Homologs in group_205

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00605 FBDBKF_00605 94.9 Morganella morganii S1 fliI flagellar protein export ATPase FliI
EHELCC_00940 EHELCC_00940 94.9 Morganella morganii S2 fliI flagellar protein export ATPase FliI
NLDBIP_02520 NLDBIP_02520 94.9 Morganella morganii S4 fliI flagellar protein export ATPase FliI
LHKJJB_04035 LHKJJB_04035 94.9 Morganella morganii S3 fliI flagellar protein export ATPase FliI
HKOGLL_03010 HKOGLL_03010 94.9 Morganella morganii S5 fliI flagellar protein export ATPase FliI
F4V73_RS08315 F4V73_RS08315 44.5 Morganella psychrotolerans - FliI/YscN family ATPase
PMI_RS07975 PMI_RS07975 78.9 Proteus mirabilis HI4320 fliI flagellar protein export ATPase FliI

Distribution of the homologs in the orthogroup group_205

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_205

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P26465 0.0 652 72 2 454 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52612 0.0 622 71 2 442 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
P57178 0.0 533 54 1 451 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9I4N1 0.0 523 64 3 410 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KA42 0.0 523 54 1 451 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AZ7 1.52e-167 482 52 2 449 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P23445 9.93e-139 408 51 7 414 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
P52607 7.07e-126 375 43 3 423 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O83417 2.15e-124 372 46 3 423 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
P80153 1.59e-119 359 45 4 440 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
B8H363 1.98e-116 351 46 5 433 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 1.98e-116 351 46 5 433 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O67531 2.49e-114 346 42 6 431 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
Q9ZJJ3 8.96e-113 342 44 3 428 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O07025 2.06e-112 340 43 3 428 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
P55717 1.62e-111 339 44 4 414 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P40291 5.57e-111 337 43 4 423 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 5.57e-111 337 43 4 423 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 5.76e-111 337 43 4 423 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P74857 4.05e-103 317 42 4 427 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8RK01 8.18e-98 303 41 5 442 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
Q52371 7.29e-97 301 40 5 459 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
Q887B5 1.01e-96 301 41 5 442 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
O34171 3.73e-91 287 47 3 326 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 1.83e-88 280 46 4 344 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
P0A1C2 8.78e-87 275 38 5 430 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 8.78e-87 275 38 5 430 1 sctN Type 3 secretion system ATPase Shigella flexneri
P0A1B9 4.93e-86 273 38 5 426 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 4.93e-86 273 38 5 426 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
Q2LR05 2.88e-49 177 33 10 390 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
A8ZUA1 5.86e-47 171 31 12 424 3 atpD ATP synthase subunit beta Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
O50292 1.15e-46 171 34 5 304 3 atpD ATP synthase subunit beta Aquifex pyrophilus
A9NBD0 1.28e-46 170 33 3 302 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
O67828 1.4e-46 171 34 5 312 3 atpD ATP synthase subunit beta Aquifex aeolicus (strain VF5)
Q83AF5 1.6e-46 170 33 3 302 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 1.6e-46 170 33 3 302 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
Q3SF66 1.58e-45 167 31 4 328 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
Q5WSG8 3.34e-45 166 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 3.34e-45 166 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 3.34e-45 166 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 3.34e-45 166 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
Q60CR4 9.02e-45 165 33 4 323 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P42466 1.63e-44 165 29 11 401 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
Q8XID4 3.71e-44 164 29 10 421 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 3.71e-44 164 29 10 421 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C3K1E6 3.77e-44 163 30 7 382 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
Q0SQZ5 4.03e-44 164 29 10 421 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
B8J439 5.72e-44 163 31 10 392 3 atpD ATP synthase subunit beta Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q2S6P1 5.78e-44 163 33 4 302 3 atpD ATP synthase subunit beta Hahella chejuensis (strain KCTC 2396)
B5YI24 6.6e-44 163 32 3 301 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A5HY52 8.54e-44 162 32 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 8.54e-44 162 32 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 8.54e-44 162 32 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
A7N6Q5 9.31e-44 162 33 4 302 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
C1FQP5 1.01e-43 162 32 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
A7G9Q9 1.09e-43 162 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 1.09e-43 162 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
Q31DM0 1.45e-43 162 32 3 301 3 atpD ATP synthase subunit beta Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2FHY8 1.5e-43 162 33 5 308 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain K279a)
B4SJR9 1.5e-43 162 33 5 308 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain R551-3)
B3QUP6 1.78e-43 162 31 7 386 3 atpD ATP synthase subunit beta Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
P41168 2.21e-43 162 33 4 295 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
C5BKJ5 2.24e-43 162 34 7 321 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
A9AVV4 2.35e-43 162 29 11 401 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A4VS62 2.63e-43 161 30 6 382 3 atpD ATP synthase subunit beta Stutzerimonas stutzeri (strain A1501)
A3DIM9 2.82e-43 161 29 9 389 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B0VBP3 3.03e-43 161 33 5 308 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 3.03e-43 161 33 5 308 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 3.03e-43 161 33 5 308 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 3.03e-43 161 33 5 308 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 3.03e-43 161 33 5 308 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 3.03e-43 161 33 5 308 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
Q6FFK0 3.87e-43 161 33 5 308 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B3EDQ7 3.89e-43 160 31 6 335 3 atpD ATP synthase subunit beta Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A6LQH6 4.04e-43 160 32 3 301 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q87TT4 4.38e-43 160 31 8 383 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZL24 5.16e-43 160 31 5 330 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
Q4K3A9 5.17e-43 160 30 7 382 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P42467 5.95e-43 159 30 4 302 3 atpD ATP synthase subunit beta (Fragment) Peptococcus niger
A0LLF8 6.49e-43 160 31 12 392 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A8LN39 6.75e-43 160 34 4 307 3 atpD1 ATP synthase subunit beta 1 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A5UQN3 6.87e-43 160 32 5 308 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
P00830 7.49e-43 161 30 10 390 1 ATP2 ATP synthase subunit beta, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B8GRB8 7.53e-43 160 31 3 301 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B4SAN6 8.28e-43 160 32 6 333 3 atpD ATP synthase subunit beta Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q48BG5 8.6e-43 160 31 5 330 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1LHL0 8.78e-43 160 31 5 329 3 atpD ATP synthase subunit beta Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1MRB8 9.04e-43 160 30 11 422 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
P49376 9.32e-43 160 33 6 308 3 ATP2 ATP synthase subunit beta, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A0KQX8 9.45e-43 160 32 3 304 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q46VY0 1.02e-42 160 31 5 329 3 atpD ATP synthase subunit beta Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P35110 1.04e-42 159 33 4 303 3 atpD ATP synthase subunit beta Chlorobium limicola
Q48AW0 1.15e-42 159 30 6 382 3 atpD ATP synthase subunit beta Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B2TK00 1.23e-42 159 31 3 301 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
B1KSS8 1.32e-42 159 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
A5CVI6 1.59e-42 159 32 3 302 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B2UZK0 1.79e-42 159 31 3 301 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
Q9HT20 1.93e-42 159 30 7 382 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 1.93e-42 159 30 7 382 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 1.93e-42 159 30 7 382 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 1.93e-42 159 30 7 382 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
P42465 2.18e-42 159 33 4 303 3 atpD ATP synthase subunit beta Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q313W0 2.2e-42 159 31 9 390 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q3J6N1 2.57e-42 158 33 4 295 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1VFJ5 2.59e-42 159 29 9 394 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 2.59e-42 159 29 9 394 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8FGT4 2.63e-42 159 30 9 394 3 atpD ATP synthase subunit beta Desulfatibacillum aliphaticivorans
Q9GPE9 2.77e-42 159 30 12 405 1 Tb427.03.1380 ATP synthase subunit beta, mitochondrial Trypanosoma brucei brucei
A4SC45 2.84e-42 158 33 4 303 3 atpD ATP synthase subunit beta Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A6W3S8 2.93e-42 158 32 3 301 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
A2SC70 3.04e-42 159 32 8 339 3 atpD ATP synthase subunit beta Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q2RFX9 3.28e-42 158 31 4 302 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q03QY8 3.36e-42 158 33 8 316 3 atpD ATP synthase subunit beta Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
C0HK52 3.38e-42 159 30 10 391 1 ATP2 ATP synthase subunit beta, mitochondrial Pichia angusta
Q8KAC9 3.75e-42 158 33 4 303 3 atpD2 ATP synthase subunit beta 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B1JRN2 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)
Q1CCH5 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5T9 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM8 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis
B2K847 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C095 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE0 3.77e-42 158 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4STP3 4.06e-42 158 31 3 304 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
Q5QZI6 4.2e-42 158 29 6 382 3 atpD ATP synthase subunit beta Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1AXU2 4.44e-42 158 31 5 324 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
Q8XU76 4.57e-42 158 32 4 302 3 atpD ATP synthase subunit beta Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7VU44 5.24e-42 158 31 5 324 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9BPU7 5.3e-42 158 32 6 309 3 atpD ATP synthase subunit beta Delftia acidovorans (strain DSM 14801 / SPH-1)
A4Y187 5.35e-42 157 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
Q7W3B0 5.57e-42 158 31 5 324 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 5.57e-42 158 31 5 324 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3AP13 6.69e-42 157 31 6 333 3 atpD ATP synthase subunit beta Chlorobium chlorochromatii (strain CaD3)
C1D5G2 6.7e-42 157 32 3 301 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
A1W2T7 7.14e-42 157 32 5 309 3 atpD ATP synthase subunit beta Acidovorax sp. (strain JS42)
B9MBA3 7.28e-42 157 32 5 309 3 atpD ATP synthase subunit beta Acidovorax ebreus (strain TPSY)
Q88BX4 7.42e-42 157 29 6 381 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 7.42e-42 157 29 6 381 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A7NIQ9 7.44e-42 157 31 5 308 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q3A946 7.62e-42 157 32 5 303 3 atpD ATP synthase subunit beta Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B8DRD2 7.67e-42 157 30 10 396 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A6QB59 8.28e-42 157 30 8 357 3 atpD ATP synthase subunit beta Sulfurovum sp. (strain NBC37-1)
Q12GQ0 8.42e-42 157 31 9 368 3 atpD ATP synthase subunit beta Polaromonas sp. (strain JS666 / ATCC BAA-500)
B0BRX2 9.12e-42 157 30 7 375 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B0U598 9.74e-42 157 32 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
A6VWP9 9.85e-42 157 33 10 353 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
B4EEY9 1.03e-41 157 32 4 302 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q4AAV7 1.07e-41 157 30 10 388 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
B2VCA4 1.08e-41 157 32 3 302 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7VPP0 1.13e-41 157 30 7 375 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6LKZ6 1.14e-41 157 30 7 385 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
Q3IK50 1.16e-41 157 29 8 412 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
B0KRA8 1.2e-41 157 29 6 381 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
A9AJG4 1.21e-41 157 31 4 302 3 atpD ATP synthase subunit beta Burkholderia multivorans (strain ATCC 17616 / 249)
B3H2P3 1.47e-41 156 30 7 375 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 1.47e-41 156 30 7 375 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q1I2I7 1.5e-41 156 29 6 382 3 atpD ATP synthase subunit beta Pseudomonas entomophila (strain L48)
Q2NQ86 1.58e-41 156 31 3 302 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
Q0VKX4 1.6e-41 156 33 4 296 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A8ZNR6 1.63e-41 156 33 8 331 3 atpD ATP synthase subunit beta Acaryochloris marina (strain MBIC 11017)
Q2YCA3 1.65e-41 156 30 5 350 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7VQV6 1.7e-41 156 30 9 391 3 atpD ATP synthase subunit beta Blochmanniella floridana
Q0BJL5 1.96e-41 156 31 4 302 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4F0E7 2.11e-41 156 29 7 382 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
Q15MU4 2.14e-41 156 32 3 302 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q4A8V9 2.18e-41 156 30 7 349 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 7448)
A1WZT1 2.2e-41 156 32 3 301 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
B1XSD4 2.24e-41 156 30 5 329 3 atpD ATP synthase subunit beta Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q5P4E2 2.24e-41 156 31 7 352 3 atpD ATP synthase subunit beta Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q0K5M7 2.3e-41 156 31 7 356 3 atpD ATP synthase subunit beta Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6CFT7 2.45e-41 157 30 10 391 1 ATP2 ATP synthase subunit beta, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
A4SUT4 2.46e-41 156 30 5 329 3 atpD ATP synthase subunit beta Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A1JTC6 2.5e-41 156 31 3 302 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7NA94 2.58e-41 156 31 3 302 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A0Q2Z4 2.66e-41 156 32 3 301 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
Q87E90 2.69e-41 156 32 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 2.69e-41 156 32 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
Q0A4M8 2.7e-41 155 32 3 301 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q601Z5 2.76e-41 156 32 9 343 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 232)
Q9PE85 2.89e-41 155 32 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
A2S6J8 3.14e-41 155 31 4 302 3 atpD ATP synthase subunit beta Burkholderia mallei (strain NCTC 10229)
Q1QSD0 3.35e-41 155 29 9 412 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3K441 3.49e-41 155 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
Q1BRB0 3.68e-41 155 31 4 302 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain AU 1054)
B1JSV7 3.68e-41 155 31 4 302 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain MC0-3)
A0K2Y3 3.68e-41 155 31 4 302 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain HI2424)
B3R7L5 3.83e-41 155 31 6 341 3 atpD ATP synthase subunit beta Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q3B6W8 4.44e-41 155 32 4 303 3 atpD1 ATP synthase subunit beta 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1VIV2 4.44e-41 155 31 10 368 3 atpD1 ATP synthase subunit beta 1 Polaromonas naphthalenivorans (strain CJ2)
Q2STE9 5.04e-41 155 31 4 302 1 atpD1 ATP synthase subunit beta 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PI0 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain K96243)
A3NF40 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 668)
Q3JXV8 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z0 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1106a)
A1V8T1 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain SAVP1)
Q62FR5 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ9 5.04e-41 155 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain NCTC 10247)
A4WGF5 5.2e-41 155 32 3 302 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
Q39KX6 5.52e-41 155 31 4 302 3 atpD ATP synthase subunit beta Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2JX57 6.08e-41 155 30 11 393 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-3-3Ab)
Q1GXN0 7.02e-41 155 30 7 352 3 atpD ATP synthase subunit beta Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q39Q56 7.33e-41 155 30 10 394 3 atpD ATP synthase subunit beta Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q03EL4 7.9e-41 155 32 5 306 3 atpD ATP synthase subunit beta Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B4RS81 8.19e-41 154 31 3 301 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A8GTS6 8.36e-41 155 28 11 409 3 atpD ATP synthase subunit beta Rickettsia rickettsii (strain Sheila Smith)
B0BVB6 8.36e-41 155 28 11 409 3 atpD ATP synthase subunit beta Rickettsia rickettsii (strain Iowa)
A7MMW9 8.39e-41 154 31 3 302 3 atpD ATP synthase subunit beta Cronobacter sakazakii (strain ATCC BAA-894)
A5CYE2 8.98e-41 154 32 5 302 3 atpD ATP synthase subunit beta Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q2KU36 9.02e-41 154 31 4 302 3 atpD ATP synthase subunit beta Bordetella avium (strain 197N)
B3EJK9 9.81e-41 154 31 6 333 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain BS1)
Q3Z8Z2 1.07e-40 154 32 9 356 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B1YQL4 1.09e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain MC40-6)
A4JA35 1.22e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1WF58 1.26e-40 154 33 6 309 3 atpD ATP synthase subunit beta Verminephrobacter eiseniae (strain EF01-2)
Q0C100 1.35e-40 154 28 10 397 3 atpD ATP synthase subunit beta Hyphomonas neptunium (strain ATCC 15444)
Q82XP8 1.71e-40 154 32 3 306 3 atpD ATP synthase subunit beta Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q74GY0 1.77e-40 154 30 10 394 3 atpD ATP synthase subunit beta Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B9DME3 1.78e-40 154 32 6 303 3 atpD ATP synthase subunit beta Staphylococcus carnosus (strain TM300)
A8G7M8 1.8e-40 154 31 3 302 3 atpD ATP synthase subunit beta Serratia proteamaculans (strain 568)
A9HY42 1.8e-40 154 31 5 324 3 atpD ATP synthase subunit beta Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q0AJB0 1.85e-40 153 31 3 306 3 atpD1 ATP synthase subunit beta 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8RGE2 1.88e-40 154 31 6 304 1 atpD ATP synthase subunit beta Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6CYJ5 2.2e-40 153 31 3 302 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q65Q07 2.24e-40 153 30 3 301 3 atpD ATP synthase subunit beta Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6TG36 2.27e-40 153 31 3 302 3 atpD ATP synthase subunit beta Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZM4 2.27e-40 153 31 3 302 3 atpD ATP synthase subunit beta Klebsiella pneumoniae (strain 342)
A1SBU0 2.57e-40 153 30 6 332 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1UY41 2.59e-40 156 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain SAVP1)
Q62EB0 2.59e-40 156 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain ATCC 23344)
A3MAS4 2.59e-40 156 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain NCTC 10247)
B1JFU1 2.66e-40 153 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas putida (strain W619)
C5BF40 2.67e-40 153 31 3 302 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
Q0AEJ6 2.68e-40 154 33 6 302 3 atpD2 ATP synthase subunit beta 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3JJP7 2.7e-40 156 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 1710b)
Q63IX0 2.75e-40 156 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain K96243)
A3P8L5 2.75e-40 156 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 1106a)
Q97CP9 2.84e-40 153 30 8 379 3 atpB V-type ATP synthase beta chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q477Z1 2.86e-40 153 31 7 352 3 atpD ATP synthase subunit beta Dechloromonas aromatica (strain RCB)
A4IW24 2.88e-40 153 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 2.88e-40 153 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 2.88e-40 153 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
B0RWC2 2.99e-40 153 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain B100)
A0Q8D9 3.06e-40 153 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
Q8PCZ5 3.31e-40 153 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQF4 3.31e-40 153 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain 8004)
A8ACN6 3.4e-40 153 31 3 302 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8A6J5 3.51e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
A3NN58 3.62e-40 155 31 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 668)
B9LZ84 3.64e-40 153 30 10 394 3 atpD ATP synthase subunit beta Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A9F3R4 3.69e-40 153 32 7 308 3 atpD ATP synthase subunit beta Sorangium cellulosum (strain So ce56)
Q7P095 3.7e-40 153 32 5 308 3 atpD ATP synthase subunit beta Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7CPE2 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 3.77e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
Q19V65 3.94e-40 153 31 14 403 3 atpB ATP synthase subunit beta, chloroplastic Chlorokybus atmophyticus
B5BIN6 4e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 4e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3YVN6 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK77 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 4.13e-40 152 31 3 302 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
B1X9W0 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 4.13e-40 152 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
Q329S1 4.21e-40 152 31 3 302 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
A5G9D8 4.23e-40 152 30 10 394 3 atpD ATP synthase subunit beta Geotalea uraniireducens (strain Rf4)
Q1AVH9 4.29e-40 153 30 12 406 3 atpD ATP synthase subunit beta Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B5RFW3 4.34e-40 152 31 3 302 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q3BP15 4.4e-40 152 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
C6DJH2 4.61e-40 152 31 3 302 3 atpD ATP synthase subunit beta Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8PGG7 4.72e-40 152 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas axonopodis pv. citri (strain 306)
Q5H4Y4 5.07e-40 152 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB0 5.07e-40 152 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q4 5.07e-40 152 32 5 308 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8MBQ4 5.21e-40 153 29 14 398 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea coccinea
P22068 5.37e-40 153 32 6 308 1 atp2 ATP synthase subunit beta, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B3PIS7 5.39e-40 152 32 4 303 3 atpD ATP synthase subunit beta Cellvibrio japonicus (strain Ueda107)
Q1XDM8 5.45e-40 152 30 15 403 3 atpB ATP synthase subunit beta, chloroplastic Neopyropia yezoensis
Q8D3J3 5.9e-40 152 29 9 389 3 atpD ATP synthase subunit beta Wigglesworthia glossinidia brevipalpis
A1U7H4 6.1e-40 152 31 4 302 3 atpD ATP synthase subunit beta Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A5EXL4 6.19e-40 152 31 3 302 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
B8F774 6.32e-40 152 32 4 296 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
B2SEY1 6.62e-40 152 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2ST34 6.85e-40 152 32 6 301 3 atpD ATP synthase subunit beta Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A1BCJ2 7.01e-40 152 32 4 303 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A1TJ41 7.06e-40 152 31 8 339 3 atpD ATP synthase subunit beta Paracidovorax citrulli (strain AAC00-1)
O50290 7.2e-40 152 28 11 406 3 atpD ATP synthase subunit beta Rickettsia prowazekii (strain Madrid E)
Q494C3 7.61e-40 152 31 6 313 3 atpD ATP synthase subunit beta Blochmanniella pennsylvanica (strain BPEN)
Q2T873 7.66e-40 153 30 6 376 3 atpA2 ATP synthase subunit alpha 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0BK84 7.87e-40 152 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 7.87e-40 152 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 7.87e-40 152 31 4 302 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B8DYT0 8.08e-40 152 32 5 303 3 atpD ATP synthase subunit beta Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q0C9L8 8.25e-40 151 31 5 307 3 ctvE ATP synthase subunit beta, mitochondrial Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9CKW1 8.47e-40 152 31 3 301 3 atpD ATP synthase subunit beta Pasteurella multocida (strain Pm70)
Q05FY1 8.74e-40 151 31 4 301 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
A9NGW2 9.38e-40 151 29 8 383 3 atpD ATP synthase subunit beta Acholeplasma laidlawii (strain PG-8A)
Q67TB7 1.01e-39 152 28 6 345 3 atpD ATP synthase subunit beta Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B8I579 1.03e-39 151 31 6 303 3 atpD ATP synthase subunit beta Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
C4LDW0 1.09e-39 151 30 5 324 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B2G691 1.12e-39 152 33 12 330 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIR1 1.12e-39 152 33 12 330 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri (strain DSM 20016)
Q04ZU5 1.23e-39 151 30 9 386 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 1.23e-39 151 30 9 386 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B9LBM0 1.23e-39 151 31 6 309 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 1.23e-39 151 31 6 309 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A8YUK1 1.28e-39 151 30 9 358 3 atpD ATP synthase subunit beta Lactobacillus helveticus (strain DPC 4571)
B0THN2 1.3e-39 151 32 6 304 3 atpD ATP synthase subunit beta Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q6MS94 1.33e-39 151 33 6 301 3 atpD ATP synthase subunit beta Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
A7HIX7 1.33e-39 151 31 13 398 3 atpD ATP synthase subunit beta Anaeromyxobacter sp. (strain Fw109-5)
Q13SQ2 1.41e-39 151 31 4 302 3 atpD2 ATP synthase subunit beta 2 Paraburkholderia xenovorans (strain LB400)
B1I6J7 1.43e-39 151 28 10 397 3 atpD ATP synthase subunit beta Desulforudis audaxviator (strain MP104C)
A9WNC8 1.53e-39 151 32 14 394 3 atpD ATP synthase subunit beta Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q3ZZT7 1.6e-39 151 31 9 356 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain CBDB1)
A5FRQ5 1.6e-39 151 31 9 356 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A1AP52 1.62e-39 151 30 13 399 3 atpD2 ATP synthase subunit beta 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q0I5X3 1.62e-39 151 28 6 381 3 atpD ATP synthase subunit beta Histophilus somni (strain 129Pt)
P43715 1.65e-39 151 31 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN64 1.65e-39 151 31 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain 86-028NP)
Q5FRC5 1.7e-39 151 32 7 314 3 atpD1 ATP synthase subunit beta 1 Gluconobacter oxydans (strain 621H)
A5UA11 1.72e-39 150 31 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittEE)
A4XKX0 1.75e-39 151 31 4 303 3 atpD ATP synthase subunit beta Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B0TWS7 1.84e-39 150 31 4 302 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B0UWG5 1.89e-39 150 28 6 381 3 atpD ATP synthase subunit beta Histophilus somni (strain 2336)
A1ALL7 1.94e-39 151 30 13 399 3 atpD1 ATP synthase subunit beta 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q5FNY6 2.05e-39 151 34 2 269 3 atpA2 ATP synthase subunit alpha 2 Gluconobacter oxydans (strain 621H)
A5V3X5 2.46e-39 151 28 13 437 3 atpD ATP synthase subunit beta Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A5UGY9 2.53e-39 150 31 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittGG)
P42468 2.58e-39 150 31 5 302 3 atpD ATP synthase subunit beta Burkholderia cepacia
B9E8E6 2.6e-39 150 31 11 364 3 atpD ATP synthase subunit beta Macrococcus caseolyticus (strain JCSC5402)
B9MS68 2.72e-39 150 31 4 303 3 atpD ATP synthase subunit beta Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q3SVJ1 3.21e-39 150 30 11 391 3 atpD ATP synthase subunit beta Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
C3PLT1 3.39e-39 150 28 11 409 3 atpD ATP synthase subunit beta Rickettsia africae (strain ESF-5)
A5N3H7 3.66e-39 150 30 3 301 3 atpD ATP synthase subunit beta Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q5PAN2 3.91e-39 150 29 12 396 3 atpD ATP synthase subunit beta Anaplasma marginale (strain St. Maries)
Q8E8C0 4.23e-39 150 30 6 332 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0L2S8 4.32e-39 150 30 6 332 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
Q5LNP1 4.52e-39 150 31 12 398 3 atpD ATP synthase subunit beta Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O03069 4.54e-39 150 31 13 400 3 atpB ATP synthase subunit beta, chloroplastic (Fragment) Equisetum arvense
A6VL57 4.87e-39 149 30 3 301 3 atpD ATP synthase subunit beta Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1K1S2 5.01e-39 150 31 4 302 3 atpD ATP synthase subunit beta Azoarcus sp. (strain BH72)
A6T470 5.06e-39 150 31 5 309 3 atpD ATP synthase subunit beta Janthinobacterium sp. (strain Marseille)
Q6AQ10 5.11e-39 150 31 12 398 3 atpD ATP synthase subunit beta Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B4RJG0 5.14e-39 149 30 7 338 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z0 5.14e-39 149 30 7 338 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q11DD5 5.47e-39 150 32 6 309 3 atpD ATP synthase subunit beta Chelativorans sp. (strain BNC1)
Q9JW70 5.8e-39 149 30 7 338 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P42470 6.05e-39 149 27 8 385 3 atpD ATP synthase subunit beta Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A4GAG9 6.07e-39 149 31 5 309 3 atpD ATP synthase subunit beta Herminiimonas arsenicoxydans
Q3A083 6.11e-39 149 31 7 353 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A4WUM7 6.34e-39 149 30 13 400 3 atpD ATP synthase subunit beta Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
P50002 6.58e-39 149 30 6 305 1 atpD ATP synthase subunit beta, sodium ion specific Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q1GAW5 7.39e-39 149 29 11 388 3 atpD ATP synthase subunit beta Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A2RMI2 7.57e-39 149 29 12 391 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain MG1363)
Q04BA3 7.77e-39 149 30 9 358 3 atpD ATP synthase subunit beta Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q07VU4 8.07e-39 149 31 4 302 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
Q223D6 8.53e-39 149 31 5 309 3 atpD1 ATP synthase subunit beta 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
C4K227 8.65e-39 149 29 15 404 3 atpD ATP synthase subunit beta Rickettsia peacockii (strain Rustic)
Q2JIV9 8.67e-39 149 29 11 394 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-2-3B'a(2-13))
Q4FQ37 8.67e-39 149 32 8 327 3 atpD ATP synthase subunit beta Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q21DK8 8.68e-39 149 32 8 333 3 atpD ATP synthase subunit beta Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C3M9S1 8.98e-39 150 30 13 399 3 atpD ATP synthase subunit beta Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q4L7Y4 9.41e-39 149 30 12 389 3 atpD ATP synthase subunit beta Staphylococcus haemolyticus (strain JCSC1435)
P42469 9.51e-39 149 29 10 396 3 atpD ATP synthase subunit beta Stigmatella aurantiaca
A9KX06 9.88e-39 149 31 4 302 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 9.88e-39 149 31 4 302 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 9.88e-39 149 31 4 302 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 9.88e-39 149 31 4 302 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
Q4FP38 9.91e-39 149 28 10 402 3 atpD ATP synthase subunit beta Pelagibacter ubique (strain HTCC1062)
Q02XA5 9.93e-39 149 29 12 391 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain SK11)
B8CVU5 9.97e-39 149 30 4 302 3 atpD ATP synthase subunit beta Shewanella piezotolerans (strain WP3 / JCM 13877)
B8G6G6 1e-38 149 30 6 309 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
B8HAY9 1.02e-38 149 31 14 393 3 atpD ATP synthase subunit beta Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A1RQB0 1.03e-38 149 31 4 302 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 1.03e-38 149 31 4 302 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B5YBP8 1.04e-38 149 32 10 355 3 atpD ATP synthase subunit beta Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q5FKY0 1.12e-38 149 30 9 358 2 atpD ATP synthase subunit beta Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q95DR6 1.19e-38 149 29 12 397 3 atpB ATP synthase subunit beta, chloroplastic Agapanthus africanus
Q8F2J5 1.24e-38 149 29 9 386 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SX9 1.24e-38 149 29 9 386 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P47639 1.36e-38 149 29 9 381 3 atpD ATP synthase subunit beta Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A1A3C5 1.36e-38 149 31 15 399 3 atpD ATP synthase subunit beta Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A1KW11 1.45e-38 148 30 7 338 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M123 1.45e-38 148 30 7 338 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C (strain 053442)
A9KK92 1.51e-38 148 28 7 383 3 atpD ATP synthase subunit beta Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q5KUJ3 1.52e-38 148 31 6 304 1 atpD ATP synthase subunit beta Geobacillus kaustophilus (strain HTA426)
Q9LA80 1.54e-38 148 31 6 304 3 atpD ATP synthase subunit beta Geobacillus thermoleovorans
Q9Z687 1.58e-38 148 28 7 389 3 atpD ATP synthase subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C6E9F1 1.59e-38 148 29 10 394 3 atpD ATP synthase subunit beta Geobacter sp. (strain M21)
A8G1W5 1.62e-38 148 31 5 296 3 atpD ATP synthase subunit beta Shewanella sediminis (strain HAW-EB3)
A9H9A8 1.65e-38 149 30 12 396 3 atpD ATP synthase subunit beta Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B9IRT7 1.65e-38 148 29 11 388 3 atpD ATP synthase subunit beta Bacillus cereus (strain Q1)
B7HY64 1.65e-38 148 29 11 388 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH187)
Q72XE8 1.65e-38 148 29 11 388 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7VJ21 1.67e-38 148 27 9 387 3 atpD ATP synthase subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
P23704 1.67e-38 149 31 8 331 2 atp-2 ATP synthase subunit beta, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
B8D6S7 1.71e-38 148 30 4 307 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 1.71e-38 148 30 4 307 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 1.71e-38 148 30 4 307 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q1Q899 1.72e-38 148 32 8 327 3 atpD ATP synthase subunit beta Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9MUT5 1.74e-38 148 30 14 403 3 atpB ATP synthase subunit beta, chloroplastic Mesostigma viride
Q8MBQ1 1.75e-38 149 29 14 398 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea aquatica
B7JGN0 1.75e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH820)
Q92G88 1.86e-38 148 29 12 402 3 atpD ATP synthase subunit beta Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A1R7V3 1.86e-38 148 31 14 396 3 atpD ATP synthase subunit beta Paenarthrobacter aurescens (strain TC1)
B9K814 1.91e-38 148 33 8 345 3 atpB V-type ATP synthase beta chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A4ITI9 2e-38 148 31 5 303 3 atpD ATP synthase subunit beta Geobacillus thermodenitrificans (strain NG80-2)
Q9JXQ2 2.03e-38 148 30 7 338 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
C5D990 2.04e-38 148 31 6 304 3 atpD ATP synthase subunit beta Geobacillus sp. (strain WCH70)
Q6HAY0 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U3 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus cereus (strain ZK / E33L)
C1F0M8 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus cereus (strain 03BB102)
Q81JZ5 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus anthracis
A0RL95 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus thuringiensis (strain Al Hakam)
C3LFH9 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F4 2.09e-38 148 30 13 391 3 atpD ATP synthase subunit beta Bacillus anthracis (strain A0248)
Q07232 2.16e-38 148 31 6 313 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q180W5 2.23e-38 148 28 7 385 3 atpD ATP synthase subunit beta Clostridioides difficile (strain 630)
Q68VU8 2.26e-38 148 29 15 403 3 atpD ATP synthase subunit beta Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q3A605 2.35e-38 148 28 9 391 3 atpD1 ATP synthase subunit beta 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q0HPG1 2.35e-38 148 30 6 332 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-7)
Q0HD79 2.52e-38 147 30 6 332 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-4)
B5EFI7 2.52e-38 148 29 10 394 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q32RI0 2.54e-38 148 30 15 402 3 atpB ATP synthase subunit beta, chloroplastic Zygnema circumcarinatum
Q9ZK81 2.56e-38 148 29 7 354 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
A5WBW1 2.57e-38 148 31 7 315 3 atpD ATP synthase subunit beta Psychrobacter sp. (strain PRwf-1)
Q8MBK3 2.63e-38 148 29 13 398 3 atpB ATP synthase subunit beta, chloroplastic Cressa truxillensis
Q2LQZ7 2.64e-38 148 32 7 308 3 atpA1 ATP synthase subunit alpha 1 Syntrophus aciditrophicus (strain SB)
Q8MBQ3 2.69e-38 148 29 14 398 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea quamoclit
A3QJR0 2.79e-38 147 30 4 302 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q9HM64 2.85e-38 147 32 6 317 3 atpB V-type ATP synthase beta chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9UXU8 2.86e-38 147 29 12 432 3 atpB V-type ATP synthase beta chain Pyrococcus abyssi (strain GE5 / Orsay)
B1KQ34 3.06e-38 147 28 8 385 3 atpD ATP synthase subunit beta Shewanella woodyi (strain ATCC 51908 / MS32)
B9L7Y7 3.18e-38 147 29 12 390 3 atpD ATP synthase subunit beta Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q8MBM3 3.19e-38 148 29 13 398 3 atpB ATP synthase subunit beta, chloroplastic Convolvulus arvensis
Q1GQS5 3.36e-38 148 30 7 322 3 atpD ATP synthase subunit beta Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q4UK18 3.45e-38 147 27 10 409 3 atpD ATP synthase subunit beta Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8RC15 3.55e-38 147 30 4 302 3 atpD ATP synthase subunit beta Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7H8M1 3.63e-38 148 29 14 398 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea setosa
A7Y3E6 3.7e-38 148 29 14 398 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea purpurea
B5Z8D0 3.75e-38 147 29 7 354 3 atpD ATP synthase subunit beta Helicobacter pylori (strain G27)
B6YV15 3.82e-38 147 28 11 442 3 atpB V-type ATP synthase beta chain Thermococcus onnurineus (strain NA1)
Q9CES0 3.83e-38 147 29 11 390 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. lactis (strain IL1403)
B8GFQ7 3.92e-38 147 31 9 367 3 atpB V-type ATP synthase beta chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
O06505 4.01e-38 147 29 11 435 3 atpB V-type ATP synthase beta chain Desulfurococcus sp. (strain SY)
Q8MBM4 4.01e-38 147 29 13 398 3 atpB ATP synthase subunit beta, chloroplastic Calystegia sepium
A8HAG3 4.01e-38 147 30 4 302 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A4J999 4.01e-38 147 28 9 366 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q5FGY3 4.05e-38 148 31 8 312 3 atpD ATP synthase subunit beta Ehrlichia ruminantium (strain Gardel)
O57729 4.14e-38 147 29 11 431 3 atpB V-type ATP synthase beta chain Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9TJR9 4.21e-38 147 30 11 398 3 atpB ATP synthase subunit beta, plastid Prototheca wickerhamii
P05037 4.37e-38 147 29 12 400 3 atpB ATP synthase subunit beta, chloroplastic Pisum sativum
Q5HB71 4.43e-38 148 31 8 312 3 atpD ATP synthase subunit beta Ehrlichia ruminantium (strain Welgevonden)
A0AFR1 4.75e-38 147 29 11 400 3 atpD1 ATP synthase subunit beta 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P13357 4.91e-38 147 29 12 426 3 atpD ATP synthase subunit beta Cellulophaga lytica
P56480 4.97e-38 148 29 12 392 1 Atp5f1b ATP synthase subunit beta, mitochondrial Mus musculus
P06576 5.07e-38 148 32 7 309 1 ATP5F1B ATP synthase subunit beta, mitochondrial Homo sapiens
Q9MTY2 5.18e-38 147 29 12 397 3 atpB ATP synthase subunit beta, chloroplastic Saruma henryi
P10719 5.32e-38 148 32 7 309 1 Atp5f1b ATP synthase subunit beta, mitochondrial Rattus norvegicus
Q814W2 5.36e-38 147 29 10 387 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK1 5.36e-38 147 29 10 387 3 atpD ATP synthase subunit beta Bacillus cereus (strain B4264)
Q5M5J1 5.47e-38 147 28 9 389 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q7MGI0 5.5e-38 147 30 11 395 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain YJ016)
Q8DDG8 5.5e-38 147 30 11 395 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain CMCP6)
A2RFC2 5.53e-38 147 28 9 387 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1WUC6 5.53e-38 147 30 8 342 3 atpD ATP synthase subunit beta Ligilactobacillus salivarius (strain UCC118)
Q1J7F9 5.7e-38 147 28 9 387 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHN5 5.7e-38 147 28 9 387 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P1K5 5.7e-38 147 28 9 387 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCY0 5.7e-38 147 28 9 387 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q06FV3 5.73e-38 147 29 12 400 3 atpB ATP synthase subunit beta, chloroplastic Pelargonium hortorum

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS06615
Feature type CDS
Gene fliI
Product flagellar protein export ATPase FliI
Location 1377484 - 1378848 (strand: 1)
Length 1365 (nucleotides) / 454 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_205
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)
NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02412 flagellum-specific ATP synthase [EC:7.4.2.8] Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG023641 flagellum-specific ATP synthase FliI VF0394 Motility

Protein Sequence

MTARIGRWIGALDGLDARMSGVPMTRHYGRLTKITGLVMEAEGIKMPLGATCFIERIINGKTEEVICEVVGFNGPRMLLMPLAELEGIAPGARVYAQSTGAGGQTSRQLPLGDELLGRILDASGNPLDGKGPLDAKIRAPLYTPPINPLERSPIKDVLDVGVRAINALLTVGRGQRMGLFAGSGVGKSVLLGMMARFTQADIIVVGLIGERGREVKDFIENILGAEGLKRAVVVAAPADVSPLLRMQGASYATRIAEYYRDLGRNVLLIMDSLTRYSMAQREIALAIGEPPATKGYPPSVFAKLPALVERAGNGKNGGSITAFYTVLTEGDDQQDPIADSARAILDGHIVLSRSLAESGHYPAIDIEASISRAMTELIDKSHYKKIQRFKQLTSAYQRNRDLINVGAYAAGSDPMLDMAIQWFPHMAKFLQQDIDERCDYPDACEQLDQVVPQA

Flanking regions ( +/- flanking 50bp)

GCCACACGCTGGCAGGAGCTGTGCCGGTTATATGCCCCGGAGATCTCATTATGACGGCGCGGATTGGCCGCTGGATTGGCGCGTTGGACGGGCTGGATGCACGGATGAGCGGCGTGCCGATGACCCGCCATTACGGGCGGCTCACTAAAATCACCGGACTTGTGATGGAAGCGGAAGGCATCAAAATGCCTCTCGGTGCGACCTGTTTTATCGAGCGCATCATCAACGGCAAAACAGAAGAAGTCATCTGTGAAGTGGTCGGATTCAACGGACCACGCATGCTGCTGATGCCGCTGGCTGAGCTGGAAGGAATAGCGCCCGGTGCGCGCGTTTATGCGCAGTCTACCGGCGCGGGCGGGCAGACCAGCCGCCAGTTGCCGCTGGGCGATGAACTGCTCGGGCGGATCCTTGATGCATCCGGCAATCCGCTGGACGGCAAAGGTCCGCTGGACGCTAAAATACGCGCACCTCTGTATACCCCGCCGATTAACCCGCTGGAGCGCAGCCCGATCAAAGATGTACTCGATGTCGGTGTGCGGGCCATCAATGCTCTGCTGACAGTCGGGCGCGGGCAGCGGATGGGATTGTTTGCCGGCTCCGGTGTCGGAAAAAGTGTGCTGCTCGGCATGATGGCGCGCTTTACTCAGGCAGACATTATTGTTGTCGGACTGATTGGCGAGCGCGGGCGCGAAGTTAAAGATTTTATTGAAAATATTCTCGGCGCGGAAGGATTAAAACGCGCCGTTGTTGTCGCAGCACCGGCAGATGTCTCCCCTCTGCTGAGAATGCAGGGCGCATCTTATGCCACCCGTATCGCGGAGTATTACCGTGATCTGGGTCGCAATGTGCTGTTAATTATGGATTCCCTGACCCGTTACAGCATGGCACAACGTGAAATTGCGCTTGCCATCGGAGAACCGCCTGCTACGAAAGGCTATCCTCCGTCGGTGTTCGCAAAATTACCGGCACTGGTAGAACGGGCGGGTAACGGGAAAAACGGTGGCTCTATTACAGCGTTTTATACTGTCCTGACCGAAGGCGATGACCAGCAGGATCCGATTGCTGACTCCGCGCGGGCCATTCTTGACGGCCATATCGTGCTGTCACGCTCGCTGGCTGAATCCGGACACTACCCTGCTATCGATATAGAAGCATCAATCAGCCGTGCAATGACAGAACTTATCGACAAAAGCCATTACAAGAAAATACAGCGGTTCAAACAGCTGACGTCCGCCTATCAGCGCAACCGTGACCTGATTAATGTCGGCGCATATGCCGCAGGCAGTGATCCGATGCTGGACATGGCGATTCAGTGGTTCCCGCACATGGCAAAATTTCTGCAACAGGATATCGATGAACGCTGTGATTACCCGGATGCCTGTGAGCAGCTTGATCAGGTGGTGCCGCAAGCGTAACGAGGCCGTCAATGTCAAAAAATAATGCATTAACCACACTGTTAAATTTA