Homologs in group_205

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00605 FBDBKF_00605 100.0 Morganella morganii S1 fliI flagellar protein export ATPase FliI
EHELCC_00940 EHELCC_00940 100.0 Morganella morganii S2 fliI flagellar protein export ATPase FliI
NLDBIP_02520 NLDBIP_02520 100.0 Morganella morganii S4 fliI flagellar protein export ATPase FliI
HKOGLL_03010 HKOGLL_03010 100.0 Morganella morganii S5 fliI flagellar protein export ATPase FliI
F4V73_RS06615 F4V73_RS06615 94.9 Morganella psychrotolerans fliI flagellar protein export ATPase FliI
F4V73_RS08315 F4V73_RS08315 43.8 Morganella psychrotolerans - FliI/YscN family ATPase
PMI_RS07975 PMI_RS07975 79.1 Proteus mirabilis HI4320 fliI flagellar protein export ATPase FliI

Distribution of the homologs in the orthogroup group_205

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_205

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P26465 0.0 649 71 2 454 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52612 0.0 623 71 2 442 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
P57178 0.0 535 54 1 452 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9I4N1 0.0 528 63 3 427 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KA42 0.0 525 54 1 452 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AZ7 1.34e-163 472 51 3 451 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P23445 7.59e-138 405 49 9 437 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
P52607 2.23e-124 371 41 2 440 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O83417 7.1e-124 370 46 3 426 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
P80153 7.56e-122 365 45 3 440 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
B8H363 4.42e-116 350 46 7 434 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 4.42e-116 350 46 7 434 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9ZJJ3 4.22e-114 345 43 4 441 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O07025 1.12e-113 344 43 4 441 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
O67531 2.59e-112 340 42 7 433 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
P40291 2.25e-110 335 44 4 412 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 2.25e-110 335 44 4 412 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 2.48e-110 335 44 4 412 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P55717 8.12e-110 334 43 4 422 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P74857 1.05e-101 313 42 4 426 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8RK01 5.26e-98 304 41 5 442 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
Q887B5 1.03e-97 303 41 5 442 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q52371 2.4e-97 302 41 5 442 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
O34171 1.66e-90 285 46 3 326 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 1.26e-87 278 46 3 332 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
P0A1C2 3.12e-86 273 37 3 428 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 3.12e-86 273 37 3 428 1 sctN Type 3 secretion system ATPase Shigella flexneri
P0A1B9 6.99e-85 270 38 5 413 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 6.99e-85 270 38 5 413 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
Q2LR05 3.85e-48 174 33 10 390 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
A8ZUA1 4.64e-46 169 31 14 425 3 atpD ATP synthase subunit beta Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
O50292 1.03e-45 168 34 5 304 3 atpD ATP synthase subunit beta Aquifex pyrophilus
A9NBD0 1.09e-45 167 33 3 302 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
O67828 1.14e-45 168 34 6 319 3 atpD ATP synthase subunit beta Aquifex aeolicus (strain VF5)
Q83AF5 1.64e-45 167 33 3 302 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 1.64e-45 167 33 3 302 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
Q60CR4 2.59e-44 164 33 4 323 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q3SF66 9.84e-44 162 32 3 301 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
A3DIM9 1.51e-43 162 29 11 416 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B8J439 2.87e-43 161 30 11 405 3 atpD ATP synthase subunit beta Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A7N6Q5 2.9e-43 161 30 9 384 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
B5YI24 3.98e-43 161 31 3 301 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q5WSG8 5.39e-43 160 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 5.39e-43 160 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 5.39e-43 160 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 5.39e-43 160 33 3 302 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
P42466 6.08e-43 160 29 10 401 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
A4VS62 8.79e-43 160 29 8 412 3 atpD ATP synthase subunit beta Stutzerimonas stutzeri (strain A1501)
Q31DM0 9.05e-43 160 32 3 301 3 atpD ATP synthase subunit beta Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q87TT4 1.29e-42 159 31 8 383 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5UQN3 1.47e-42 159 32 5 308 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
B2FHY8 1.63e-42 159 33 5 308 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain K279a)
B4SJR9 1.73e-42 159 33 5 308 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain R551-3)
Q4ZL24 1.74e-42 159 31 9 386 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
A5HY52 2.11e-42 159 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 2.11e-42 159 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 2.11e-42 159 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
B3QUP6 2.19e-42 159 30 8 399 3 atpD ATP synthase subunit beta Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
C1FQP5 2.48e-42 159 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
A7G9Q9 2.9e-42 158 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 2.9e-42 158 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
P41168 3.07e-42 158 32 4 295 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
B3EDQ7 3.18e-42 158 33 6 319 3 atpD ATP synthase subunit beta Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q48BG5 3.31e-42 158 31 5 330 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B4SAN6 3.45e-42 158 33 7 318 3 atpD ATP synthase subunit beta Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q5QZI6 3.57e-42 158 29 8 384 3 atpD ATP synthase subunit beta Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q48AW0 3.64e-42 158 29 6 382 3 atpD ATP synthase subunit beta Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0VBP3 4.57e-42 158 31 7 335 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 4.57e-42 158 31 7 335 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 4.57e-42 158 31 7 335 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 4.57e-42 158 31 7 335 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 4.57e-42 158 31 7 335 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 4.57e-42 158 31 7 335 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
Q3IK50 5.59e-42 157 29 8 412 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
B2TK00 6.22e-42 157 31 4 314 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
A6LQH6 6.28e-42 157 31 4 314 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P35110 6.3e-42 157 33 4 303 3 atpD ATP synthase subunit beta Chlorobium limicola
B8GRB8 7.03e-42 157 31 3 301 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
C3K1E6 7.12e-42 157 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
Q6FFK0 7.15e-42 157 31 7 335 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2S6P1 7.25e-42 157 31 6 332 3 atpD ATP synthase subunit beta Hahella chejuensis (strain KCTC 2396)
A8LN39 7.49e-42 157 34 4 308 3 atpD1 ATP synthase subunit beta 1 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q8XID4 7.5e-42 157 28 7 402 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 7.5e-42 157 28 7 402 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A0LLF8 8.37e-42 157 30 11 404 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2UZK0 8.88e-42 157 31 4 314 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
P42465 9.27e-42 157 33 5 316 3 atpD ATP synthase subunit beta Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q0SQZ5 9.57e-42 157 28 7 402 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
A9AVV4 1.04e-41 157 29 10 401 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q1MRB8 1.05e-41 157 30 10 405 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
C0HK52 1.08e-41 157 30 10 391 1 ATP2 ATP synthase subunit beta, mitochondrial Pichia angusta
Q8KAC9 1.09e-41 157 33 5 316 3 atpD2 ATP synthase subunit beta 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8FGT4 1.18e-41 157 30 10 407 3 atpD ATP synthase subunit beta Desulfatibacillum aliphaticivorans
A7NIQ9 1.34e-41 157 31 5 308 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A6W3S8 1.35e-41 156 32 3 301 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
A1VFJ5 1.36e-41 157 29 10 407 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 1.36e-41 157 29 10 407 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8DRD2 1.37e-41 157 29 10 407 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
P00830 1.48e-41 157 30 10 390 1 ATP2 ATP synthase subunit beta, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HT20 1.5e-41 156 30 9 409 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 1.5e-41 156 30 9 409 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 1.5e-41 156 30 9 409 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 1.5e-41 156 30 9 409 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
A0KQX8 1.73e-41 156 31 3 304 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q313W0 1.75e-41 156 29 10 418 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1QSD0 2.12e-41 156 30 8 395 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2RFX9 2.41e-41 156 31 4 302 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A5CVI6 3.08e-41 155 31 3 302 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B1KSS8 3.2e-41 155 31 7 355 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
Q9GPE9 3.31e-41 157 29 13 423 1 Tb427.03.1380 ATP synthase subunit beta, mitochondrial Trypanosoma brucei brucei
P49376 3.31e-41 156 33 6 308 3 ATP2 ATP synthase subunit beta, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q4K3A9 3.49e-41 155 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6LKZ6 3.49e-41 155 29 7 385 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
Q3A946 3.53e-41 155 32 6 316 3 atpD ATP synthase subunit beta Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
C1D5G2 4.19e-41 155 32 4 311 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
P42467 4.57e-41 154 29 5 315 3 atpD ATP synthase subunit beta (Fragment) Peptococcus niger
Q3J6N1 5.18e-41 155 33 4 295 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q3AP13 5.28e-41 155 32 5 316 3 atpD ATP synthase subunit beta Chlorobium chlorochromatii (strain CaD3)
B8DYT0 5.79e-41 155 32 6 329 3 atpD ATP synthase subunit beta Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q1LHL0 5.87e-41 155 32 4 302 3 atpD ATP synthase subunit beta Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0VKX4 6e-41 155 33 4 296 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4SC45 6.34e-41 155 32 5 316 3 atpD ATP synthase subunit beta Chlorobium phaeovibrioides (strain DSM 265 / 1930)
C5BKJ5 7.48e-41 155 33 7 321 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
A9AJG4 7.79e-41 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia multivorans (strain ATCC 17616 / 249)
B3EJK9 8.17e-41 154 33 8 320 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain BS1)
Q7VU44 9.2e-41 154 31 5 324 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W3B0 9.29e-41 154 31 5 324 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 9.29e-41 154 31 5 324 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1AXU2 9.41e-41 154 31 5 324 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
A4STP3 9.71e-41 154 31 3 304 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
A4Y187 9.73e-41 154 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
Q4AAV7 1.14e-40 154 29 9 388 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
B0U598 1.21e-40 154 32 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
Q0BJL5 1.26e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A6QB59 1.51e-40 154 29 10 391 3 atpD ATP synthase subunit beta Sulfurovum sp. (strain NBC37-1)
A2SC70 1.6e-40 154 32 6 309 3 atpD ATP synthase subunit beta Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q4A8V9 1.68e-40 154 30 7 351 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 7448)
A2S6J8 1.68e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia mallei (strain NCTC 10229)
Q7VPP0 1.74e-40 153 30 7 375 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B3H2P3 1.76e-40 153 30 7 375 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 1.76e-40 153 30 7 375 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BRX2 1.8e-40 153 30 7 375 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q1BRB0 1.9e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain AU 1054)
B1JSV7 1.9e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain MC0-3)
A0K2Y3 1.9e-40 154 31 4 302 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain HI2424)
Q0A4M8 2.11e-40 153 32 3 301 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q601Z5 2.18e-40 154 30 7 351 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 232)
B1JRN2 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)
Q1CCH5 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5T9 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM8 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis
B2K847 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C095 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE0 2.41e-40 153 28 7 384 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q03EL4 2.43e-40 153 32 8 338 3 atpD ATP synthase subunit beta Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q2STE9 2.61e-40 153 31 4 302 1 atpD1 ATP synthase subunit beta 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PI0 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain K96243)
A3NF40 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 668)
Q3JXV8 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z0 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1106a)
A1V8T1 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain SAVP1)
Q62FR5 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ9 2.61e-40 153 31 4 302 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain NCTC 10247)
Q1I2I7 2.63e-40 153 29 6 382 3 atpD ATP synthase subunit beta Pseudomonas entomophila (strain L48)
Q97CP9 2.92e-40 153 30 8 379 3 atpB V-type ATP synthase beta chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
B0KRA8 3.16e-40 153 28 8 411 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
Q87E90 3.37e-40 153 31 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 3.37e-40 153 31 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
Q46VY0 3.39e-40 153 31 4 302 3 atpD ATP synthase subunit beta Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9PE85 3.4e-40 153 31 5 308 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
Q39KX6 3.5e-40 153 31 4 302 3 atpD ATP synthase subunit beta Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3B6W8 3.86e-40 152 32 5 316 3 atpD1 ATP synthase subunit beta 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q2YCA3 4.14e-40 152 31 4 323 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q88BX4 4.15e-40 152 29 6 381 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 4.15e-40 152 29 6 381 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1WZT1 4.37e-40 152 32 3 301 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
Q8XU76 4.88e-40 152 31 4 302 3 atpD ATP synthase subunit beta Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3K441 4.99e-40 152 29 7 382 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
B4EEY9 5.52e-40 152 31 4 302 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q6CFT7 5.56e-40 153 33 6 308 1 ATP2 ATP synthase subunit beta, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
A4IW24 5.86e-40 152 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 5.86e-40 152 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 5.86e-40 152 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
Q5P4E2 6.06e-40 152 32 6 325 3 atpD ATP synthase subunit beta Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A0Q8D9 6.11e-40 152 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
B1YQL4 6.17e-40 152 31 4 302 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain MC40-6)
Q03QY8 6.72e-40 152 32 8 321 3 atpD ATP synthase subunit beta Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7VQV6 7.33e-40 152 29 7 385 3 atpD ATP synthase subunit beta Blochmanniella floridana
A4JA35 7.4e-40 152 31 4 302 3 atpD ATP synthase subunit beta Burkholderia vietnamiensis (strain G4 / LMG 22486)
B4F0E7 7.5e-40 152 29 7 382 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
Q15MU4 8.71e-40 152 29 6 382 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A8ZNR6 9.8e-40 151 33 8 331 3 atpD ATP synthase subunit beta Acaryochloris marina (strain MBIC 11017)
A0Q2Z4 1.05e-39 151 31 3 301 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
A9HY42 1.06e-39 151 31 5 324 3 atpD ATP synthase subunit beta Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A5CYE2 1.14e-39 151 33 5 302 3 atpD ATP synthase subunit beta Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B9MBA3 1.16e-39 151 32 5 309 3 atpD ATP synthase subunit beta Acidovorax ebreus (strain TPSY)
B4RS81 1.22e-39 151 30 5 331 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B9LZ84 1.29e-39 151 30 10 394 3 atpD ATP synthase subunit beta Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A1W2T7 1.3e-39 151 32 5 309 3 atpD ATP synthase subunit beta Acidovorax sp. (strain JS42)
A1BCJ2 1.35e-39 151 32 5 316 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B2SEY1 1.37e-39 151 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5FNY6 1.49e-39 152 34 2 269 3 atpA2 ATP synthase subunit alpha 2 Gluconobacter oxydans (strain 621H)
Q7NA94 1.49e-39 151 31 3 302 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B5YBP8 1.53e-39 151 32 5 302 3 atpD ATP synthase subunit beta Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q0BK84 1.58e-39 151 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 1.58e-39 151 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 1.58e-39 151 31 6 332 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4SUT4 1.67e-39 151 31 4 302 3 atpD ATP synthase subunit beta Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B0RWC2 1.72e-39 151 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain B100)
Q8PCZ5 1.79e-39 151 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQF4 1.79e-39 151 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain 8004)
B1XSD4 1.81e-39 151 31 4 302 3 atpD ATP synthase subunit beta Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q2JX57 1.82e-39 151 32 6 304 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-3-3Ab)
Q1GXN0 1.85e-39 151 31 6 325 3 atpD ATP synthase subunit beta Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0AJB0 2.02e-39 150 31 5 308 3 atpD1 ATP synthase subunit beta 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3Z8Z2 2.08e-39 150 30 12 391 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A6VWP9 2.17e-39 151 33 10 353 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
Q05FY1 2.29e-39 150 31 4 301 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
Q3BP15 2.31e-39 150 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A4WGF5 2.36e-39 150 31 3 302 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
A9BPU7 2.42e-39 150 31 6 309 3 atpD ATP synthase subunit beta Delftia acidovorans (strain DSM 14801 / SPH-1)
Q2LQZ7 2.58e-39 151 33 7 308 3 atpA1 ATP synthase subunit alpha 1 Syntrophus aciditrophicus (strain SB)
B1JFU1 2.6e-39 150 28 9 412 3 atpD ATP synthase subunit beta Pseudomonas putida (strain W619)
B2VCA4 2.71e-39 150 31 3 302 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q82XP8 2.74e-39 150 31 5 308 3 atpD ATP synthase subunit beta Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B9DME3 2.97e-39 150 30 13 403 3 atpD ATP synthase subunit beta Staphylococcus carnosus (strain TM300)
Q8PGG7 3e-39 150 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas axonopodis pv. citri (strain 306)
B3R7L5 3.08e-39 150 32 6 303 3 atpD ATP synthase subunit beta Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A4XKX0 3.14e-39 150 30 7 351 3 atpD ATP synthase subunit beta Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B8I579 3.23e-39 150 31 6 303 3 atpD ATP synthase subunit beta Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q0K5M7 3.37e-39 150 32 6 303 3 atpD ATP synthase subunit beta Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2NQ86 3.42e-39 150 31 3 302 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
Q5H4Y4 3.67e-39 150 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB0 3.67e-39 150 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q4 3.67e-39 150 31 5 308 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B0TWS7 4.58e-39 149 31 7 316 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q8RGE2 4.6e-39 150 31 7 317 1 atpD ATP synthase subunit beta Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q12GQ0 4.65e-39 150 31 7 336 3 atpD ATP synthase subunit beta Polaromonas sp. (strain JS666 / ATCC BAA-500)
B9LBM0 5.17e-39 150 29 11 395 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 5.17e-39 150 29 11 395 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A1JTC6 5.4e-39 149 30 3 302 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2KU36 5.49e-39 149 31 4 302 3 atpD ATP synthase subunit beta Bordetella avium (strain 197N)
A7MMW9 5.56e-39 149 31 3 302 3 atpD ATP synthase subunit beta Cronobacter sakazakii (strain ATCC BAA-894)
B9MS68 6.05e-39 149 30 7 351 3 atpD ATP synthase subunit beta Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A9F3R4 6.05e-39 149 32 7 308 3 atpD ATP synthase subunit beta Sorangium cellulosum (strain So ce56)
P22068 6.49e-39 150 31 9 351 1 atp2 ATP synthase subunit beta, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4FQ37 7.23e-39 149 32 10 354 3 atpD ATP synthase subunit beta Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q65Q07 7.67e-39 149 30 3 301 3 atpD ATP synthase subunit beta Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1VIV2 7.71e-39 149 31 6 309 3 atpD1 ATP synthase subunit beta 1 Polaromonas naphthalenivorans (strain CJ2)
Q0AEJ6 8.52e-39 149 33 4 301 3 atpD2 ATP synthase subunit beta 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q39Q56 8.85e-39 149 30 11 395 3 atpD ATP synthase subunit beta Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q0C100 9.02e-39 149 28 10 397 3 atpD ATP synthase subunit beta Hyphomonas neptunium (strain ATCC 15444)
Q0C9L8 1.09e-38 148 31 5 307 3 ctvE ATP synthase subunit beta, mitochondrial Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A8GTS6 1.1e-38 149 28 13 402 3 atpD ATP synthase subunit beta Rickettsia rickettsii (strain Sheila Smith)
B0BVB6 1.1e-38 149 28 13 402 3 atpD ATP synthase subunit beta Rickettsia rickettsii (strain Iowa)
P42468 1.31e-38 148 31 5 302 3 atpD ATP synthase subunit beta Burkholderia cepacia
B5XZM4 1.34e-38 148 31 3 302 3 atpD ATP synthase subunit beta Klebsiella pneumoniae (strain 342)
Q6CYJ5 1.39e-38 148 31 3 302 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6TG36 1.44e-38 148 31 3 302 3 atpD ATP synthase subunit beta Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q6AQ10 1.46e-38 149 32 15 415 3 atpD ATP synthase subunit beta Desulfotalea psychrophila (strain LSv54 / DSM 12343)
C5BF40 1.47e-38 148 31 3 302 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
Q7P095 1.5e-38 148 32 5 308 3 atpD ATP synthase subunit beta Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A9WNC8 1.52e-38 149 32 15 407 3 atpD ATP synthase subunit beta Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A5EXL4 1.6e-38 148 31 5 304 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
Q2T873 1.62e-38 150 29 6 376 3 atpA2 ATP synthase subunit alpha 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9CKW1 1.64e-38 148 28 6 381 3 atpD ATP synthase subunit beta Pasteurella multocida (strain Pm70)
B3PIS7 1.65e-38 148 31 4 303 3 atpD ATP synthase subunit beta Cellvibrio japonicus (strain Ueda107)
Q67TB7 1.76e-38 148 28 7 358 3 atpD ATP synthase subunit beta Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q74GY0 1.79e-38 148 30 11 395 3 atpD ATP synthase subunit beta Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A1K1S2 1.9e-38 148 32 6 303 3 atpD ATP synthase subunit beta Azoarcus sp. (strain BH72)
Q7CPE2 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 1.95e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
Q3YVN6 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5BIN6 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7LK77 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 1.99e-38 148 31 3 302 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
A8A6J5 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
B1X9W0 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 1.99e-38 148 31 3 302 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
A8ACN6 2.01e-38 148 31 3 302 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B9E8E6 2.08e-38 148 31 12 377 3 atpD ATP synthase subunit beta Macrococcus caseolyticus (strain JCSC5402)
B5RFW3 2.09e-38 148 31 3 302 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8MBQ4 2.22e-38 148 29 14 398 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea coccinea
Q13SQ2 2.23e-38 148 31 6 308 3 atpD2 ATP synthase subunit beta 2 Paraburkholderia xenovorans (strain LB400)
Q329S1 2.31e-38 148 31 3 302 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
Q1Q899 2.32e-38 148 31 10 354 3 atpD ATP synthase subunit beta Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q04BA3 2.33e-38 148 30 10 372 3 atpD ATP synthase subunit beta Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
C4LDW0 2.43e-38 147 30 5 324 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9CES0 2.48e-38 148 30 11 390 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. lactis (strain IL1403)
Q9HM64 2.69e-38 147 32 6 317 3 atpB V-type ATP synthase beta chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q8D3J3 2.69e-38 147 29 11 394 3 atpD ATP synthase subunit beta Wigglesworthia glossinidia brevipalpis
Q1GAW5 2.81e-38 148 30 13 402 3 atpD ATP synthase subunit beta Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
O03069 2.84e-38 148 31 14 407 3 atpB ATP synthase subunit beta, chloroplastic (Fragment) Equisetum arvense
Q19V65 2.84e-38 148 31 14 403 3 atpB ATP synthase subunit beta, chloroplastic Chlorokybus atmophyticus
A1AP52 2.86e-38 147 30 13 399 3 atpD2 ATP synthase subunit beta 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5G9D8 2.91e-38 147 29 10 394 3 atpD ATP synthase subunit beta Geotalea uraniireducens (strain Rf4)
A8YUK1 2.96e-38 148 30 11 371 3 atpD ATP synthase subunit beta Lactobacillus helveticus (strain DPC 4571)
Q1XDM8 3.05e-38 147 30 15 403 3 atpB ATP synthase subunit beta, chloroplastic Neopyropia yezoensis
A1TJ41 3.06e-38 147 31 6 309 3 atpD ATP synthase subunit beta Paracidovorax citrulli (strain AAC00-1)
Q8EM83 3.07e-38 147 30 13 401 3 atpD ATP synthase subunit beta Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C6DJH2 3.16e-38 147 31 3 302 3 atpD ATP synthase subunit beta Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P42470 3.16e-38 147 26 10 415 3 atpD ATP synthase subunit beta Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q2JIV9 3.17e-38 147 29 11 402 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-2-3B'a(2-13))
A1A3C5 3.25e-38 148 30 14 399 3 atpD ATP synthase subunit beta Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B8F774 3.33e-38 147 31 4 296 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
A8G7M8 3.56e-38 147 30 3 302 3 atpD ATP synthase subunit beta Serratia proteamaculans (strain 568)
Q3ZZT7 3.58e-38 147 30 9 356 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain CBDB1)
A5FRQ5 3.58e-38 147 30 9 356 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B0UWG5 3.72e-38 147 28 6 381 3 atpD ATP synthase subunit beta Histophilus somni (strain 2336)
A1ALL7 3.87e-38 147 30 13 399 3 atpD1 ATP synthase subunit beta 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A2RMI2 4.03e-38 147 30 13 391 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain MG1363)
A1SBU0 4.07e-38 147 31 4 302 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0I5X3 4.2e-38 147 28 6 381 3 atpD ATP synthase subunit beta Histophilus somni (strain 129Pt)
Q04ZU5 4.73e-38 147 29 9 386 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 4.73e-38 147 29 9 386 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B8GFQ7 4.74e-38 147 32 8 366 3 atpB V-type ATP synthase beta chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
P43715 4.78e-38 147 30 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN64 4.78e-38 147 30 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain 86-028NP)
Q9TM41 4.81e-38 147 29 14 410 3 atpB ATP synthase subunit beta, chloroplastic Cyanidium caldarium
A5UA11 4.93e-38 147 30 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittEE)
A7HIX7 4.94e-38 147 30 13 398 3 atpD ATP synthase subunit beta Anaeromyxobacter sp. (strain Fw109-5)
B1I6J7 5.27e-38 147 28 10 397 3 atpD ATP synthase subunit beta Desulforudis audaxviator (strain MP104C)
Q02XA5 5.5e-38 147 30 13 391 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain SK11)
Q2ST34 5.6e-38 147 32 6 301 3 atpD ATP synthase subunit beta Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
B2G691 5.98e-38 147 32 8 321 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIR1 5.98e-38 147 32 8 321 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri (strain DSM 20016)
Q07YM0 6.27e-38 147 34 5 311 3 atpA1 ATP synthase subunit alpha 1 Shewanella frigidimarina (strain NCIMB 400)
B8G6G6 6.28e-38 147 30 6 309 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q180W5 6.88e-38 146 28 8 398 3 atpD ATP synthase subunit beta Clostridioides difficile (strain 630)
A5UGY9 7.01e-38 146 30 3 302 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittGG)
A6W7G9 7.56e-38 147 30 14 415 3 atpD ATP synthase subunit beta Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q1CX36 7.61e-38 147 30 13 401 3 atpD ATP synthase subunit beta Myxococcus xanthus (strain DK1622)
A1U7H4 8.25e-38 146 31 4 302 3 atpD ATP synthase subunit beta Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3A083 8.28e-38 146 31 7 353 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
C3M9S1 8.61e-38 147 30 13 394 3 atpD ATP synthase subunit beta Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B0THN2 8.92e-38 146 32 6 304 3 atpD ATP synthase subunit beta Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q5FRC5 9.09e-38 147 29 14 399 3 atpD1 ATP synthase subunit beta 1 Gluconobacter oxydans (strain 621H)
A1WF58 9.2e-38 146 32 6 309 3 atpD ATP synthase subunit beta Verminephrobacter eiseniae (strain EF01-2)
B9L7Y7 9.23e-38 146 29 11 390 3 atpD ATP synthase subunit beta Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q3A605 9.33e-38 146 28 10 419 3 atpD1 ATP synthase subunit beta 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3JJP7 9.69e-38 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 1710b)
Q63IX0 9.83e-38 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain K96243)
A3P8L5 9.83e-38 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 1106a)
A3NN58 9.99e-38 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 668)
A1UY41 1.01e-37 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain SAVP1)
Q62EB0 1.01e-37 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain ATCC 23344)
A3MAS4 1.01e-37 149 30 6 375 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain NCTC 10247)
Q6MS94 1.04e-37 146 32 6 301 3 atpD ATP synthase subunit beta Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
A9KX06 1.12e-37 146 31 5 315 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 1.12e-37 146 31 5 315 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 1.12e-37 146 31 5 315 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 1.12e-37 146 31 5 315 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
B8CVU5 1.13e-37 146 30 5 315 3 atpD ATP synthase subunit beta Shewanella piezotolerans (strain WP3 / JCM 13877)
A5V3X5 1.19e-37 146 28 13 437 3 atpD ATP synthase subunit beta Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A4ITI9 1.22e-37 146 31 8 317 3 atpD ATP synthase subunit beta Geobacillus thermodenitrificans (strain NG80-2)
A5N3H7 1.22e-37 146 30 4 302 3 atpD ATP synthase subunit beta Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q11DD5 1.27e-37 147 32 7 309 3 atpD ATP synthase subunit beta Chelativorans sp. (strain BNC1)
Q9JW70 1.4e-37 145 31 8 322 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q92LK8 1.47e-37 146 30 14 403 3 atpD ATP synthase subunit beta Rhizobium meliloti (strain 1021)
Q3SVJ1 1.56e-37 145 28 11 398 3 atpD ATP synthase subunit beta Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8DP44 1.59e-37 145 31 8 336 1 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97PT6 1.59e-37 145 31 8 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLA9 1.59e-37 145 31 8 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICS9 1.59e-37 145 31 8 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Hungary19A-6)
Q04HT9 1.59e-37 145 31 8 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A6VL57 1.6e-37 145 30 3 301 3 atpD ATP synthase subunit beta Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A0L2S8 1.64e-37 145 30 6 337 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
A4J999 1.67e-37 145 29 8 349 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C3PLT1 1.68e-37 145 27 10 409 3 atpD ATP synthase subunit beta Rickettsia africae (strain ESF-5)
Q7VJ21 1.74e-37 145 26 11 417 3 atpD ATP synthase subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q07232 1.74e-37 145 31 4 307 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A9KK92 1.74e-37 145 29 10 386 3 atpD ATP synthase subunit beta Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B4U989 1.76e-37 146 32 11 320 3 atpA ATP synthase subunit alpha Hydrogenobaculum sp. (strain Y04AAS1)
Q92G88 2.01e-37 145 27 11 402 3 atpD ATP synthase subunit beta Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q494C3 2.06e-37 145 30 6 313 3 atpD ATP synthase subunit beta Blochmanniella pennsylvanica (strain BPEN)
Q07VU4 2.07e-37 145 30 6 331 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
Q9Z687 2.19e-37 145 28 8 402 3 atpD ATP synthase subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C1CLK6 2.23e-37 145 31 7 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain P1031)
C1CF93 2.23e-37 145 31 7 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain JJA)
B2IQX0 2.23e-37 145 31 7 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain CGSP14)
C1C899 2.23e-37 145 31 7 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain 70585)
Q3J9F4 2.25e-37 145 31 7 345 3 atpB V-type ATP synthase beta chain Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1RQB0 2.29e-37 145 30 7 353 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 2.29e-37 145 30 7 353 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C1CSC8 2.3e-37 145 31 8 336 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Taiwan19F-14)
C4K227 2.32e-37 145 28 14 404 3 atpD ATP synthase subunit beta Rickettsia peacockii (strain Rustic)
B4RJG0 2.38e-37 145 31 9 339 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z0 2.38e-37 145 31 9 339 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9NGW2 2.46e-37 145 28 9 401 3 atpD ATP synthase subunit beta Acholeplasma laidlawii (strain PG-8A)
Q4FP38 2.52e-37 145 27 10 402 3 atpD ATP synthase subunit beta Pelagibacter ubique (strain HTCC1062)
P42469 2.61e-37 145 29 10 396 3 atpD ATP synthase subunit beta Stigmatella aurantiaca
Q5PAN2 2.64e-37 145 29 12 396 3 atpD ATP synthase subunit beta Anaplasma marginale (strain St. Maries)
Q9MUT5 2.8e-37 145 30 13 400 3 atpB ATP synthase subunit beta, chloroplastic Mesostigma viride
Q1ACK1 3.07e-37 145 29 15 401 3 atpB ATP synthase subunit beta, chloroplastic Chara vulgaris
A9H9A8 3.16e-37 145 29 12 395 3 atpD ATP synthase subunit beta Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B5E670 3.18e-37 145 31 6 316 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 19F (strain G54)
A3QJR0 3.26e-37 144 30 5 315 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q1GQS5 3.72e-37 145 28 10 397 3 atpD ATP synthase subunit beta Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B9K814 3.83e-37 144 32 7 343 3 atpB V-type ATP synthase beta chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B9IRT7 3.92e-37 144 29 12 389 3 atpD ATP synthase subunit beta Bacillus cereus (strain Q1)
B7HY64 3.92e-37 144 29 12 389 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH187)
Q72XE8 3.92e-37 144 29 12 389 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8RC15 3.93e-37 144 30 4 302 3 atpD ATP synthase subunit beta Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8F2J5 4.02e-37 144 29 11 389 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SX9 4.02e-37 144 29 11 389 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B5EFI7 4.04e-37 144 30 14 401 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
P0DA05 4.12e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48UD3 4.12e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JMI9 4.12e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCL3 4.12e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DA04 4.12e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9A0I7 4.12e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M1
A8HAG3 4.19e-37 144 30 5 315 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q1J7F9 4.21e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHN5 4.21e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P1K5 4.21e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCY0 4.21e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q39ZU1 4.25e-37 144 28 10 419 3 atpD3 ATP synthase subunit beta 3 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1KW11 4.27e-37 144 31 8 322 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M123 4.27e-37 144 31 8 322 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C (strain 053442)
A0LLG0 4.29e-37 145 32 8 307 3 atpA ATP synthase subunit alpha Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q1AVH9 4.34e-37 145 32 6 304 3 atpD ATP synthase subunit beta Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q32RI0 4.5e-37 145 30 15 402 3 atpB ATP synthase subunit beta, chloroplastic Zygnema circumcarinatum
A2RFC2 4.51e-37 144 29 11 400 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8E5U8 4.51e-37 144 31 6 316 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype III (strain NEM316)
B1KQ34 4.63e-37 144 28 9 398 3 atpD ATP synthase subunit beta Shewanella woodyi (strain ATCC 51908 / MS32)
P23704 4.66e-37 145 29 9 357 2 atp-2 ATP synthase subunit beta, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8E8C0 4.67e-37 144 30 5 324 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9JXQ2 4.72e-37 144 31 8 322 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q98QU5 4.77e-37 144 32 7 297 3 atpD1 ATP synthase subunit beta 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q8E072 4.79e-37 144 31 6 316 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1J5 4.79e-37 144 31 6 316 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q40612 4.81e-37 144 31 14 401 3 atpD ATP synthase subunit beta, chloroplastic Ochrosphaera neapolitana
Q223D6 4.84e-37 144 31 5 309 3 atpD1 ATP synthase subunit beta 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B8D6S7 4.96e-37 144 31 6 308 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 4.96e-37 144 31 6 308 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 4.96e-37 144 31 6 308 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A8G1W5 5.17e-37 144 31 5 296 3 atpD ATP synthase subunit beta Shewanella sediminis (strain HAW-EB3)
A8F004 5.32e-37 144 28 14 402 3 atpD ATP synthase subunit beta Rickettsia canadensis (strain McKiel)
Q9ZK81 5.43e-37 144 28 7 354 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
C6E9F1 5.8e-37 144 29 11 395 3 atpD ATP synthase subunit beta Geobacter sp. (strain M21)
A3CM14 5.86e-37 144 32 6 303 3 atpD ATP synthase subunit beta Streptococcus sanguinis (strain SK36)
A6UDM1 5.86e-37 145 30 14 403 3 atpD ATP synthase subunit beta Sinorhizobium medicae (strain WSM419)
A4WUM7 5.88e-37 144 29 13 400 3 atpD ATP synthase subunit beta Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q03A18 6.75e-37 144 32 8 326 3 atpD ATP synthase subunit beta Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WDL8 6.75e-37 144 32 8 326 3 atpD ATP synthase subunit beta Lacticaseibacillus casei (strain BL23)
A7IH31 6.93e-37 144 28 9 399 3 atpD ATP synthase subunit beta Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q5M5J1 7.01e-37 144 30 7 336 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
B8HAY9 7.41e-37 144 31 14 393 3 atpD ATP synthase subunit beta Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q03LX3 7.68e-37 144 31 6 316 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M104 7.68e-37 144 31 6 316 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain CNRZ 1066)
Q477Z1 7.75e-37 144 30 6 325 3 atpD ATP synthase subunit beta Dechloromonas aromatica (strain RCB)
Q1GEU8 7.98e-37 144 29 13 399 3 atpD ATP synthase subunit beta Ruegeria sp. (strain TM1040)
A4GAG9 8.65e-37 144 31 5 309 3 atpD ATP synthase subunit beta Herminiimonas arsenicoxydans
Q03234 8.74e-37 144 31 8 326 3 atpD ATP synthase subunit beta Lacticaseibacillus casei
Q9LA80 8.87e-37 144 30 8 329 3 atpD ATP synthase subunit beta Geobacillus thermoleovorans
Q2G5N5 9.02e-37 144 28 10 397 3 atpD ATP synthase subunit beta Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5FKY0 9.03e-37 144 30 11 373 2 atpD ATP synthase subunit beta Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5KUJ3 9.33e-37 144 31 7 316 1 atpD ATP synthase subunit beta Geobacillus kaustophilus (strain HTA426)
A6T470 9.47e-37 143 31 5 309 3 atpD ATP synthase subunit beta Janthinobacterium sp. (strain Marseille)
Q9TJR9 1.02e-36 144 29 12 405 3 atpB ATP synthase subunit beta, plastid Prototheca wickerhamii
B8E137 1.04e-36 143 31 6 341 3 atpB V-type ATP synthase beta chain Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
O50290 1.12e-36 143 27 11 406 3 atpD ATP synthase subunit beta Rickettsia prowazekii (strain Madrid E)
Q8MBQ1 1.19e-36 144 28 12 395 3 atpB ATP synthase subunit beta, chloroplastic Ipomoea aquatica
P50002 1.23e-36 143 28 13 393 1 atpD ATP synthase subunit beta, sodium ion specific Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q8UC76 1.23e-36 143 30 14 393 3 atpD ATP synthase subunit beta Agrobacterium fabrum (strain C58 / ATCC 33970)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_04035
Feature type CDS
Gene fliI
Product flagellar protein export ATPase FliI
Location 79076 - 80440 (strand: 1)
Length 1365 (nucleotides) / 454 (amino acids)
In genomic island -

Contig

Accession ZDB_361
Length 286024 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_205
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)
NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02412 flagellum-specific ATP synthase [EC:7.4.2.8] Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG023641 flagellum-specific ATP synthase FliI VF0394 Motility

Protein Sequence

MTARIGRWIGALEGFESRMSGVAMTRHYGRLTKITGLVMEAEGIKMPLGATCFIERVINGNTEEVICEVVGFNGPRMLLMPLAELEGIAPGARVYAQSTGSGGQTSRQLPLGDELLGRILDASGNPLDGKGPLEAKIRAPLITPPINPLERSPINSVLDVGVRAINALLTVGRGQRMGLFAGSGVGKSVLLGMMARFTQADIIVVGLIGERGREVKDFIENILGAEGLQRAVVVAAPADVSPLLRMQGASYATRIAEYYRDLGRNVLLIMDSLTRYSMAQREIALAIGEPPATKGYPPSVFAKLPALVERAGNGKNGGSVTAFYTVLTEGDDQQDPIADSARAILDGHIVLSRSLAESGHYPAIDIEASISRAMTELIEKSHYRKIQRFKQLTSAYQRNRDLINVGAYAAGSDPMLDEAIQLFPYMAKFLQQDIDERCDYPAACEQLSQVIPDA

Flanking regions ( +/- flanking 50bp)

GCCACCCGCTGGCAGGAGCTGTGCCGGTTATACGCGCCGGAGACCTTGTTATGACCGCGCGGATTGGCCGCTGGATAGGCGCACTGGAAGGTTTTGAATCCCGGATGTCCGGCGTGGCGATGACCCGCCATTACGGGCGTCTGACCAAAATCACCGGGCTTGTGATGGAAGCCGAGGGTATCAAAATGCCGCTCGGCGCCACCTGTTTTATCGAGCGCGTGATCAACGGGAACACCGAAGAAGTTATCTGTGAAGTGGTCGGTTTTAACGGGCCGCGTATGCTGCTGATGCCGCTGGCAGAGCTGGAAGGTATCGCACCGGGTGCCCGTGTCTATGCGCAATCCACCGGAAGCGGCGGGCAGACCAGCCGCCAGCTGCCGCTGGGTGATGAACTGCTCGGCCGTATCCTTGATGCCTCCGGCAACCCGCTGGACGGCAAAGGGCCGCTGGAAGCCAAAATCCGCGCCCCGCTGATTACGCCGCCAATCAACCCGCTGGAACGGTCGCCGATTAACAGTGTGCTGGATGTTGGTGTCCGCGCTATCAACGCCCTGCTGACCGTCGGACGTGGTCAGCGTATGGGGCTGTTTGCCGGTTCCGGCGTCGGGAAAAGTGTGCTGCTCGGCATGATGGCGCGTTTCACACAGGCGGACATTATTGTGGTCGGGCTGATTGGTGAGCGCGGCCGCGAAGTAAAAGATTTTATCGAGAACATCCTCGGCGCGGAAGGACTTCAGCGTGCGGTGGTTGTCGCGGCACCGGCGGACGTTTCCCCGCTGCTGCGGATGCAGGGTGCCTCCTATGCCACGCGGATCGCGGAATATTACCGTGATCTGGGTCGCAATGTGCTGTTAATTATGGATTCACTGACCCGTTACAGTATGGCACAGCGTGAAATTGCGCTCGCCATCGGAGAACCGCCGGCGACAAAAGGCTATCCTCCGTCGGTGTTCGCAAAATTACCGGCACTGGTCGAACGGGCAGGCAACGGTAAAAACGGCGGCTCTGTCACCGCGTTTTACACTGTACTGACCGAAGGGGATGACCAGCAGGATCCGATCGCAGACTCCGCGCGGGCCATTCTTGACGGCCATATCGTGCTTTCGCGTTCCCTGGCGGAATCCGGACACTACCCTGCTATCGATATCGAAGCCTCCATCAGCCGTGCCATGACCGAGCTGATTGAGAAAAGCCATTACCGGAAAATTCAGCGTTTCAAACAGCTGACCTCCGCTTACCAGCGCAACCGCGATCTGATTAATGTCGGTGCCTACGCGGCAGGCAGTGACCCGATGCTGGATGAGGCCATTCAGCTGTTCCCGTATATGGCGAAGTTTCTGCAGCAGGATATCGATGAGCGCTGTGACTACCCGGCCGCCTGTGAGCAGCTCAGTCAGGTGATACCGGACGCATAACGAGGTCGTCAATGTCAAACACGCATGCACTCACCACGTTGTTAAATTTA