Homologs in group_205

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00605 FBDBKF_00605 79.1 Morganella morganii S1 fliI flagellar protein export ATPase FliI
EHELCC_00940 EHELCC_00940 79.1 Morganella morganii S2 fliI flagellar protein export ATPase FliI
NLDBIP_02520 NLDBIP_02520 79.1 Morganella morganii S4 fliI flagellar protein export ATPase FliI
LHKJJB_04035 LHKJJB_04035 79.1 Morganella morganii S3 fliI flagellar protein export ATPase FliI
HKOGLL_03010 HKOGLL_03010 79.1 Morganella morganii S5 fliI flagellar protein export ATPase FliI
F4V73_RS06615 F4V73_RS06615 78.9 Morganella psychrotolerans fliI flagellar protein export ATPase FliI
F4V73_RS08315 F4V73_RS08315 44.7 Morganella psychrotolerans - FliI/YscN family ATPase

Distribution of the homologs in the orthogroup group_205

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_205

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P26465 0.0 699 77 2 451 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52612 0.0 671 78 2 439 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
P57178 0.0 555 56 0 452 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA42 0.0 529 56 2 453 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9I4N1 0.0 518 62 1 425 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89AZ7 5.37e-173 496 53 1 454 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P23445 2.16e-139 410 49 5 427 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
O83417 2.03e-124 372 46 3 443 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
P80153 1.32e-118 357 46 4 428 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
P52607 2.1e-117 353 40 5 454 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B8H363 2.25e-113 343 46 7 433 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 2.25e-113 343 46 7 433 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O67531 2.45e-113 343 43 6 434 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
P40291 1.04e-111 339 45 6 432 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 1.04e-111 339 45 6 432 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 1.05e-111 339 45 6 432 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P55717 1.17e-111 339 44 5 428 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P74857 6.54e-111 337 45 5 427 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZJJ3 1.17e-106 326 43 5 442 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O07025 8.54e-106 323 42 5 442 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8RK01 5.15e-103 317 43 6 462 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
Q887B5 7.51e-103 317 43 6 462 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q52371 1.68e-101 313 42 5 459 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
P0A1C2 1.7e-89 281 39 4 424 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 1.7e-89 281 39 4 424 1 sctN Type 3 secretion system ATPase Shigella flexneri
P0A1B9 1.63e-88 279 38 5 433 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 1.63e-88 279 38 5 433 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
O34171 1.83e-86 275 44 3 347 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 4.33e-86 274 43 4 367 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
A9NBD0 1.19e-42 159 32 3 303 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
Q83AF5 1.43e-42 159 32 3 303 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 1.43e-42 159 32 3 303 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
A8LN39 1.97e-42 159 36 6 305 3 atpD1 ATP synthase subunit beta 1 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q3JJP7 1.17e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 1710b)
Q63IX0 1.19e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain K96243)
A3P8L5 1.19e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 1106a)
A3NN58 1.41e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia pseudomallei (strain 668)
A1UY41 1.51e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain SAVP1)
Q62EB0 1.51e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain ATCC 23344)
A3MAS4 1.51e-41 160 33 5 370 3 atpA2 ATP synthase subunit alpha 2 Burkholderia mallei (strain NCTC 10247)
B8JE34 1.73e-41 157 33 4 358 3 atpB V-type ATP synthase beta chain Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q2T873 5.39e-41 157 32 5 371 3 atpA2 ATP synthase subunit alpha 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2IQ94 9.17e-41 155 32 4 358 3 atpB V-type ATP synthase beta chain Anaeromyxobacter dehalogenans (strain 2CP-C)
A8ZNR6 3.01e-40 153 34 7 330 3 atpD ATP synthase subunit beta Acaryochloris marina (strain MBIC 11017)
A3PS65 4.32e-40 153 35 5 315 3 atpA2 ATP synthase subunit alpha 2 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3HKH9 4.5e-40 153 35 5 315 3 atpA2 ATP synthase subunit alpha 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A8ZUA1 5.39e-40 152 33 8 334 3 atpD ATP synthase subunit beta Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
C3K1E6 9.22e-40 152 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
B5YI24 9.66e-40 152 31 5 330 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B4UH38 1.25e-39 152 32 4 358 3 atpB V-type ATP synthase beta chain Anaeromyxobacter sp. (strain K)
Q97CP9 1.35e-39 151 31 6 355 3 atpB V-type ATP synthase beta chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
B0VBP3 1.44e-39 151 32 6 332 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 1.44e-39 151 32 6 332 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 1.44e-39 151 32 6 332 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 1.44e-39 151 32 6 332 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 1.44e-39 151 32 6 332 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 1.44e-39 151 32 6 332 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
A7HDG8 1.57e-39 151 32 4 354 3 atpB V-type ATP synthase beta chain Anaeromyxobacter sp. (strain Fw109-5)
Q03LX5 2.46e-39 151 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5J3 2.46e-39 151 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M106 2.46e-39 151 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus thermophilus (strain CNRZ 1066)
Q6FFK0 2.95e-39 150 32 6 332 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O67828 3.08e-39 150 31 8 349 3 atpD ATP synthase subunit beta Aquifex aeolicus (strain VF5)
P42467 3.26e-39 149 29 7 368 3 atpD ATP synthase subunit beta (Fragment) Peptococcus niger
A0LLF8 3.72e-39 150 33 8 334 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q0AEJ6 4.5e-39 150 32 7 331 3 atpD2 ATP synthase subunit beta 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A6VWP9 5.13e-39 150 34 8 337 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
Q8P1K6 7.68e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M18 (strain MGAS8232)
P41168 7.88e-39 149 31 3 309 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
B5XKP9 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M49 (strain NZ131)
P0DA03 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48UD5 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J7G1 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JMJ1 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCL5 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XCY2 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA02 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9A0I9 8.32e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M1
C1D5G2 8.36e-39 149 32 5 309 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
A2RFC4 8.88e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JHN7 8.88e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8E074 8.88e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1J7 8.88e-39 150 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E5V0 9.43e-39 149 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus agalactiae serotype III (strain NEM316)
Q2RFX9 1.1e-38 149 31 4 308 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
O50292 1.16e-38 149 31 8 349 3 atpD ATP synthase subunit beta Aquifex pyrophilus
Q4ZL24 1.24e-38 149 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
Q87TT4 1.24e-38 149 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9HM64 1.55e-38 148 32 4 316 3 atpB V-type ATP synthase beta chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A4VVK1 1.7e-38 149 35 7 315 3 atpA ATP synthase subunit alpha Streptococcus suis (strain 05ZYH33)
A4W1V9 1.7e-38 149 35 7 315 3 atpA ATP synthase subunit alpha Streptococcus suis (strain 98HAH33)
Q0SQZ5 2.12e-38 148 30 5 332 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
Q48BG5 2.15e-38 148 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A7NIQ9 2.15e-38 148 32 6 311 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q8XID4 2.16e-38 148 30 5 332 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 2.16e-38 148 30 5 332 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C0M718 2.35e-38 149 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus equi subsp. equi (strain 4047)
B4SAN6 3.25e-38 147 31 7 332 3 atpD ATP synthase subunit beta Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B2FHY8 3.61e-38 147 32 5 314 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain K279a)
B4SJR9 3.87e-38 147 32 5 314 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain R551-3)
C0MH19 4.59e-38 148 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus equi subsp. zooepidemicus (strain H70)
B4U2D9 4.59e-38 148 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B5Y8B6 4.74e-38 147 32 6 336 3 atpB V-type ATP synthase beta chain Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
B8GRB8 5.12e-38 147 31 3 302 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A2BKX5 5.63e-38 147 32 5 350 3 atpB V-type ATP synthase beta chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
A5UQN3 5.82e-38 147 32 6 311 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
Q2LQZ7 6.52e-38 147 32 7 321 3 atpA1 ATP synthase subunit alpha 1 Syntrophus aciditrophicus (strain SB)
Q3A083 6.88e-38 147 34 4 302 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A9A2Q9 7.08e-38 146 33 4 309 3 atpB V-type ATP synthase beta chain Nitrosopumilus maritimus (strain SCM1)
A8AYG3 7.79e-38 147 34 6 311 3 atpA ATP synthase subunit alpha Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q12GQ0 8.77e-38 146 31 10 363 3 atpD ATP synthase subunit beta Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q04G20 9.55e-38 146 32 9 333 3 atpD ATP synthase subunit beta Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q13XV9 1.05e-37 147 34 4 312 3 atpA1 ATP synthase subunit alpha 1 Paraburkholderia xenovorans (strain LB400)
A0KQX8 1.2e-37 146 30 3 307 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B8GFQ7 1.2e-37 146 33 3 309 3 atpB V-type ATP synthase beta chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B8FGT4 1.21e-37 146 32 8 340 3 atpD ATP synthase subunit beta Desulfatibacillum aliphaticivorans
Q4K3A9 1.23e-37 145 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3SF66 1.27e-37 145 32 5 304 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
A0Q8D9 1.34e-37 145 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
A7GV58 1.42e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7IQW0 1.42e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain G9842)
Q15MU4 1.5e-37 145 31 3 307 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A1VIV2 1.5e-37 146 31 9 363 3 atpD1 ATP synthase subunit beta 1 Polaromonas naphthalenivorans (strain CJ2)
Q5FNY6 1.52e-37 146 34 2 269 3 atpA2 ATP synthase subunit alpha 2 Gluconobacter oxydans (strain 621H)
Q814W0 1.54e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HAX7 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U1 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain ZK / E33L)
B9IRT9 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain Q1)
B7HY67 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain AH187)
C1F0N0 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain 03BB102)
Q72XE6 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JGN2 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain AH820)
Q81JZ3 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus anthracis
A0RL97 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus thuringiensis (strain Al Hakam)
C3LFI1 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F6 1.59e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus anthracis (strain A0248)
Q46VY0 1.6e-37 145 31 4 303 3 atpD ATP synthase subunit beta Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A2SC70 1.7e-37 145 31 9 345 3 atpD ATP synthase subunit beta Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B3QUP6 1.9e-37 145 30 7 362 3 atpD ATP synthase subunit beta Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A3DHP1 1.96e-37 145 30 6 367 3 atpB V-type ATP synthase beta chain Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5WSG8 2e-37 145 32 3 303 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 2e-37 145 32 3 303 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 2e-37 145 32 3 303 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 2e-37 145 32 3 303 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
A4IW24 2.06e-37 145 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 2.06e-37 145 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 2.06e-37 145 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
Q88BX4 2.14e-37 145 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 2.14e-37 145 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A9VSA5 2.28e-37 146 33 8 317 3 atpA ATP synthase subunit alpha Bacillus mycoides (strain KBAB4)
Q12WL0 2.3e-37 145 33 5 317 3 atpB V-type ATP synthase beta chain Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q2LR05 2.49e-37 145 32 4 303 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
A0ALL5 2.51e-37 145 34 8 311 3 atpA2 ATP synthase subunit alpha 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B7HFK4 2.51e-37 145 33 8 317 3 atpA ATP synthase subunit alpha Bacillus cereus (strain B4264)
O83540 2.56e-37 145 31 5 359 3 atpB2 V-type ATP synthase beta chain 2 Treponema pallidum (strain Nichols)
B4U989 2.67e-37 145 33 10 332 3 atpA ATP synthase subunit alpha Hydrogenobaculum sp. (strain Y04AAS1)
Q71WP7 2.83e-37 145 34 8 311 3 atpA2 ATP synthase subunit alpha 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y4C0 2.97e-37 145 34 8 311 3 atpA2 ATP synthase subunit alpha 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A5CVI6 3.01e-37 145 32 5 309 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q927W2 3.15e-37 145 34 8 311 3 atpA2 ATP synthase subunit alpha 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9YF36 3.2e-37 145 30 7 362 3 atpB V-type ATP synthase beta chain Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
B2SEY1 3.34e-37 144 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
Q1MRB8 3.34e-37 145 33 5 303 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
A6LQH6 3.36e-37 145 30 6 331 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P35110 3.45e-37 144 31 9 337 3 atpD ATP synthase subunit beta Chlorobium limicola
Q03EL4 3.51e-37 145 31 8 348 3 atpD ATP synthase subunit beta Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B0KRA8 3.65e-37 144 31 3 307 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
B3EST8 3.82e-37 145 30 8 364 3 atpD ATP synthase subunit beta Amoebophilus asiaticus (strain 5a2)
Q0BK84 3.92e-37 144 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 3.92e-37 144 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 3.92e-37 144 30 6 333 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
P42466 5.03e-37 144 27 9 406 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
C5BKJ5 5.11e-37 144 33 8 312 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
B8DRD2 5.73e-37 144 30 6 333 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q31DM0 5.89e-37 144 30 3 307 3 atpD ATP synthase subunit beta Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q2FQF0 6.03e-37 144 33 7 352 3 atpB3 V-type ATP synthase beta chain 3 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
B9E8E8 6.25e-37 144 32 7 339 3 atpA ATP synthase subunit alpha Macrococcus caseolyticus (strain JCSC5402)
A9NGW2 6.29e-37 144 30 8 377 3 atpD ATP synthase subunit beta Acholeplasma laidlawii (strain PG-8A)
Q3J6N1 6.41e-37 144 31 3 302 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1RX20 6.55e-37 144 34 5 317 3 atpB V-type ATP synthase beta chain Thermofilum pendens (strain DSM 2475 / Hrk 5)
B1JRN2 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)
Q1CCH5 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5T9 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM8 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pestis
B2K847 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C095 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE0 7.17e-37 144 29 5 357 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q48AW0 7.5e-37 144 30 3 307 3 atpD ATP synthase subunit beta Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4Y187 7.68e-37 144 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
A4STP3 7.85e-37 144 30 3 307 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
Q180W5 8.1e-37 144 30 6 333 3 atpD ATP synthase subunit beta Clostridioides difficile (strain 630)
Q1I2I7 9.39e-37 143 31 3 302 3 atpD ATP synthase subunit beta Pseudomonas entomophila (strain L48)
B9DRT4 1.04e-36 144 35 7 311 3 atpA ATP synthase subunit alpha Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q03QY8 1.07e-36 143 33 7 305 3 atpD ATP synthase subunit beta Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B0U598 1.09e-36 143 31 5 314 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
B0TWS7 1.1e-36 143 31 6 304 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q3IK50 1.11e-36 143 29 6 355 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
A4VS62 1.22e-36 143 30 3 307 3 atpD ATP synthase subunit beta Stutzerimonas stutzeri (strain A1501)
A1SBU0 1.26e-36 143 31 4 308 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q60CR4 1.46e-36 143 31 3 302 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A9BPU7 1.51e-36 143 32 6 310 3 atpD ATP synthase subunit beta Delftia acidovorans (strain DSM 14801 / SPH-1)
Q1QSD0 1.52e-36 143 29 5 337 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8KAC9 1.57e-36 143 30 8 336 3 atpD2 ATP synthase subunit beta 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B9K814 1.65e-36 142 32 9 368 3 atpB V-type ATP synthase beta chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B3EJK9 1.65e-36 143 31 8 340 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain BS1)
Q3ITC7 1.69e-36 143 32 6 330 3 atpB V-type ATP synthase beta chain Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
C1CSD0 1.8e-36 143 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain Taiwan19F-14)
Q7CRB1 1.8e-36 143 33 7 311 1 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97PT4 1.8e-36 143 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2S6P1 1.83e-36 142 31 5 326 3 atpD ATP synthase subunit beta Hahella chejuensis (strain KCTC 2396)
Q88UU1 1.91e-36 143 33 10 351 3 atpA ATP synthase subunit alpha Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A4SUT4 1.92e-36 142 30 4 308 3 atpD ATP synthase subunit beta Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B8G6G6 1.92e-36 142 31 7 311 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
A5I556 1.96e-36 142 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FWQ6 1.96e-36 142 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain ATCC 19397 / Type A)
Q7W3B0 1.99e-36 142 30 5 330 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 1.99e-36 142 30 5 330 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B1ICT1 2.01e-36 143 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain Hungary19A-6)
A4SC45 2.03e-36 142 32 7 313 3 atpD ATP synthase subunit beta Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B1KXT5 2.04e-36 142 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain Loch Maree / Type A3)
A7GGL3 2.04e-36 142 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IJM7 2.04e-36 142 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain Okra / Type B1)
Q3J9F4 2.1e-36 143 32 4 317 3 atpB V-type ATP synthase beta chain Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q2YCA3 2.1e-36 142 30 8 339 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B3PLV6 2.13e-36 144 30 5 317 3 atpA ATP synthase subunit alpha Metamycoplasma arthritidis (strain 158L3-1)
Q7VU44 2.18e-36 142 30 5 330 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B3EDQ7 2.25e-36 142 31 7 311 3 atpD ATP synthase subunit beta Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B9LBM0 2.37e-36 142 32 8 313 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 2.37e-36 142 32 8 313 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B9MBA3 2.44e-36 142 32 6 310 3 atpD ATP synthase subunit beta Acidovorax ebreus (strain TPSY)
B1JFU1 2.46e-36 142 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas putida (strain W619)
Q48333 2.72e-36 142 33 6 328 1 atpB V-type ATP synthase beta chain Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
A1WF58 2.73e-36 142 32 9 340 3 atpD ATP synthase subunit beta Verminephrobacter eiseniae (strain EF01-2)
Q5P4E2 2.75e-36 142 30 4 308 3 atpD ATP synthase subunit beta Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1W2T7 2.77e-36 142 32 6 310 3 atpD ATP synthase subunit beta Acidovorax sp. (strain JS42)
C1FTN6 2.84e-36 142 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain Kyoto / Type A2)
Q9PE85 2.98e-36 142 31 5 314 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
B1XSD4 2.98e-36 142 30 4 308 3 atpD ATP synthase subunit beta Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q46FH4 3.07e-36 142 33 4 315 3 atpB V-type ATP synthase beta chain Methanosarcina barkeri (strain Fusaro / DSM 804)
B9DME3 3.14e-36 142 32 8 306 3 atpD ATP synthase subunit beta Staphylococcus carnosus (strain TM300)
A6UT36 3.19e-36 142 31 8 370 3 atpB V-type ATP synthase beta chain Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q3A946 3.23e-36 142 30 7 334 3 atpD ATP synthase subunit beta Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1BCJ2 3.32e-36 142 32 6 306 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A1AXU2 3.47e-36 142 31 6 327 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
Q3B406 3.53e-36 142 31 12 388 3 atpD2 ATP synthase subunit beta 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A7N6Q5 3.73e-36 142 32 6 305 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
A6UP55 4.22e-36 142 30 6 366 3 atpB V-type ATP synthase beta chain Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A0RXK0 4.44e-36 141 32 4 311 3 atpB V-type ATP synthase beta chain Cenarchaeum symbiosum (strain A)
Q7P095 4.6e-36 141 32 7 311 3 atpD ATP synthase subunit beta Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87E90 4.62e-36 142 31 5 314 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 4.62e-36 142 31 5 314 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
C5BF40 4.76e-36 141 30 6 327 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
Q6LKZ6 4.78e-36 141 32 6 310 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
B5ZAW1 4.81e-36 141 30 8 352 3 atpD ATP synthase subunit beta Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
C3L1B0 4.83e-36 141 33 5 309 3 atpB V-type ATP synthase beta chain Clostridium botulinum (strain 657 / Type Ba4)
Q2NQ86 4.86e-36 141 30 3 303 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
B9E8E6 4.92e-36 142 29 11 408 3 atpD ATP synthase subunit beta Macrococcus caseolyticus (strain JCSC5402)
B2VCA4 5.06e-36 141 31 3 303 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q3SVJ1 5.08e-36 142 28 9 395 3 atpD ATP synthase subunit beta Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A0PZC7 5.26e-36 141 32 6 335 3 atpB V-type ATP synthase beta chain Clostridium novyi (strain NT)
C1CLK8 5.47e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain P1031)
B5E673 5.47e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae serotype 19F (strain G54)
P95787 5.47e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q223D6 5.51e-36 141 31 6 310 3 atpD1 ATP synthase subunit beta 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0LSL6 5.65e-36 142 29 9 409 3 atpD ATP synthase subunit beta Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q8RGE2 5.82e-36 141 30 6 305 1 atpD ATP synthase subunit beta Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q0VKX4 6.05e-36 141 30 3 307 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C1CF95 6.16e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain JJA)
B2IQX2 6.16e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain CGSP14)
B8ZLB1 6.16e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C8A1 6.16e-36 142 33 7 311 3 atpA ATP synthase subunit alpha Streptococcus pneumoniae (strain 70585)
A1JTC6 6.3e-36 141 29 5 357 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A9AVV4 6.38e-36 141 27 9 406 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q2NF88 6.65e-36 141 30 7 366 3 atpB V-type ATP synthase beta chain Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A1WZT1 6.69e-36 141 31 3 302 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
Q2KU36 6.75e-36 141 29 5 337 3 atpD ATP synthase subunit beta Bordetella avium (strain 197N)
Q9PR15 7.54e-36 141 30 8 352 3 atpD ATP synthase subunit beta Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIB8 7.54e-36 141 30 8 352 3 atpD ATP synthase subunit beta Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q3K441 7.69e-36 141 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
A3DNQ5 7.87e-36 141 33 5 306 3 atpB V-type ATP synthase beta chain Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
Q5QZI6 7.89e-36 141 29 3 307 3 atpD ATP synthase subunit beta Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q56404 8.11e-36 141 32 4 314 1 atpB V-type ATP synthase beta chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72J73 8.11e-36 141 32 4 314 3 atpB V-type ATP synthase beta chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q4AAV7 8.61e-36 141 30 5 325 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A8V9 8.69e-36 141 30 5 325 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 7448)
Q9HT20 8.76e-36 140 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 8.76e-36 140 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 8.76e-36 140 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 8.76e-36 140 30 3 307 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
Q3B6W8 9.21e-36 140 31 8 336 3 atpD1 ATP synthase subunit beta 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A5CYE2 9.47e-36 140 31 7 331 3 atpD ATP synthase subunit beta Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B6JD09 9.72e-36 141 30 9 345 3 atpD ATP synthase subunit beta Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q3ZZT7 9.78e-36 140 30 9 369 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain CBDB1)
A5FRQ5 9.78e-36 140 30 9 369 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q313W0 1.03e-35 140 28 9 417 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q82XP8 1.05e-35 140 31 5 304 3 atpD ATP synthase subunit beta Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A1VPR5 1.1e-35 140 33 6 301 3 atpD2 ATP synthase subunit beta 2 Polaromonas naphthalenivorans (strain CJ2)
Q7VPP0 1.1e-35 140 30 3 303 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B3H2P3 1.18e-35 140 30 3 303 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 1.18e-35 140 30 3 303 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3DIM9 1.19e-35 140 28 6 349 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9HNE4 1.22e-35 140 32 6 331 1 atpB V-type ATP synthase beta chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R754 1.22e-35 140 32 6 331 3 atpB V-type ATP synthase beta chain Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0BRX2 1.24e-35 140 30 3 303 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A5E950 1.25e-35 140 29 11 400 3 atpD1 ATP synthase subunit beta 1 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B2A3G4 1.3e-35 141 32 7 312 3 atpA ATP synthase subunit alpha Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A1K1S2 1.3e-35 140 30 6 331 3 atpD ATP synthase subunit beta Azoarcus sp. (strain BH72)
Q601Z5 1.31e-35 140 30 5 325 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 232)
O57729 1.37e-35 140 31 5 350 3 atpB V-type ATP synthase beta chain Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2JX57 1.37e-35 140 32 6 305 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-3-3Ab)
Q3AP13 1.39e-35 140 31 7 311 3 atpD ATP synthase subunit beta Chlorobium chlorochromatii (strain CaD3)
Q2YUJ9 1.41e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain bovine RF122 / ET3-1)
P63676 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain MW2)
A8YY72 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7K5 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain MSSA476)
Q6GEX0 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain MRSA252)
P99111 1.42e-35 141 30 6 362 1 atpA ATP synthase subunit alpha Staphylococcus aureus (strain N315)
P63675 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IUQ0 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain JH9)
Q2FWE8 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF22 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain USA300)
A6U3J0 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain JH1)
A7X4U5 1.42e-35 141 30 6 362 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain Mu3 / ATCC 700698)
O27035 1.44e-35 140 32 4 316 3 atpB V-type ATP synthase beta chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B0TQF4 1.46e-35 140 30 6 333 3 atpD ATP synthase subunit beta Shewanella halifaxensis (strain HAW-EB4)
Q7NA94 1.5e-35 140 30 3 303 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A3QJR0 1.55e-35 140 30 6 333 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8U4A5 1.61e-35 140 33 4 316 3 atpB V-type ATP synthase beta chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q0AJB0 1.73e-35 140 30 5 304 3 atpD1 ATP synthase subunit beta 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B1YQL4 1.76e-35 140 31 6 305 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain MC40-6)
B8F774 1.77e-35 140 29 6 349 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
B2G691 1.78e-35 140 33 9 307 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIR1 1.78e-35 140 33 9 307 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri (strain DSM 20016)
Q5WB76 1.81e-35 140 33 7 311 3 atpA ATP synthase subunit alpha Shouchella clausii (strain KSM-K16)
B8E137 1.91e-35 140 32 3 301 3 atpB V-type ATP synthase beta chain Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B2UZK0 1.92e-35 140 30 5 330 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
Q6NDD2 1.97e-35 140 28 11 396 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q05FY1 1.99e-35 139 30 4 302 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
A2S6J8 2.02e-35 140 31 6 305 3 atpD ATP synthase subunit beta Burkholderia mallei (strain NCTC 10229)
B4EEY9 2.05e-35 140 31 6 305 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A4JA35 2.07e-35 140 31 6 305 3 atpD ATP synthase subunit beta Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9HY42 2.13e-35 140 29 8 355 3 atpD ATP synthase subunit beta Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q6CYJ5 2.13e-35 139 30 5 305 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8EM81 2.18e-35 140 32 11 375 3 atpA ATP synthase subunit alpha Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B2TK00 2.18e-35 140 30 5 330 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
Q0A4M8 2.2e-35 139 30 3 302 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q477Z1 2.21e-35 140 30 4 308 3 atpD ATP synthase subunit beta Dechloromonas aromatica (strain RCB)
B5YFA1 2.29e-35 139 32 3 301 3 atpB V-type ATP synthase beta chain Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q831A3 2.33e-35 140 34 7 311 3 atpA ATP synthase subunit alpha Enterococcus faecalis (strain ATCC 700802 / V583)
Q3Z8Z2 2.38e-35 139 30 9 369 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B9L7Y7 2.44e-35 139 28 9 359 3 atpD ATP synthase subunit beta Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q2VEH0 2.57e-35 140 32 8 337 3 atpB ATP synthase subunit beta, chloroplastic Solanum tuberosum
P17674 2.57e-35 140 33 8 327 3 atpA ATP synthase subunit alpha Priestia megaterium (strain ATCC 12872 / QMB1551)
A5HY52 2.64e-35 139 29 5 351 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 2.64e-35 139 29 5 351 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 2.64e-35 139 29 5 351 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
A8G7M8 2.68e-35 139 30 3 303 3 atpD ATP synthase subunit beta Serratia proteamaculans (strain 568)
A3MU07 2.74e-35 139 29 10 384 3 atpB V-type ATP synthase beta chain Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
P37808 2.79e-35 140 32 11 361 1 atpA ATP synthase subunit alpha Bacillus subtilis (strain 168)
Q2STE9 2.79e-35 139 31 6 305 1 atpD1 ATP synthase subunit beta 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PI0 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain K96243)
A3NF40 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 668)
Q3JXV8 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z0 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1106a)
A1V8T1 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain SAVP1)
Q62FR5 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ9 2.79e-35 139 31 6 305 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain NCTC 10247)
B4F0E7 2.82e-35 139 30 3 303 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
B6YV15 2.83e-35 139 33 4 316 3 atpB V-type ATP synthase beta chain Thermococcus onnurineus (strain NA1)
A6QIU9 2.84e-35 140 32 6 325 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain Newman)
Q5HE95 2.84e-35 140 32 6 325 3 atpA ATP synthase subunit alpha Staphylococcus aureus (strain COL)
Q2J3I4 2.88e-35 139 27 11 425 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain HaA2)
A4WGF5 2.9e-35 139 31 5 305 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
Q1LHL0 2.97e-35 139 30 4 303 3 atpD ATP synthase subunit beta Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1GXN0 2.97e-35 139 29 6 353 3 atpD ATP synthase subunit beta Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4J999 3e-35 139 28 8 363 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C1FQP5 3e-35 139 29 5 351 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
Q5UXY7 3.04e-35 139 31 6 330 3 atpB V-type ATP synthase beta chain Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A8A6J5 3.15e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
A7IH31 3.17e-35 139 28 6 349 3 atpD ATP synthase subunit beta Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B5RFW3 3.18e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q329S1 3.24e-35 139 30 5 305 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
C4KYS5 3.26e-35 140 33 7 317 3 atpA ATP synthase subunit alpha Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q3YVN6 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK77 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 3.27e-35 139 30 5 305 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
B1X9W0 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 3.27e-35 139 30 5 305 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
A7G9Q9 3.39e-35 139 28 5 351 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 3.39e-35 139 28 5 351 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
P22663 3.41e-35 139 32 4 315 3 atpB V-type ATP synthase beta chain Methanosarcina barkeri
A8ACN6 3.55e-35 139 30 5 305 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A0L2S8 3.56e-35 139 30 6 333 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
Q0W362 3.58e-35 139 32 3 309 3 atpB V-type ATP synthase beta chain Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B5BIN6 3.62e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 3.62e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q39KX6 3.65e-35 139 31 6 305 3 atpD ATP synthase subunit beta Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q21CY7 3.65e-35 139 27 11 425 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB18)
A1RQB0 3.67e-35 139 31 4 303 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 3.67e-35 139 31 4 303 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q7CPE2 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 3.73e-35 139 30 5 305 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
B1YMR6 3.79e-35 139 33 7 317 3 atpA ATP synthase subunit alpha Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8D3J3 3.91e-35 139 29 6 327 3 atpD ATP synthase subunit beta Wigglesworthia glossinidia brevipalpis
A5EXL4 3.97e-35 139 30 5 309 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
A1VFJ5 3.97e-35 139 30 6 333 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 3.97e-35 139 30 6 333 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8E8C0 4.01e-35 139 31 6 305 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q13DP2 4.11e-35 139 28 13 426 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB5)
Q7MA20 4.12e-35 139 31 6 312 3 atpA ATP synthase subunit alpha Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A3DIM7 4.14e-35 139 30 7 357 3 atpA ATP synthase subunit alpha Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2Y8G9 4.23e-35 139 35 3 277 3 atpA2 ATP synthase subunit alpha 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q1BRB0 4.32e-35 139 31 6 305 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain AU 1054)
B1JSV7 4.32e-35 139 31 6 305 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain MC0-3)
A0K2Y3 4.32e-35 139 31 6 305 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain HI2424)
P50002 4.45e-35 139 30 8 315 1 atpD ATP synthase subunit beta, sodium ion specific Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q4A604 4.54e-35 139 31 5 308 3 atpD ATP synthase subunit beta Mycoplasmopsis synoviae (strain 53)
P42465 4.73e-35 139 30 8 336 3 atpD ATP synthase subunit beta Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q07UZ5 4.82e-35 139 28 13 426 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisA53)
C5D990 4.96e-35 139 30 5 304 3 atpD ATP synthase subunit beta Geobacillus sp. (strain WCH70)
P27179 5.01e-35 139 33 3 274 3 atpA ATP synthase subunit alpha Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
C6DJH2 5.28e-35 139 30 5 305 3 atpD ATP synthase subunit beta Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7VQV6 5.38e-35 139 30 7 347 3 atpD ATP synthase subunit beta Blochmanniella floridana
C5A337 5.41e-35 139 32 4 316 3 atpB V-type ATP synthase beta chain Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
A7MMW9 5.44e-35 139 30 5 305 3 atpD ATP synthase subunit beta Cronobacter sakazakii (strain ATCC BAA-894)
Q07VU4 5.57e-35 139 30 6 331 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
Q5JIR2 5.68e-35 139 32 4 316 3 atpB V-type ATP synthase beta chain Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A9KX06 5.69e-35 139 31 4 303 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 5.69e-35 139 31 4 303 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 5.69e-35 139 31 4 303 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 5.69e-35 139 31 4 303 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
Q9K6H3 5.74e-35 139 32 8 317 3 atpA ATP synthase subunit alpha Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A3CS72 5.75e-35 138 32 4 315 3 atpB V-type ATP synthase beta chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A9AJG4 5.77e-35 139 31 6 305 3 atpD ATP synthase subunit beta Burkholderia multivorans (strain ATCC 17616 / 249)
Q95DR6 5.85e-35 139 29 13 402 3 atpB ATP synthase subunit beta, chloroplastic Agapanthus africanus
B8DYT0 5.91e-35 138 32 5 303 3 atpD ATP synthase subunit beta Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
C4LDW0 6.01e-35 138 30 5 326 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q0SSI3 6.01e-35 138 33 7 335 3 atpB V-type ATP synthase beta chain Clostridium perfringens (strain SM101 / Type A)
Q8XJW6 6.01e-35 138 33 7 335 3 atpB V-type ATP synthase beta chain Clostridium perfringens (strain 13 / Type A)
Q0TPW8 6.01e-35 138 33 7 335 3 atpB V-type ATP synthase beta chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B5Z8D0 6.07e-35 139 29 10 370 3 atpD ATP synthase subunit beta Helicobacter pylori (strain G27)
O32467 6.1e-35 138 32 4 316 3 atpB V-type ATP synthase beta chain Thermococcus sp. (strain KI)
A6W7G9 6.16e-35 139 31 11 389 3 atpD ATP synthase subunit beta Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A6W3S8 6.2e-35 138 30 3 302 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
Q12HQ1 6.22e-35 138 30 6 333 3 atpD ATP synthase subunit beta Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q9ZK81 6.26e-35 138 29 10 370 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
A4YKE0 6.4e-35 139 29 11 400 3 atpD ATP synthase subunit beta Bradyrhizobium sp. (strain ORS 278)
Q92FG8 6.52e-35 138 31 9 356 3 atpD1 ATP synthase subunit beta 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A6T470 6.56e-35 138 31 6 310 3 atpD ATP synthase subunit beta Janthinobacterium sp. (strain Marseille)
Q04ZU5 6.58e-35 138 30 9 389 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 6.58e-35 138 30 9 389 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q57669 6.59e-35 138 30 7 356 3 atpB V-type ATP synthase beta chain Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7IAU7 6.64e-35 138 31 3 309 3 atpB V-type ATP synthase beta chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q8XU76 6.78e-35 138 31 6 305 3 atpD ATP synthase subunit beta Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0BJL5 6.83e-35 138 31 6 305 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4RS81 7.08e-35 138 30 3 302 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A8HAG3 7.34e-35 138 30 4 303 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
P55988 7.48e-35 138 29 10 370 3 atpD ATP synthase subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
A4FXD3 7.63e-35 138 30 6 366 3 atpB V-type ATP synthase beta chain Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
B1YAT5 7.88e-35 138 29 10 384 3 atpB V-type ATP synthase beta chain Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
C1F3N8 7.93e-35 139 33 9 325 3 atpA ATP synthase subunit alpha Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
P22478 8.9e-35 138 31 8 306 3 atpD ATP synthase subunit beta Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9JW70 8.98e-35 138 31 7 311 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9KK92 9.15e-35 138 29 7 349 3 atpD ATP synthase subunit beta Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q13SQ2 9.97e-35 138 30 9 344 3 atpD2 ATP synthase subunit beta 2 Paraburkholderia xenovorans (strain LB400)
Q6LYE6 1.04e-34 138 30 6 355 3 atpB V-type ATP synthase beta chain Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6QB61 1.04e-34 138 31 11 362 3 atpA ATP synthase subunit alpha Sulfurovum sp. (strain NBC37-1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07975
Feature type CDS
Gene fliI
Product flagellar protein export ATPase FliI
Location 1746683 - 1748056 (strand: 1)
Length 1374 (nucleotides) / 457 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_205
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)
NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02412 flagellum-specific ATP synthase [EC:7.4.2.8] Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG002331 flagellum-specific ATP synthase FliI VF0394 Motility

Protein Sequence

MTARLGRWLEKLADAESRLNKIPRIRQYGRLTRATGLVMEAKGLVMPLGSTCLIERTIGKTVEEVESEVVGFNGSQMLLMPLQEVEGLTPGARVYAQSIPGREGEGRQLPLGDALLGRVLDGSGDPLDGLPPPDTSYRAPLITPPINPLQRTPITDVLDVGVRAINALLTVGRGQRMGLFAGSGVGKSVLLGMMARFTQADVIVVGLIGERGREVKDFIENILGKEGLARSVVVAAPADVSPLLRMQGASYATRIAEDFRDRGKHVLLIMDSLTRYSMAQREIALAVGEPPATKGYPPSVFAKLPALVERAGNGVDGGGSITAFYTVLTEGDDQQDPIADSARAILDGHIVLSRSLAESGHYPAIDIEASISRAMTSLIDKTHYRRVQVFKQLLSSYQRNRDLINVGAYATGSDPMLDKAIALYPSLAKFLQQDIQEQCSYQHACEQLNQLITLDSF

Flanking regions ( +/- flanking 50bp)

GCGACACGTTGGCATGAATTGTGTCGTCTTGCTGCACCGGAGGCGTTGTAATGACCGCAAGATTGGGGCGTTGGTTAGAAAAACTCGCTGATGCAGAATCTCGTTTAAATAAAATTCCGCGCATTCGCCAATATGGTCGCTTAACCCGTGCTACAGGCTTAGTCATGGAAGCTAAGGGGCTAGTTATGCCCCTTGGCTCTACCTGCTTAATAGAACGTACCATTGGTAAAACGGTTGAAGAAGTTGAAAGTGAAGTCGTCGGATTTAACGGTAGCCAAATGTTACTCATGCCACTACAAGAAGTGGAAGGATTAACCCCAGGTGCTCGAGTCTACGCTCAATCGATCCCCGGTCGTGAAGGCGAAGGCCGACAATTACCCCTTGGTGATGCCTTATTAGGCCGCGTACTTGATGGCTCAGGTGATCCGCTAGATGGTTTACCGCCGCCAGATACCAGTTATCGTGCACCACTGATTACACCACCTATCAACCCATTACAACGTACCCCCATTACAGATGTACTTGATGTGGGTGTACGTGCCATCAATGCACTGCTTACGGTCGGTCGTGGCCAACGTATGGGACTCTTTGCCGGCTCGGGTGTCGGGAAAAGTGTTCTATTAGGTATGATGGCGCGTTTTACTCAAGCCGACGTCATTGTCGTAGGGCTTATTGGTGAACGTGGTCGTGAAGTTAAAGACTTTATTGAGAATATCCTAGGTAAAGAAGGATTAGCACGCTCGGTGGTAGTAGCAGCACCTGCTGATGTTTCACCACTCTTACGAATGCAAGGTGCTTCTTATGCAACCCGTATTGCCGAAGATTTTCGTGATCGCGGTAAACATGTTTTATTAATTATGGATTCGTTAACTCGCTATAGCATGGCGCAGCGTGAAATTGCCTTAGCCGTTGGTGAACCGCCGGCGACAAAAGGTTATCCCCCTTCTGTATTTGCAAAATTACCCGCACTTGTTGAGCGTGCCGGTAATGGCGTTGATGGTGGTGGCTCCATTACTGCTTTCTATACCGTGTTAACAGAAGGTGACGATCAGCAAGATCCAATCGCTGATTCTGCCCGTGCTATTTTGGATGGCCATATCGTGCTTTCGCGTTCACTGGCGGAATCGGGTCACTACCCTGCTATTGATATTGAAGCGTCCATTAGCCGTGCGATGACCTCACTGATTGATAAAACACATTATCGCCGAGTACAAGTATTTAAGCAGCTATTATCCAGTTATCAGCGCAATCGCGACTTAATTAATGTAGGGGCTTATGCCACAGGCAGTGATCCTATGCTGGATAAGGCGATTGCCCTTTATCCATCATTAGCAAAATTCTTACAACAAGATATTCAAGAGCAATGTAGCTATCAACATGCTTGTGAACAACTTAATCAACTGATCACACTAGATTCATTCTGAACATAATCAGGAAAAATAAAGAGGGTTCCAATGCGGGAGCAGTCACCTTT