Homologs in group_225

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00605 FBDBKF_00605 43.8 Morganella morganii S1 fliI flagellar protein export ATPase FliI
EHELCC_00940 EHELCC_00940 43.8 Morganella morganii S2 fliI flagellar protein export ATPase FliI
NLDBIP_02520 NLDBIP_02520 43.8 Morganella morganii S4 fliI flagellar protein export ATPase FliI
LHKJJB_04035 LHKJJB_04035 43.8 Morganella morganii S3 fliI flagellar protein export ATPase FliI
HKOGLL_03010 HKOGLL_03010 43.8 Morganella morganii S5 fliI flagellar protein export ATPase FliI
F4V73_RS06615 F4V73_RS06615 44.5 Morganella psychrotolerans fliI flagellar protein export ATPase FliI
PMI_RS07975 PMI_RS07975 44.7 Proteus mirabilis HI4320 fliI flagellar protein export ATPase FliI

Distribution of the homologs in the orthogroup group_225

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_225

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P40291 0.0 527 63 1 419 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 0.0 527 63 1 419 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 0.0 527 63 1 419 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P80153 5.81e-143 418 50 3 419 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
P55717 1.02e-138 408 49 3 414 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P23445 1.05e-132 392 49 1 404 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
P74857 4.77e-130 385 50 3 417 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O83417 1.91e-120 361 45 3 416 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
Q9I4N1 3.34e-117 353 44 2 433 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52607 1.7e-116 350 43 6 435 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P0A1B9 2.31e-113 342 44 3 406 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 2.31e-113 342 44 3 406 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
P0A1C2 9.29e-110 333 43 4 413 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 9.29e-110 333 43 4 413 1 sctN Type 3 secretion system ATPase Shigella flexneri
P26465 9.68e-109 331 43 3 422 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q887B5 1.36e-106 325 47 4 406 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8RK01 4.51e-106 324 46 4 406 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
Q52371 5.6e-106 324 46 4 406 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
P52612 7.63e-106 324 44 3 415 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
P57178 2.05e-100 310 39 6 447 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9ZJJ3 1.46e-98 305 39 7 450 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O07025 3.12e-98 303 39 7 450 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
O67531 1.24e-97 302 39 2 411 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
B8H363 2.74e-96 299 43 4 413 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 2.74e-96 299 43 4 413 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8KA42 3.03e-92 289 39 5 426 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AZ7 8.42e-92 288 38 6 422 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O34171 3.21e-86 274 40 8 407 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 9.15e-81 259 45 4 329 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
Q1MRB8 6.38e-52 184 31 8 421 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
A9NBD0 2.81e-48 174 34 8 352 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
P41168 2.85e-48 174 32 8 401 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
Q83AF5 4.03e-48 174 34 8 352 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 4.03e-48 174 34 8 352 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
A6VWP9 7.59e-48 174 32 9 406 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
A1VPR5 1.71e-47 172 33 6 345 3 atpD2 ATP synthase subunit beta 2 Polaromonas naphthalenivorans (strain CJ2)
A9KK92 5.38e-47 171 29 7 413 3 atpD ATP synthase subunit beta Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B8G6G6 7.97e-47 171 31 8 386 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
A6LQH6 8.93e-47 170 32 8 348 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B9LBM0 1.15e-46 170 31 7 383 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 1.15e-46 170 31 7 383 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q2LR05 1.44e-46 170 35 6 314 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
A3DIM9 1.78e-46 169 32 10 370 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B8J439 2.03e-46 169 32 8 384 3 atpD ATP synthase subunit beta Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q8XID4 2.05e-46 169 32 7 346 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 2.05e-46 169 32 7 346 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SQZ5 2.14e-46 169 32 7 346 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
Q2RFX9 3.28e-46 169 33 9 347 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A8ZUA1 3.46e-46 169 32 14 417 3 atpD ATP synthase subunit beta Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q313W0 3.52e-46 169 33 8 348 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8RC15 4.76e-46 168 32 6 345 3 atpD ATP synthase subunit beta Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1I6J7 6.43e-46 168 31 8 348 3 atpD ATP synthase subunit beta Desulforudis audaxviator (strain MP104C)
Q3A946 7.49e-46 168 33 5 318 3 atpD ATP synthase subunit beta Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B8DRD2 8.68e-46 168 32 9 385 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
C0R5I6 1.37e-45 167 34 9 355 3 atpD ATP synthase subunit beta Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q11DD5 1.67e-45 168 32 5 350 3 atpD ATP synthase subunit beta Chelativorans sp. (strain BNC1)
Q0C9L8 1.71e-45 166 30 6 381 3 ctvE ATP synthase subunit beta, mitochondrial Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P22068 1.75e-45 168 34 5 323 1 atp2 ATP synthase subunit beta, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B8GRB8 1.8e-45 167 32 6 351 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q0AEJ6 1.89e-45 167 31 12 426 3 atpD2 ATP synthase subunit beta 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1CX36 2.5e-45 167 32 9 383 3 atpD ATP synthase subunit beta Myxococcus xanthus (strain DK1622)
A0LLF8 3.18e-45 166 30 9 384 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q7NA94 3.44e-45 166 31 7 385 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7NIQ9 4.83e-45 166 30 6 382 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q98EV8 5.07e-45 166 31 6 351 3 atpD ATP synthase subunit beta Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B3CN17 5.38e-45 166 34 9 355 3 atpD ATP synthase subunit beta Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q3SF66 5.71e-45 165 31 8 356 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
Q73IG3 5.76e-45 166 34 9 355 3 atpD ATP synthase subunit beta Wolbachia pipientis wMel
B9MS68 6.5e-45 165 32 10 374 3 atpD ATP synthase subunit beta Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q24MP1 8.88e-45 165 30 11 407 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain Y51)
Q8EWY8 1.04e-44 169 30 8 384 3 atpD ATP synthase subunit beta Malacoplasma penetrans (strain HF-2)
Q4FP38 1.26e-44 165 32 5 324 3 atpD ATP synthase subunit beta Pelagibacter ubique (strain HTCC1062)
Q3A083 1.33e-44 164 31 9 413 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A3QJR0 1.37e-44 164 30 10 408 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1AXU2 1.47e-44 164 30 9 408 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
Q30QQ1 1.55e-44 164 31 5 345 3 atpD ATP synthase subunit beta Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q6KI82 1.88e-44 164 28 6 402 3 atpD ATP synthase subunit beta Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
B8D6S7 2.15e-44 164 29 5 379 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 2.15e-44 164 29 5 379 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 2.15e-44 164 29 5 379 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A5CVI6 2.31e-44 164 33 6 320 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B0TQF4 2.96e-44 163 29 7 404 3 atpD ATP synthase subunit beta Shewanella halifaxensis (strain HAW-EB4)
Q5GRU7 3.38e-44 164 33 6 326 3 atpD ATP synthase subunit beta Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q07VU4 3.68e-44 163 31 6 349 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
Q60CR4 3.74e-44 163 29 9 408 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A8HAG3 4.07e-44 163 29 7 404 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A7GV56 4.19e-44 163 30 10 405 3 atpD ATP synthase subunit beta Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B8FZ34 4.4e-44 163 32 9 347 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B8FGT4 5.05e-44 163 33 11 354 3 atpD ATP synthase subunit beta Desulfatibacillum aliphaticivorans
A1T0Y9 5.08e-44 163 30 10 412 3 atpD2 ATP synthase subunit beta 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q2ST34 5.1e-44 163 31 11 406 3 atpD ATP synthase subunit beta Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
B9IRT7 8.25e-44 162 30 11 409 3 atpD ATP synthase subunit beta Bacillus cereus (strain Q1)
B7HY64 8.25e-44 162 30 11 409 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH187)
Q72XE8 8.25e-44 162 30 11 409 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 10987 / NRS 248)
Q814W2 1.11e-43 162 30 11 409 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK1 1.11e-43 162 30 11 409 3 atpD ATP synthase subunit beta Bacillus cereus (strain B4264)
A1VFJ5 1.21e-43 162 33 7 321 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 1.21e-43 162 33 7 321 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0HPG1 1.31e-43 162 31 6 349 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-7)
Q2JX57 1.36e-43 162 32 10 394 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-3-3Ab)
B9LZ84 1.4e-43 162 32 10 349 3 atpD ATP synthase subunit beta Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q0HD79 1.56e-43 161 31 6 349 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-4)
B5YI24 1.62e-43 162 30 2 320 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A9BFX3 1.68e-43 161 30 10 408 3 atpD ATP synthase subunit beta Petrotoga mobilis (strain DSM 10674 / SJ95)
A5UQN3 1.8e-43 161 30 6 349 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
A5N3H7 1.93e-43 161 31 6 309 3 atpD ATP synthase subunit beta Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A4J999 2.25e-43 161 30 5 318 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B2TK00 2.4e-43 161 32 5 296 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
Q12HQ1 2.5e-43 161 31 4 321 3 atpD ATP synthase subunit beta Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B2UZK0 2.5e-43 161 32 5 296 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
A4XKX0 2.63e-43 161 31 8 369 3 atpD ATP synthase subunit beta Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q21ZA6 2.87e-43 162 32 6 345 3 atpD2 ATP synthase subunit beta 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0Q2Z4 3.32e-43 160 30 4 317 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
Q2JIV9 3.44e-43 161 32 10 394 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-2-3B'a(2-13))
Q5KUJ3 3.52e-43 160 31 7 354 1 atpD ATP synthase subunit beta Geobacillus kaustophilus (strain HTA426)
Q9LA80 4.23e-43 160 31 7 354 3 atpD ATP synthase subunit beta Geobacillus thermoleovorans
Q5FRC5 4.3e-43 161 30 12 426 3 atpD1 ATP synthase subunit beta 1 Gluconobacter oxydans (strain 621H)
B7IQV8 4.47e-43 160 30 11 409 3 atpD ATP synthase subunit beta Bacillus cereus (strain G9842)
Q9Z687 4.54e-43 160 28 6 376 3 atpD ATP synthase subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B5YBP8 4.55e-43 160 31 11 412 3 atpD ATP synthase subunit beta Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q7VJ21 4.92e-43 160 31 10 374 3 atpD ATP synthase subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B3EJK9 5.13e-43 160 32 11 350 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain BS1)
A1RQB0 5.39e-43 160 31 6 349 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 5.39e-43 160 31 6 349 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A5EXL4 5.44e-43 160 29 9 408 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
B9L7Y7 5.95e-43 160 32 8 323 3 atpD ATP synthase subunit beta Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B7JGN0 6.24e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH820)
Q48AW0 6.58e-43 160 31 6 349 3 atpD ATP synthase subunit beta Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q6HAY0 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U3 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus cereus (strain ZK / E33L)
C1F0M8 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus cereus (strain 03BB102)
Q81JZ5 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus anthracis
A0RL95 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus thuringiensis (strain Al Hakam)
C3LFH9 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F4 6.71e-43 160 30 11 410 3 atpD ATP synthase subunit beta Bacillus anthracis (strain A0248)
B8I579 6.78e-43 160 32 8 337 3 atpD ATP synthase subunit beta Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q5WB78 6.9e-43 160 30 10 414 3 atpD ATP synthase subunit beta Shouchella clausii (strain KSM-K16)
B8CVU5 7.72e-43 159 28 7 404 3 atpD ATP synthase subunit beta Shewanella piezotolerans (strain WP3 / JCM 13877)
B5Y831 8.43e-43 159 31 7 349 3 atpD ATP synthase subunit beta Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
P35110 8.47e-43 159 31 14 388 3 atpD ATP synthase subunit beta Chlorobium limicola
Q8E8C0 8.54e-43 159 31 6 349 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9K6H5 9.37e-43 159 31 8 351 3 atpD ATP synthase subunit beta Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q74GY0 9.56e-43 159 32 10 349 3 atpD ATP synthase subunit beta Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q3IK50 9.8e-43 159 30 5 348 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
Q6AQ10 9.83e-43 159 32 7 346 3 atpD ATP synthase subunit beta Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A1WZT1 9.97e-43 159 32 4 321 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
Q89B39 1.02e-42 159 29 8 412 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A5EBX1 1.06e-42 159 33 10 354 3 atpD2 ATP synthase subunit beta 2 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
P42470 1.12e-42 159 30 7 346 3 atpD ATP synthase subunit beta Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A4ITI9 1.24e-42 159 31 7 346 3 atpD ATP synthase subunit beta Geobacillus thermodenitrificans (strain NG80-2)
A8G1W5 1.25e-42 159 29 8 405 3 atpD ATP synthase subunit beta Shewanella sediminis (strain HAW-EB3)
Q9CKW1 1.33e-42 159 29 5 374 3 atpD ATP synthase subunit beta Pasteurella multocida (strain Pm70)
B8DYT0 1.35e-42 159 34 9 352 3 atpD ATP synthase subunit beta Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B0UWG5 1.35e-42 159 29 9 403 3 atpD ATP synthase subunit beta Histophilus somni (strain 2336)
Q39Q56 1.35e-42 159 32 10 349 3 atpD ATP synthase subunit beta Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A7G9Q9 1.37e-42 159 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 1.37e-42 159 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
Q8KAC9 1.43e-42 159 30 13 385 3 atpD2 ATP synthase subunit beta 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
C3M9S1 1.66e-42 159 29 6 382 3 atpD ATP synthase subunit beta Sinorhizobium fredii (strain NBRC 101917 / NGR234)
C1FQP5 1.71e-42 159 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
P42469 1.79e-42 159 32 8 329 3 atpD ATP synthase subunit beta Stigmatella aurantiaca
Q0A4M8 1.86e-42 159 32 7 352 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1BCJ2 1.94e-42 159 31 10 350 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q15SF7 1.94e-42 160 30 6 365 3 atpD1 ATP synthase subunit beta 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A5HY52 1.95e-42 159 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 1.95e-42 159 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 1.95e-42 159 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
Q0AUD3 2e-42 159 31 6 345 3 atpD ATP synthase subunit beta Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A9VSA3 2e-42 159 30 11 410 3 atpD ATP synthase subunit beta Bacillus mycoides (strain KBAB4)
A6VL57 2.04e-42 158 30 7 351 3 atpD ATP synthase subunit beta Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P47639 2.23e-42 159 30 10 409 3 atpD ATP synthase subunit beta Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A9KX06 2.37e-42 158 30 5 348 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 2.37e-42 158 30 5 348 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 2.37e-42 158 30 5 348 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 2.37e-42 158 30 5 348 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
A0L2S8 2.52e-42 158 31 4 321 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
Q6NDD2 2.63e-42 158 32 7 326 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B1KQ34 2.66e-42 158 30 5 348 3 atpD ATP synthase subunit beta Shewanella woodyi (strain ATCC 51908 / MS32)
Q6MS94 2.98e-42 158 31 11 406 3 atpD ATP synthase subunit beta Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q0C100 3.04e-42 158 31 9 361 3 atpD ATP synthase subunit beta Hyphomonas neptunium (strain ATCC 15444)
P42465 3.33e-42 158 32 10 351 3 atpD ATP synthase subunit beta Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B9E8E6 3.41e-42 158 29 10 412 3 atpD ATP synthase subunit beta Macrococcus caseolyticus (strain JCSC5402)
Q3J6N1 3.47e-42 158 29 6 382 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
C5D990 3.5e-42 158 31 7 354 3 atpD ATP synthase subunit beta Geobacillus sp. (strain WCH70)
A1SBU0 3.65e-42 158 31 6 349 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
P22478 4.2e-42 158 31 8 351 3 atpD ATP synthase subunit beta Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
A4IW24 4.44e-42 157 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 4.44e-42 157 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 4.44e-42 157 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
Q7VPP0 4.64e-42 157 29 5 399 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q03235 4.7e-42 157 30 7 346 3 atpD ATP synthase subunit beta Pectinatus frisingensis
A9H9A8 4.78e-42 158 32 10 357 3 atpD ATP synthase subunit beta Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q0AKW0 5.05e-42 158 30 7 390 3 atpD ATP synthase subunit beta Maricaulis maris (strain MCS10)
Q1QSD0 5.07e-42 157 31 11 409 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0BRX2 5.35e-42 157 29 5 399 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
P50002 5.6e-42 157 31 10 363 1 atpD ATP synthase subunit beta, sodium ion specific Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
B3QUP6 5.62e-42 157 33 5 318 3 atpD ATP synthase subunit beta Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B3H2P3 5.69e-42 157 29 5 399 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 5.69e-42 157 29 5 399 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q67TB7 5.78e-42 157 28 12 426 3 atpD ATP synthase subunit beta Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A8EV70 6.91e-42 157 29 8 381 3 atpD ATP synthase subunit beta Aliarcobacter butzleri (strain RM4018)
Q3A605 6.97e-42 157 29 10 413 3 atpD1 ATP synthase subunit beta 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A5WBW1 7.16e-42 157 32 9 365 3 atpD ATP synthase subunit beta Psychrobacter sp. (strain PRwf-1)
B2SEY1 7.4e-42 157 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
Q180W5 7.5e-42 157 30 6 345 3 atpD ATP synthase subunit beta Clostridioides difficile (strain 630)
A6TK65 7.81e-42 157 33 7 309 3 atpD ATP synthase subunit beta Alkaliphilus metalliredigens (strain QYMF)
Q5FGY3 7.96e-42 157 30 8 355 3 atpD ATP synthase subunit beta Ehrlichia ruminantium (strain Gardel)
Q8KDL4 8.28e-42 157 33 7 321 3 atpD1 ATP synthase subunit beta 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q3J431 8.35e-42 157 30 6 360 3 atpD1 ATP synthase subunit beta 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PIB9 8.35e-42 157 30 6 360 3 atpD1 ATP synthase subunit beta 1 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q65Q07 8.45e-42 157 28 8 410 3 atpD ATP synthase subunit beta Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0TWS7 8.54e-42 157 28 8 409 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q8D9 8.62e-42 157 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
Q6LKZ6 8.82e-42 157 32 6 322 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
Q5HB71 8.9e-42 157 30 8 355 3 atpD ATP synthase subunit beta Ehrlichia ruminantium (strain Welgevonden)
Q39ZU1 9.75e-42 157 29 10 413 3 atpD3 ATP synthase subunit beta 3 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P33253 9.86e-42 157 30 9 353 3 atpD ATP synthase subunit beta Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
P07677 9.99e-42 157 30 7 354 1 atpD ATP synthase subunit beta Bacillus sp. (strain PS3)
C3LSI9 1.05e-41 157 30 7 356 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain M66-2)
Q9KNH5 1.05e-41 157 30 7 356 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F459 1.05e-41 157 30 7 356 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9ZK81 1.1e-41 157 32 7 319 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
P46561 1.12e-41 158 31 5 324 1 atp-2 ATP synthase subunit beta, mitochondrial Caenorhabditis elegans
C6E9F1 1.14e-41 157 31 9 347 3 atpD ATP synthase subunit beta Geobacter sp. (strain M21)
B5Z8D0 1.23e-41 156 32 7 319 3 atpD ATP synthase subunit beta Helicobacter pylori (strain G27)
A1SS55 1.28e-41 157 31 6 345 3 atpD1 ATP synthase subunit beta 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A8G7M8 1.47e-41 156 30 8 352 3 atpD ATP synthase subunit beta Serratia proteamaculans (strain 568)
P83484 1.64e-41 157 33 8 353 1 At5g08690 ATP synthase subunit beta-2, mitochondrial Arabidopsis thaliana
A8MJV9 1.68e-41 156 32 6 336 3 atpD ATP synthase subunit beta Alkaliphilus oremlandii (strain OhILAs)
A5FLS1 1.8e-41 157 30 7 351 3 atpD ATP synthase subunit beta Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
P83483 1.83e-41 157 33 8 353 1 At5g08670 ATP synthase subunit beta-1, mitochondrial Arabidopsis thaliana
A0LDA0 1.83e-41 156 32 10 360 3 atpD ATP synthase subunit beta Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q0BK84 1.87e-41 155 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 1.87e-41 155 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 1.87e-41 155 30 5 350 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A8F004 1.92e-41 156 32 5 326 3 atpD ATP synthase subunit beta Rickettsia canadensis (strain McKiel)
Q9C5A9 1.96e-41 157 33 8 353 1 At5g08680 ATP synthase subunit beta-3, mitochondrial Arabidopsis thaliana
B3EA01 1.97e-41 156 30 11 410 3 atpD ATP synthase subunit beta Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q2VZN2 1.99e-41 156 31 10 359 3 atpD ATP synthase subunit beta Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q82J84 2e-41 156 31 8 354 3 atpD ATP synthase subunit beta Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A3CM14 2.01e-41 156 30 8 355 3 atpD ATP synthase subunit beta Streptococcus sanguinis (strain SK36)
A5G9D8 2.02e-41 156 31 9 347 3 atpD ATP synthase subunit beta Geotalea uraniireducens (strain Rf4)
Q98QU5 2.11e-41 156 28 7 405 3 atpD1 ATP synthase subunit beta 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q1CSD5 2.2e-41 155 32 9 347 3 atpD ATP synthase subunit beta Helicobacter pylori (strain HPAG1)
B4SAN6 2.2e-41 155 30 9 353 3 atpD ATP synthase subunit beta Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q6FFK0 2.35e-41 155 31 5 329 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2NQ86 2.45e-41 155 31 6 351 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
B1KSS8 2.61e-41 155 32 7 339 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
B7GMF3 2.63e-41 155 30 8 355 3 atpD ATP synthase subunit beta Anoxybacillus flavithermus (strain DSM 21510 / WK1)
P42467 2.75e-41 155 31 5 318 3 atpD ATP synthase subunit beta (Fragment) Peptococcus niger
B2VCA4 3.01e-41 155 29 6 384 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q0I5X3 3.13e-41 155 29 9 403 3 atpD ATP synthase subunit beta Histophilus somni (strain 129Pt)
B6JMX2 3.2e-41 155 32 7 319 3 atpD ATP synthase subunit beta Helicobacter pylori (strain P12)
Q17Y78 3.37e-41 155 32 9 347 3 atpD ATP synthase subunit beta Helicobacter acinonychis (strain Sheeba)
P41009 3.71e-41 155 30 7 354 3 atpD ATP synthase subunit beta Bacillus caldotenax
B0SLC8 4.14e-41 155 32 6 319 3 atpD ATP synthase subunit beta Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDA5 4.14e-41 155 32 6 319 3 atpD ATP synthase subunit beta Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q5ZLC5 4.44e-41 156 31 7 327 1 ATP5F1B ATP synthase subunit beta, mitochondrial Gallus gallus
P72247 4.86e-41 155 31 9 364 1 atpD ATP synthase subunit beta Rhodobacter capsulatus
B5EFI7 4.99e-41 155 31 9 347 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
P55988 5.11e-41 155 32 7 319 3 atpD ATP synthase subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
Q3B406 5.13e-41 155 31 7 375 3 atpD2 ATP synthase subunit beta 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A7Z9Q0 5.25e-41 155 30 8 347 3 atpD ATP synthase subunit beta Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B0KRA8 5.35e-41 154 31 4 348 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
A7N6Q5 6.12e-41 154 31 6 322 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
B3EST8 6.87e-41 155 31 6 351 3 atpD ATP synthase subunit beta Amoebophilus asiaticus (strain 5a2)
Q07YM7 6.95e-41 154 31 7 395 3 atpD2 ATP synthase subunit beta 2 Shewanella frigidimarina (strain NCIMB 400)
P43715 7.52e-41 154 29 3 371 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN64 7.52e-41 154 29 3 371 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain 86-028NP)
A4Y187 7.72e-41 154 31 4 348 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
A5UA11 8.07e-41 154 29 3 371 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittEE)
Q9PTY0 8.12e-41 155 31 7 327 2 ATP5F1B ATP synthase subunit beta, mitochondrial Cyprinus carpio
P00829 8.13e-41 155 31 5 324 1 ATP5F1B ATP synthase subunit beta, mitochondrial Bos taurus
P10719 8.33e-41 155 31 5 324 1 Atp5f1b ATP synthase subunit beta, mitochondrial Rattus norvegicus
A6QB59 8.33e-41 154 30 5 345 3 atpD ATP synthase subunit beta Sulfurovum sp. (strain NBC37-1)
Q7MGI0 8.56e-41 154 30 6 356 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain YJ016)
Q8DDG8 8.56e-41 154 30 6 356 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain CMCP6)
Q3B6W8 8.89e-41 154 30 8 348 3 atpD1 ATP synthase subunit beta 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B1JRN2 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)
Q1CCH5 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5T9 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM8 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pestis
B2K847 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C095 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE0 9.7e-41 154 30 6 351 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P56480 1.08e-40 155 31 5 324 1 Atp5f1b ATP synthase subunit beta, mitochondrial Mus musculus
B4RS81 1.1e-40 154 30 6 349 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
P06576 1.11e-40 155 31 5 324 1 ATP5F1B ATP synthase subunit beta, mitochondrial Homo sapiens
P17614 1.25e-40 155 33 11 360 1 ATPB ATP synthase subunit beta, mitochondrial Nicotiana plumbaginifolia
A4SC45 1.28e-40 154 30 8 348 3 atpD ATP synthase subunit beta Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A5UGY9 1.3e-40 153 29 3 371 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittGG)
Q07232 1.32e-40 154 28 8 409 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B6JD09 1.33e-40 154 31 6 326 3 atpD ATP synthase subunit beta Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
C3K1E6 1.35e-40 153 31 6 349 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
A6GVV9 1.42e-40 154 29 7 351 3 atpD ATP synthase subunit beta Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q6CYJ5 1.52e-40 153 30 6 351 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P42006 1.74e-40 153 31 7 354 3 atpD ATP synthase subunit beta Geobacillus stearothermophilus
Q2J3I4 1.87e-40 153 32 7 326 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain HaA2)
Q4A604 1.87e-40 153 30 6 347 3 atpD ATP synthase subunit beta Mycoplasmopsis synoviae (strain 53)
P13357 2.13e-40 154 30 7 350 3 atpD ATP synthase subunit beta Cellulophaga lytica
Q01859 2.17e-40 154 32 9 356 1 ATPB ATP synthase subunit beta, mitochondrial Oryza sativa subsp. japonica
Q1GEU8 2.28e-40 153 32 7 328 3 atpD ATP synthase subunit beta Ruegeria sp. (strain TM1040)
A8HS10 2.34e-40 153 30 7 385 3 atpD ATP synthase subunit beta Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A0M791 2.44e-40 154 30 7 350 3 atpD ATP synthase subunit beta Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q3SVJ1 2.48e-40 153 32 6 319 3 atpD ATP synthase subunit beta Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A7IH31 2.56e-40 153 31 6 322 3 atpD ATP synthase subunit beta Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q4K3A9 2.59e-40 152 30 3 347 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B3EDQ7 2.61e-40 153 30 9 353 3 atpD ATP synthase subunit beta Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q927W4 2.69e-40 153 30 7 346 3 atpD2 ATP synthase subunit beta 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q88BX4 2.79e-40 152 30 3 347 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 2.79e-40 152 30 3 347 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q13DP2 2.8e-40 153 32 7 326 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB5)
Q89X74 2.93e-40 153 32 6 329 3 atpD ATP synthase subunit beta Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B9DME3 3e-40 153 30 13 414 3 atpD ATP synthase subunit beta Staphylococcus carnosus (strain TM300)
Q07UZ5 3e-40 153 32 7 326 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisA53)
Q05FY1 3.09e-40 152 30 8 407 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
A7HIX7 3.26e-40 153 29 10 404 3 atpD ATP synthase subunit beta Anaeromyxobacter sp. (strain Fw109-5)
A8LN39 3.62e-40 152 31 6 323 3 atpD1 ATP synthase subunit beta 1 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A8F3K2 3.71e-40 152 33 8 348 3 atpD ATP synthase subunit beta Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q9HT20 3.86e-40 152 31 2 320 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 3.86e-40 152 31 2 320 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 3.86e-40 152 31 2 320 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 3.86e-40 152 31 2 320 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
A6UDM1 3.91e-40 153 29 6 382 3 atpD ATP synthase subunit beta Sinorhizobium medicae (strain WSM419)
Q55CS9 4.23e-40 155 32 7 325 1 atp5f1b ATP synthase subunit beta, mitochondrial Dictyostelium discoideum
A4WGF5 4.33e-40 152 30 6 351 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
C4LDW0 4.43e-40 152 30 4 348 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A4STP3 4.43e-40 152 30 2 320 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
B4F0E7 4.51e-40 152 28 8 405 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
Q8Y4C1 4.7e-40 152 30 7 346 3 atpD2 ATP synthase subunit beta 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WP9 4.7e-40 152 30 7 346 3 atpD2 ATP synthase subunit beta 2 Listeria monocytogenes serotype 4b (strain F2365)
A0ALL3 4.8e-40 152 30 7 346 3 atpD2 ATP synthase subunit beta 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A4VVJ9 4.84e-40 152 30 8 355 3 atpD ATP synthase subunit beta Streptococcus suis (strain 05ZYH33)
A4W1V7 4.84e-40 152 30 8 355 3 atpD ATP synthase subunit beta Streptococcus suis (strain 98HAH33)
P37809 4.85e-40 152 30 8 347 1 atpD ATP synthase subunit beta Bacillus subtilis (strain 168)
Q50331 4.96e-40 152 31 6 350 3 atpD ATP synthase subunit beta Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q4ZL24 5.11e-40 152 30 5 348 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
Q2T880 5.15e-40 153 32 8 357 3 atpD2 ATP synthase subunit beta 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8CNJ7 5.21e-40 152 29 9 408 3 atpD ATP synthase subunit beta Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMB9 5.21e-40 152 29 9 408 3 atpD ATP synthase subunit beta Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8UC76 5.55e-40 152 31 5 324 3 atpD ATP synthase subunit beta Agrobacterium fabrum (strain C58 / ATCC 33970)
Q21CY7 5.57e-40 152 31 7 326 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB18)
A5CYE2 5.71e-40 152 31 9 338 3 atpD ATP synthase subunit beta Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
C6DJH2 5.75e-40 152 30 6 351 3 atpD ATP synthase subunit beta Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q87TT4 5.77e-40 152 30 5 348 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0VKX4 5.81e-40 152 30 4 348 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A0AFR1 5.83e-40 152 29 12 417 3 atpD1 ATP synthase subunit beta 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
C5BKJ5 5.95e-40 152 30 10 415 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q49Z50 6.58e-40 152 29 11 409 3 atpD ATP synthase subunit beta Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DP44 6.84e-40 152 30 8 355 1 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97PT6 6.84e-40 152 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLA9 6.84e-40 152 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICS9 6.84e-40 152 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Hungary19A-6)
Q04HT9 6.84e-40 152 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q7NHG7 6.98e-40 152 32 11 344 3 atpD ATP synthase subunit beta Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3AP13 7e-40 152 30 9 353 3 atpD ATP synthase subunit beta Chlorobium chlorochromatii (strain CaD3)
C5BF40 7.05e-40 151 29 7 385 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
A0KQX8 7.21e-40 151 30 2 320 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q04ZU5 7.45e-40 152 31 9 353 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 7.45e-40 152 31 9 353 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B0VBP3 8.17e-40 151 31 5 329 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 8.17e-40 151 31 5 329 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 8.17e-40 151 31 5 329 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 8.17e-40 151 31 5 329 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 8.17e-40 151 31 5 329 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 8.17e-40 151 31 5 329 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
Q0I7R2 8.22e-40 152 32 8 392 3 atpA ATP synthase subunit alpha Synechococcus sp. (strain CC9311)
Q5M5J1 8.55e-40 151 29 7 354 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
B5RFW3 8.9e-40 151 30 6 351 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q21DK8 8.92e-40 151 30 8 388 3 atpD ATP synthase subunit beta Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B7K2R8 9.34e-40 152 32 10 357 3 atpD ATP synthase subunit beta Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8EM83 9.42e-40 151 30 8 349 3 atpD ATP synthase subunit beta Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q48BG5 9.59e-40 151 30 5 348 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6CFT7 9.69e-40 152 29 7 382 1 ATP2 ATP synthase subunit beta, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
P19023 1.02e-39 152 31 9 356 2 ATPB ATP synthase subunit beta, mitochondrial Zea mays
A5E950 1.16e-39 151 31 4 327 3 atpD1 ATP synthase subunit beta 1 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q7W3B0 1.18e-39 151 29 6 349 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 1.18e-39 151 29 6 349 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A7MMW9 1.24e-39 151 30 6 351 3 atpD ATP synthase subunit beta Cronobacter sakazakii (strain ATCC BAA-894)
Q25117 1.32e-39 152 31 7 342 2 None ATP synthase subunit beta, mitochondrial Hemicentrotus pulcherrimus
P23704 1.35e-39 152 29 8 381 2 atp-2 ATP synthase subunit beta, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
B1W0A3 1.36e-39 151 30 9 359 3 atpD ATP synthase subunit beta Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q03LX3 1.38e-39 151 29 7 354 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M104 1.38e-39 151 29 7 354 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain CNRZ 1066)
Q6LLG8 1.38e-39 151 30 6 356 3 atpD1 ATP synthase subunit beta 1 Photobacterium profundum (strain SS9)
Q5LNP1 1.38e-39 151 31 7 328 3 atpD ATP synthase subunit beta Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8DLG8 1.42e-39 151 32 8 334 1 atpD ATP synthase subunit beta Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q92LK8 1.43e-39 151 28 6 382 3 atpD ATP synthase subunit beta Rhizobium meliloti (strain 1021)
Q3K441 1.46e-39 150 29 3 347 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
Q7VU44 1.5e-39 150 29 6 349 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B5E670 1.65e-39 150 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 19F (strain G54)
Q15MU4 1.7e-39 150 31 4 321 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q6F202 1.74e-39 151 35 7 281 3 atpD ATP synthase subunit beta Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A4WUM7 1.87e-39 150 29 7 361 3 atpD ATP synthase subunit beta Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B5FCZ1 1.97e-39 150 29 6 356 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain MJ11)
B5XZM4 2.07e-39 150 30 6 351 3 atpD ATP synthase subunit beta Klebsiella pneumoniae (strain 342)
A6TG36 2.09e-39 150 30 6 334 3 atpD ATP synthase subunit beta Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q2YCA3 2.09e-39 150 30 6 351 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P43451 2.24e-39 150 31 6 319 3 atpD ATP synthase subunit beta Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q2GKK8 2.25e-39 150 28 10 414 3 atpD ATP synthase subunit beta Anaplasma phagocytophilum (strain HZ)
Q65DX4 2.26e-39 150 29 10 384 3 atpD ATP synthase subunit beta Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q4FQ37 2.38e-39 150 30 9 366 3 atpD ATP synthase subunit beta Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A7H017 2.41e-39 150 30 8 346 3 atpD ATP synthase subunit beta Campylobacter curvus (strain 525.92)
B0U598 2.45e-39 150 29 9 389 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
C1CLK6 2.48e-39 150 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain P1031)
C1CF93 2.48e-39 150 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain JJA)
B2IQX0 2.48e-39 150 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain CGSP14)
C1C899 2.48e-39 150 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain 70585)
C1CSC8 2.66e-39 150 30 8 355 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Taiwan19F-14)
A1JTC6 2.8e-39 150 29 6 351 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q5E1N7 2.84e-39 150 29 6 356 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain ATCC 700601 / ES114)
O50341 2.98e-39 150 31 6 354 3 atpD ATP synthase subunit beta Fervidobacterium islandicum
Q5WSG8 3.12e-39 150 30 6 356 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 3.12e-39 150 30 6 356 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 3.12e-39 150 30 6 356 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 3.12e-39 150 30 6 356 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
Q2GGP9 3.18e-39 150 29 9 372 3 atpD ATP synthase subunit beta Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
A7HJV7 3.37e-39 150 30 8 413 3 atpD ATP synthase subunit beta Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A9AVV4 3.52e-39 150 27 9 401 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P63680 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain MW2)
A8YY70 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7K7 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain MSSA476)
Q6GEX2 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain MRSA252)
P99112 3.65e-39 150 29 11 411 1 atpD ATP synthase subunit beta Staphylococcus aureus (strain N315)
P63679 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIU7 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain Newman)
Q5HE97 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain COL)
Q2YUK1 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUP8 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain JH9)
Q2FWF0 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF24 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain USA300)
A6U3I8 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain JH1)
A7X4U3 3.65e-39 150 29 11 411 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L7Y4 3.99e-39 150 29 9 382 3 atpD ATP synthase subunit beta Staphylococcus haemolyticus (strain JCSC1435)
Q3HKH4 4.05e-39 149 32 8 350 3 atpD2 ATP synthase subunit beta 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3YVN6 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK77 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 4.08e-39 149 30 6 334 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
B1X9W0 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 4.08e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
B5BIN6 4.16e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 4.16e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8A6J5 4.16e-39 149 30 6 334 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
Q7CPE2 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
A8ACN6 4.29e-39 149 30 6 334 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7I177 4.42e-39 149 31 9 347 3 atpD ATP synthase subunit beta Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P38482 4.5e-39 151 33 8 328 1 ATP2 ATP synthase subunit beta, mitochondrial Chlamydomonas reinhardtii
Q329S1 4.56e-39 149 30 6 334 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
A7N0Y1 4.61e-39 149 29 6 356 3 atpD1 ATP synthase subunit beta 1 Vibrio campbellii (strain ATCC BAA-1116)
A6W3S8 4.64e-39 149 30 4 348 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
Q9A2V9 4.94e-39 150 31 10 371 3 atpD ATP synthase subunit beta Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B1HM56 5.17e-39 149 29 7 346 3 atpD ATP synthase subunit beta Lysinibacillus sphaericus (strain C3-41)
B8F774 5.2e-39 149 28 5 399 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
B6EHG4 5.94e-39 149 29 6 356 3 atpD ATP synthase subunit beta Aliivibrio salmonicida (strain LFI1238)
A8AYG1 6.1e-39 149 30 8 355 3 atpD ATP synthase subunit beta Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q1Q899 6.16e-39 149 30 9 366 3 atpD ATP synthase subunit beta Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9PE85 6.53e-39 149 29 9 389 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
Q5NQY9 6.59e-39 149 30 10 365 3 atpD ATP synthase subunit beta Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C4K227 6.74e-39 149 30 8 358 3 atpD ATP synthase subunit beta Rickettsia peacockii (strain Rustic)
P42466 6.8e-39 149 28 9 391 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
Q87E90 6.87e-39 149 29 9 389 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 6.87e-39 149 29 9 389 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
P12986 6.98e-39 149 29 6 356 1 atpD ATP synthase subunit beta Vibrio alginolyticus
B9KES3 7.15e-39 149 30 7 346 3 atpD ATP synthase subunit beta Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A8F2U0 7.23e-39 149 30 8 356 3 atpD ATP synthase subunit beta Rickettsia massiliae (strain Mtu5)
A1AP52 7.91e-39 149 29 9 409 3 atpD2 ATP synthase subunit beta 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS08315
Feature type CDS
Gene -
Product FliI/YscN family ATPase
Location 1723851 - 1725170 (strand: 1)
Length 1320 (nucleotides) / 439 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_225
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF02874 ATP synthase alpha/beta family, beta-barrel domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)		 NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG042265 AscN VF0479 Effector delivery system

Protein Sequence

MTITTLRTRLKQQQQDITGNAFFTPHGRVLSVTGTLIRASVSHVKIGEICLLLTQKNQLKAEVVGLDGQDALLAPYGELTGISANTAVTATGSPLQIALWPAMTGQILNGLGESLIPVTLPPDVSYGLLNNPPPSALNRKMITTPLSLGIRAIDGLLTCGEGQRMGIFAAAGGGKSTLLAAIIRNTQADICVLALVGERGRELNEFIEHDLGEEGLKKAVLVVSTSDRPAIERAKAGFTATRIAEYFRDRGKRVLLLMDSVTRFARAQREIGLAAGEPPARQGYPPSVFAQLPVLMERAGQSDKGSITALYTVLVEGDDLNEPVADETRSILDGHIVLTRKLAEMQHYPAIDVLKSASRVMNRIIPENQKKAAASIKTVLAQYDELEFLIQLGEYEPGKNPDNDNIIRRYHAIMHWLKQGTDESQDYAQTCREITESAL

Flanking regions ( +/- flanking 50bp)

CTGTCAGCCTGACCGGTTTATTTCAGTCAGACTGATGCGGAGGAGTTTTCATGACAATAACCACACTACGCACCCGCCTGAAACAGCAGCAGCAGGACATCACCGGTAATGCATTTTTTACCCCCCACGGACGGGTGCTCAGTGTTACCGGTACATTGATCCGCGCATCAGTCAGTCACGTTAAAATCGGTGAAATCTGCCTTCTGCTGACACAAAAAAATCAGCTGAAAGCCGAAGTTGTCGGGCTGGATGGTCAGGATGCGTTACTCGCACCTTACGGTGAGCTCACCGGTATTTCTGCTAATACAGCGGTCACAGCAACCGGCTCCCCATTGCAGATTGCCCTGTGGCCTGCGATGACAGGACAAATTCTCAACGGTCTGGGGGAATCGCTGATACCGGTTACGCTGCCACCGGATGTCTCGTACGGATTACTGAATAATCCCCCGCCGTCTGCACTGAACCGGAAGATGATTACCACACCGCTGTCTCTGGGCATCAGAGCGATTGATGGTCTGCTGACCTGCGGAGAGGGACAGCGTATGGGTATTTTTGCGGCAGCCGGCGGCGGAAAAAGTACGCTGCTGGCAGCTATTATCCGTAATACACAGGCAGATATCTGTGTATTGGCACTGGTCGGTGAGCGCGGACGGGAGCTGAATGAGTTTATTGAGCACGACCTCGGTGAAGAGGGGCTGAAAAAAGCGGTACTAGTCGTTTCAACCTCAGACAGACCCGCCATTGAGCGCGCCAAAGCCGGTTTTACTGCCACGCGCATAGCGGAATATTTCCGTGACCGGGGGAAACGGGTACTGCTGTTGATGGACTCAGTCACCCGGTTTGCAAGGGCACAACGGGAGATTGGATTAGCCGCCGGAGAGCCTCCCGCCCGGCAGGGATATCCGCCATCCGTTTTTGCACAGTTGCCGGTGCTGATGGAAAGAGCCGGACAATCTGACAAAGGTTCAATTACCGCCCTCTATACCGTCCTGGTGGAAGGCGACGACCTTAATGAACCGGTAGCCGATGAAACCCGCTCTATTCTTGACGGACACATAGTCCTGACCCGCAAACTGGCGGAGATGCAGCACTATCCTGCCATTGATGTTCTGAAATCGGCTAGCCGTGTAATGAACCGGATAATCCCCGAAAATCAGAAAAAAGCAGCCGCTTCCATAAAGACGGTTCTTGCTCAGTATGATGAACTGGAATTCCTTATTCAGCTTGGTGAATATGAGCCCGGTAAAAATCCGGATAATGACAATATAATCCGCAGATACCACGCCATTATGCACTGGCTGAAGCAGGGTACTGATGAATCACAGGATTATGCTCAAACCTGCCGGGAAATCACGGAGTCCGCATTATGACCGGAGCAGTTAACAGCAGACATGCCCGTATTCTGCGCTATTACCGGCAT