA thiolase 1, peroxisomal Arabidopsis thaliana
Q93Q11 9.79e-83 261 40 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas oleovorans
A4VKA4 1.49e-82 260 41 8 401 3 fadA 3-ketoacyl-CoA thiolase Stutzerimonas stutzeri (strain A1501)
A5W6G9 2.08e-82 260 40 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3K9D9 2.27e-82 260 40 9 399 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain Pf0-1)
Q88L01 2.42e-82 259 40 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87ZB3 4.15e-82 259 40 10 401 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1I7D5 4.43e-82 259 40 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas entomophila (strain L48)
B0VE46 6.14e-82 259 39 8 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AYE)
B0VLX5 6.14e-82 259 39 8 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain SDF)
B2I2J8 6.14e-82 259 39 8 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ACICU)
B7I3P0 6.14e-82 259 39 8 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB0057)
B7H1I1 6.14e-82 259 39 8 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB307-0294)
Q9R9W0 6.89e-82 258 40 10 403 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida
Q48GW4 1.06e-81 258 39 10 401 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6FF69 1.09e-81 258 40 7 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4ZRA1 1.45e-81 258 39 10 401 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. syringae (strain B728a)
Q21KB1 1.53e-81 258 39 8 399 3 fadA 3-ketoacyl-CoA thiolase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A3M1H9 1.6e-81 258 39 8 397 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q1QUW9 1.95e-81 258 41 9 402 3 fadA 3-ketoacyl-CoA thiolase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q4KFC3 3.66e-81 257 39 9 399 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C8YNG6 4.14e-81 259 40 7 401 1 KAT1 3-ketoacyl CoA thiolase 1, peroxisomal Petunia hybrida
A4XSM9 6.76e-81 256 40 8 397 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas mendocina (strain ymp)
Q56WD9 1.58e-80 257 39 6 401 1 PED1 3-ketoacyl-CoA thiolase 2, peroxisomal Arabidopsis thaliana
Q9HZJ3 5.23e-80 254 39 8 399 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PH7 6.02e-80 253 39 8 399 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V383 6.02e-80 253 39 8 399 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain PA7)
A5WH98 3.34e-79 251 38 7 397 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter sp. (strain PRwf-1)
P33290 3.88e-78 249 40 7 397 3 None 3-ketoacyl-CoA thiolase A, peroxisomal Candida tropicalis
I6XHJ3 2.72e-77 247 39 9 400 1 fadA6 Steroid 3-ketoacyl-CoA thiolase FadA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q570C8 8.56e-75 242 38 8 406 1 KAT5 3-ketoacyl-CoA thiolase 5, peroxisomal Arabidopsis thaliana
Q8SVA6 7.28e-72 233 36 7 393 1 FOX3 3-ketoacyl-CoA thiolase, peroxisomal Encephalitozoon cuniculi (strain GB-M1)
O53871 8.55e-72 233 37 7 412 1 fadA Putative acyltransferase Rv0859 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q05493 9.93e-71 231 39 6 397 3 POT1 3-ketoacyl-CoA thiolase, peroxisomal Yarrowia lipolytica (strain CLIB 122 / E 150)
P27796 1.57e-68 225 37 6 394 1 POT1 3-ketoacyl-CoA thiolase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A4SMT9 5.24e-65 216 35 7 424 3 fadI 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
A4Y898 5.96e-65 216 34 7 422 3 fadI 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RI91 7.37e-65 216 34 7 422 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
A0KK76 9.82e-65 216 34 7 424 3 fadI 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4WCW7 4.64e-64 214 36 9 426 3 fadI 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
A9KTW7 6.81e-64 213 34 10 425 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS195)
A3D685 6.81e-64 213 34 10 425 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE97 6.81e-64 213 34 10 425 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS223)
A6WQ26 1.22e-63 213 34 10 425 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
Q47ZB6 3.75e-63 211 35 7 425 3 fadI 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A8A2L1 4.19e-63 211 35 6 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
B7NP25 1.19e-62 210 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P76503 1.26e-62 210 36 8 424 1 fadI 3-ketoacyl-CoA thiolase FadI Escherichia coli (strain K12)
B1X9L5 1.26e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / DH10B)
C4ZVN3 1.26e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R971 1.35e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q0TFA5 1.35e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADI9 1.35e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
B7MGV8 1.35e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O45:K1 (strain S88 / ExPEC)
B6I6Q5 1.42e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SE11)
B7M6M3 1.42e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O8 (strain IAI1)
A7ZPF9 1.42e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IXA4 1.56e-62 210 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7LBJ6 1.85e-62 209 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain 55989 / EAEC)
B1LME8 2.36e-62 209 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SMS-3-5 / SECEC)
B2TWV5 3.08e-62 209 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YXY5 3.62e-62 209 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCN9 3.62e-62 209 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
I6XHI4 4.22e-62 207 36 7 409 1 fadA5 Steroid 3-ketoacyl-CoA thiolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B7UFZ9 5.89e-62 208 36 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N5V3 6.35e-62 208 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3YZM1 7.85e-62 208 35 7 424 3 fadI 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
Q0T2E5 9.4e-62 208 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
B7MY17 1.32e-61 207 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O81 (strain ED1a)
Q8FFG3 3.05e-61 206 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7MIS4 3.49e-61 206 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
Q31YB6 4.06e-61 206 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
Q5HRH3 4.78e-61 204 34 5 373 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CTR0 4.99e-61 204 34 5 373 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B5FGB5 5.01e-61 206 35 7 424 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
Q5E3U0 6.12e-61 206 35 7 424 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7LLC9 7.59e-61 205 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q83K95 9.59e-61 205 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri
Q8DB48 1.69e-60 204 36 7 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
B1JGG1 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668V0 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM83 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CHK1 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD46 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis
B2K8J6 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C659 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK0 2.31e-60 204 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7A1P9 2.43e-60 202 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MW2)
Q7A768 2.43e-60 202 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain N315)
Q7A2W9 2.43e-60 202 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KWK4 2.43e-60 202 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8ADP1 2.89e-60 204 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q87MM2 3.1e-60 204 34 7 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6GBR1 5.64e-60 201 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MSSA476)
Q32DJ3 6.52e-60 203 35 8 424 3 fadI 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
Q3IEE3 1.3e-59 202 34 11 428 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
Q6GJ93 1.36e-59 201 34 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MRSA252)
Q7N287 1.44e-59 202 34 8 424 3 fadI 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6LTK4 1.51e-59 202 34 7 424 3 fadI 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
A9R7W9 1.61e-59 202 35 7 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Angola)
B0TL22 2.61e-59 201 34 7 422 3 fadI 3-ketoacyl-CoA thiolase Shewanella halifaxensis (strain HAW-EB4)
B8CPY7 3.06e-59 201 33 6 422 3 fadI 3-ketoacyl-CoA thiolase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q57LW5 4.16e-59 201 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
A1JK23 5.03e-59 201 36 10 397 3 fadI 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5BBA0 5.09e-59 201 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain AKU_12601)
Q5PCX7 5.25e-59 201 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TCA9 5.25e-59 201 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella heidelberg (strain SL476)
Q8Z4Y9 5.31e-59 201 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhi
Q5HIA0 5.79e-59 199 33 7 394 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain COL)
B5XVW1 7.29e-59 200 35 9 424 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae (strain 342)
P34255 7.35e-59 201 33 10 426 3 B0303.3 Probable 3-ketoacyl-CoA thiolase Caenorhabditis elegans
A9N452 7.85e-59 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8ZNA6 8.37e-59 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PZX5 8.55e-59 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi C (strain RKS4594)
B4SZR1 8.55e-59 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella newport (strain SL254)
B4TQC3 9.7e-59 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella schwarzengrund (strain CVM19633)
B1KKT1 1.07e-58 200 33 8 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella woodyi (strain ATCC 51908 / MS32)
B5R3S0 1.08e-58 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella enteritidis PT4 (strain P125109)
B5FPN2 1.08e-58 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella dublin (strain CT_02021853)
B5EZS0 1.08e-58 200 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella agona (strain SL483)
A6TC20 1.08e-58 200 35 9 424 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8H5T2 1.36e-58 199 34 9 424 3 fadI 3-ketoacyl-CoA thiolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q07ZP7 1.85e-58 199 33 6 422 3 fadI 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
A8GH87 3.21e-58 199 33 9 424 3 fadI 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
A9MJ36 6.51e-58 198 34 6 424 3 fadI 3-ketoacyl-CoA thiolase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A3QFP4 1.74e-57 197 33 7 424 3 fadI 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A7MH80 2.52e-57 196 34 10 424 3 fadI 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
A8FTR6 6.79e-57 195 32 6 424 3 fadI 3-ketoacyl-CoA thiolase Shewanella sediminis (strain HAW-EB3)
P55084 2.29e-56 195 32 11 425 1 HADHB Trifunctional enzyme subunit beta, mitochondrial Homo sapiens
Q99JY0 2.74e-56 194 33 11 425 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Mus musculus
Q5R1W7 2.85e-56 194 32 11 425 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Pan troglodytes
O46629 3.91e-56 194 32 11 425 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Bos taurus
A1S7L7 5.97e-56 192 33 10 425 3 fadI 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A5F2P1 8.18e-56 192 33 8 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q12P12 8.37e-56 192 33 6 422 3 fadI 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8HXX4 1.27e-55 193 32 11 425 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Macaca fascicularis
B4RTU9 1.63e-55 191 32 7 424 3 fadI 3-ketoacyl-CoA thiolase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q0HWN4 1.95e-55 191 33 10 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q0HKD2 1.95e-55 191 33 10 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A0KV75 1.95e-55 191 33 10 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
O07618 2.63e-55 189 37 9 364 2 yhfS Putative acetyl-CoA C-acetyltransferase YhfS Bacillus subtilis (strain 168)
Q6D2L6 3.13e-55 191 35 10 401 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q60587 3.44e-55 192 32 10 426 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Rattus norvegicus
C6DAL8 6.76e-55 190 35 10 401 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q4L3Q1 7.01e-55 188 34 7 396 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus haemolyticus (strain JCSC1435)
Q9KT59 8.14e-55 189 33 8 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8ECP6 8.51e-55 189 32 8 425 3 fadI 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B2VJ10 7.77e-54 187 32 9 397 3 fadI 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q5QXN5 7.6e-53 184 33 7 424 3 fadI 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q15VA3 1.26e-52 184 32 7 422 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P45362 3.46e-23 96 50 0 94 3 thi Acetyl-CoA acetyltransferase (Fragment) Clostridioides difficile
O62742 7.17e-10 64 25 9 316 1 SCP2 Sterol carrier protein 2 Oryctolagus cuniculus
O26884 1.59e-07 56 24 14 388 4 MTH_793 Uncharacterized protein MTH_793 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P11915 1.63e-07 57 24 9 319 1 Scp2 Sterol carrier protein 2 Rattus norvegicus
P32020 1.92e-06 53 24 10 321 1 Scp2 Sterol carrier protein 2 Mus musculus
P07857 5.36e-06 52 34 1 92 1 SCP2 Sterol carrier protein 2 Bos taurus
G5EDP2 3.2e-05 49 24 14 330 1 daf-22 Non-specific lipid-transfer protein-like 2 Caenorhabditis elegans
P22307 4.01e-05 49 32 1 92 1 SCP2 Sterol carrier protein 2 Homo sapiens
Q07598 0.000243 47 28 5 160 2 SCP2 Sterol carrier protein 2 (Fragment) Gallus gallus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14320
Feature type CDS
Gene -
Product acetyl-CoA C-acetyltransferase
Location 85998 - 87182 (strand: 1)
Length 1185 (nucleotides) / 394 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2849
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00108 Thiolase, N-terminal domain
PF02803 Thiolase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0183 Lipid transport and metabolism (I) I Acetyl-CoA acetyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00626 acetyl-CoA C-acetyltransferase [EC:2.3.1.9] Fatty acid degradation
Valine, leucine and isoleucine degradation
Lysine degradation
Benzoate degradation
Tryptophan metabolism
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Butanoate metabolism
Carbon fixation pathways in prokaryotes
Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Fatty acid metabolism
Two-component system
Fat digestion and absorption		 Ketone body biosynthesis, acetyl-CoA => acetoacetate/3-hydroxybutyrate/acetone
C5 isoprenoid biosynthesis, mevalonate pathway
Ethylmalonyl pathway
Dicarboxylate-hydroxybutyrate cycle
Hydroxypropionate-hydroxybutylate cycle
C5 isoprenoid biosynthesis, mevalonate pathway, archaea
Lysine degradation, bacteria, L-lysine => glutarate => succinate/acetyl-CoA

Protein Sequence

MNNIVIVGALRTAIGSFNGALADVSAVELGTTVVGALLRKTELEPGLVDEVIMGNVLQAGTGQNPARQIQINSGIPDEVCSYTVNKLCGSGLKSVALGVQAISNGDADIIIAGGTENMSQAPYLLDSRARKGLRLGDGVVQDSLLKDGLMCSIHGYHMGVTAENIAKAYHLSREDQDAIALASQLKAESAITRGAFKAEIVPVTIKGRKGDVIVDTDEFPKAGSTAEGLMKLRPAFDNEGTVTAGNASGINDGAAALMLMTENRAKSLGLVPLARVRGYASGGVAPALMGLGPVPATRKVLEKTGLSLSDIDLIEANEAFAAQFLAVGRELGFDPEKVNINGGAIALGHPIGASGARVLVTLLHALQAQNKTLGLATLCIGGGQGISMVIERLQ

Flanking regions ( +/- flanking 50bp)

TTTATCATTGGTCTTGTTTTTCTTTAATAACAAAAGGATAAGGAAAGAAAATGAATAATATCGTTATTGTCGGCGCATTACGTACCGCTATCGGCAGTTTTAATGGCGCTCTGGCGGATGTCAGTGCTGTGGAACTCGGCACCACCGTTGTGGGTGCATTACTGAGAAAAACAGAGCTTGAGCCGGGTCTTGTTGATGAAGTCATTATGGGCAATGTGCTACAGGCAGGCACAGGGCAGAATCCTGCGCGGCAGATACAGATAAACAGCGGCATTCCGGATGAAGTATGTTCTTATACCGTTAATAAACTGTGTGGTTCCGGGCTTAAAAGTGTCGCCCTGGGTGTTCAGGCTATCAGTAACGGGGATGCGGATATCATTATTGCCGGCGGAACGGAAAATATGAGTCAGGCACCTTACCTTCTGGACAGCCGCGCGCGTAAAGGCTTACGTCTGGGCGACGGCGTGGTTCAGGATTCATTGCTGAAAGATGGTTTGATGTGTTCCATCCATGGCTATCACATGGGGGTTACCGCAGAAAACATAGCAAAAGCGTATCATCTCAGCCGTGAAGATCAGGATGCCATTGCGCTGGCATCCCAATTGAAAGCGGAAAGCGCTATTACACGCGGTGCATTCAAAGCAGAGATTGTGCCGGTCACAATTAAAGGCCGTAAAGGTGATGTGATTGTCGATACCGATGAATTCCCGAAAGCCGGTTCAACGGCGGAAGGGCTGATGAAATTACGTCCGGCATTTGATAACGAAGGAACCGTGACAGCCGGTAATGCATCCGGTATCAATGACGGTGCTGCGGCACTGATGCTGATGACAGAAAACCGGGCTAAATCTCTCGGGTTAGTTCCGCTTGCCAGGGTTCGTGGCTATGCATCCGGTGGTGTTGCACCGGCACTGATGGGACTGGGTCCGGTACCGGCAACGCGGAAAGTTCTGGAAAAAACAGGTTTGTCGCTCAGTGATATTGATTTGATTGAAGCGAATGAGGCCTTTGCTGCGCAGTTCCTTGCTGTCGGACGCGAGCTTGGTTTTGATCCGGAGAAAGTGAATATTAACGGCGGTGCTATTGCGTTGGGTCATCCAATCGGGGCAAGTGGTGCCCGGGTTCTGGTCACGCTGCTGCATGCATTACAGGCTCAGAATAAGACGCTGGGGCTGGCGACGCTGTGTATCGGTGGCGGACAGGGAATTTCGATGGTTATTGAGCGCCTGCAATAGCGGAGCCTGACTGTATATTCTTGTCATTACATCACCCGGCTGCGGCCGGG