Homologs in group_536

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01195 FBDBKF_01195 91.4 Morganella morganii S1 baeS Signal transduction histidine kinase
EHELCC_00350 EHELCC_00350 91.4 Morganella morganii S2 baeS Signal transduction histidine kinase
NLDBIP_03110 NLDBIP_03110 91.4 Morganella morganii S4 baeS Signal transduction histidine kinase
LHKJJB_04625 LHKJJB_04625 91.4 Morganella morganii S3 baeS Signal transduction histidine kinase
HKOGLL_02420 HKOGLL_02420 91.4 Morganella morganii S5 baeS Signal transduction histidine kinase
PMI_RS09250 PMI_RS09250 63.7 Proteus mirabilis HI4320 - HAMP domain-containing sensor histidine kinase

Distribution of the homologs in the orthogroup group_536

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_536

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P52101 0.0 552 62 1 470 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q8XA47 0.0 552 62 1 470 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
P35164 1.3e-21 101 25 3 227 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P08401 1.52e-21 100 31 6 253 1 creC Sensor protein CreC Escherichia coli (strain K12)
P08982 6.62e-20 95 26 7 292 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 6.62e-20 95 26 7 292 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
Q44007 9.57e-20 95 25 8 309 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A0QR01 1.63e-19 93 28 3 228 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q06240 2.97e-19 92 30 11 271 1 vanS Sensor protein VanS Enterococcus faecium
P23545 6.34e-19 93 32 6 234 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P41406 7.47e-19 92 26 7 292 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
A0A4P7TSF2 7.82e-19 92 26 7 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 7.82e-19 92 26 7 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 7.82e-19 92 26 7 292 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P9WGK5 1.75e-18 90 31 6 235 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.75e-18 90 31 6 235 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.75e-18 90 31 6 235 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4I8 2.02e-18 90 31 8 278 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2.02e-18 90 31 8 278 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q93CB7 2.92e-18 91 28 10 305 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9KHI5 3.67e-18 91 28 3 231 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
T2KMF4 5.12e-18 91 29 6 239 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P21865 6.75e-18 90 29 5 233 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q8FK37 1.1e-17 89 28 8 281 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77485 1.13e-17 89 27 8 281 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
B1WYT4 1.16e-17 88 28 6 255 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8XBY4 1.37e-17 88 28 8 281 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
O34206 3.56e-17 87 28 5 227 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P9WGK8 4.35e-17 87 28 8 296 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 4.35e-17 87 28 8 296 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGK9 4.85e-17 87 28 8 296 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q03228 4.93e-17 87 29 5 235 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P58356 6.81e-17 87 28 7 230 3 torS Sensor protein TorS Escherichia coli O157:H7
A5A2P0 8.09e-17 85 25 7 238 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P54883 9.48e-17 85 29 6 233 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P58402 1.16e-16 87 29 9 232 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q9CCJ1 1.3e-16 85 26 8 304 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q4L8M0 1.89e-16 85 23 6 295 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q7BWI3 2.1e-16 84 29 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P30855 5.34e-16 84 29 9 232 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
B7KFU0 6.18e-16 83 26 7 281 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P39453 6.51e-16 84 28 7 230 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q49ZT9 7.12e-16 83 24 5 283 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q54SP4 7.98e-16 84 29 12 283 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P14377 8.03e-16 83 25 5 219 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
A0QTK3 9.85e-16 83 26 7 290 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q45614 1.79e-15 82 26 6 240 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q8DMC5 2.23e-15 81 28 6 256 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8CU87 2.67e-15 82 25 7 235 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 2.67e-15 82 25 7 235 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P42245 2.89e-15 80 27 3 215 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P37461 2.93e-15 81 26 5 216 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 3.12e-15 81 26 5 216 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q4A159 3.6e-15 81 24 5 235 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9RDT3 3.93e-15 80 23 5 234 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
P30847 4.15e-15 80 26 6 289 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q9KLK7 4.67e-15 81 28 4 230 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A6QD58 5.7e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 5.8e-15 80 23 5 234 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 5.8e-15 80 23 5 234 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 5.8e-15 80 23 5 234 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ8 6.06e-15 80 25 8 237 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
P59342 7.19e-15 81 30 9 214 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0DMC5 7.37e-15 81 26 6 232 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0AEC5 7.52e-15 80 29 8 214 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 7.52e-15 80 29 8 214 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 7.52e-15 80 29 8 214 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P0DMC6 7.77e-15 80 26 6 224 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q8X614 1e-14 79 24 5 217 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q5A599 1.05e-14 80 28 7 249 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P40330 1.42e-14 80 29 9 236 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P58662 1.43e-14 80 27 6 224 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YZ23 1.48e-14 79 25 5 293 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P26762 1.49e-14 80 29 9 236 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q742C0 1.57e-14 79 26 8 291 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q56128 1.81e-14 79 27 6 224 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q6GKS6 1.99e-14 79 24 7 236 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
A2BRQ6 2.06e-14 78 28 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A3PDI2 2.12e-14 78 28 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q1B3X9 2.36e-14 79 27 10 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 2.36e-14 79 27 10 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A3Q5L8 2.68e-14 78 27 10 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
I1WSZ3 2.84e-14 78 25 7 297 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q8ZPP5 3.05e-14 79 28 6 222 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3GPN8 3.73e-14 77 25 5 275 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q8DPL8 3.95e-14 77 25 7 230 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 3.95e-14 77 25 7 230 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q06067 4.1e-14 78 28 9 250 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P0DMK6 5.27e-14 77 26 5 261 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q8NV46 6.14e-14 77 24 6 299 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 6.14e-14 77 24 6 299 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P94414 6.49e-14 77 25 6 243 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
A8G5E7 6.62e-14 76 28 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q8NWF3 8.37e-14 77 26 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q9L523 8.37e-14 77 26 3 226 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6G973 8.37e-14 77 26 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 8.37e-14 77 26 3 226 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 8.37e-14 77 26 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A3X0 8.55e-14 77 24 7 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 8.55e-14 77 24 7 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 8.55e-14 77 24 7 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 8.55e-14 77 24 7 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 8.55e-14 77 24 7 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
A0QBR0 9.61e-14 77 26 8 291 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q7V113 9.97e-14 76 28 6 227 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q04943 1.01e-13 77 30 13 296 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q55932 1.07e-13 76 30 6 230 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8KIY1 1.1e-13 77 26 6 286 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 1.12e-06 55 20 9 282 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q6GGK7 1.18e-13 77 26 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q5HLN1 1.32e-13 76 23 7 280 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A5H7 1.33e-13 76 26 3 226 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 1.33e-13 76 26 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0F7 1.57e-13 76 27 8 237 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q06904 1.59e-13 75 27 8 253 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P16575 1.62e-13 77 28 8 231 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P9WGL1 1.67e-13 76 29 8 262 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.67e-13 76 29 8 262 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.67e-13 76 29 8 262 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8CRA8 1.71e-13 75 23 7 280 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0C0F6 1.72e-13 76 27 8 237 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q55630 1.8e-13 75 24 7 266 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6GE72 1.93e-13 75 24 7 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
A1KHB8 1.96e-13 75 29 8 262 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.96e-13 75 29 8 262 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1XD95 2e-13 76 24 5 239 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
E0X9C7 2.16e-13 76 27 7 276 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 2.91e-06 53 20 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A8Z553 2.33e-13 75 24 7 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 2.33e-13 75 24 7 302 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 2.33e-13 75 24 7 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 2.33e-13 75 24 7 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 2.33e-13 75 24 7 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
A0R3I7 2.35e-13 75 28 7 258 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P37894 2.39e-13 76 25 5 228 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O34989 2.6e-13 75 26 4 210 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q8DMT2 2.85e-13 74 31 3 154 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7U871 3.48e-13 74 27 5 221 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q9Z5G7 4.27e-13 75 27 7 264 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
P54302 4.34e-13 75 25 6 230 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q9APE0 4.54e-13 74 24 7 223 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q869S5 5.45e-13 75 30 9 223 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q02541 5.68e-13 74 27 9 275 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q8DKG0 5.74e-13 75 25 3 228 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q31AE8 7.21e-13 73 27 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q52969 7.63e-13 74 24 4 223 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q08408 8.16e-13 73 23 7 242 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
B7K3M6 9.41e-13 73 26 9 261 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P0AE82 1.03e-12 73 24 5 295 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.03e-12 73 24 5 295 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.03e-12 73 24 5 295 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P73276 1.19e-12 73 27 8 253 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5HPC4 1.3e-12 73 25 11 311 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q551X9 1.33e-12 73 26 8 235 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P20169 1.47e-12 73 23 3 238 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0IBF4 1.49e-12 72 28 6 221 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P45608 1.76e-12 72 25 4 227 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P9WGL3 1.76e-12 73 27 6 238 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9P896 1.79e-12 73 30 11 227 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WGL2 1.8e-12 73 27 6 238 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5W4E3 2.24e-12 73 27 7 276 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 2.91e-06 53 20 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q87GU5 2.5e-12 73 24 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8CSL7 3.02e-12 72 25 11 311 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q54YZ9 3.98e-12 72 26 9 241 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q6GGZ4 4.28e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q95PI2 4.52e-12 72 26 7 220 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q7A0W5 4.64e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 4.64e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 4.64e-12 71 24 7 303 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 4.64e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 4.64e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q2YY04 4.64e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN3 4.64e-12 71 24 7 303 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 4.64e-12 71 24 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
P76339 5.17e-12 71 27 9 250 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P51392 6.43e-12 71 24 5 239 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q3AYV8 6.54e-12 70 27 6 222 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q8E3C7 7.4e-12 70 26 8 227 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q2JKD9 8.15e-12 70 26 7 255 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
B0JK50 1.05e-11 70 25 6 231 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8YR50 1.06e-11 70 30 2 130 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8DXQ8 1.22e-11 69 26 8 227 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
B2J946 1.22e-11 69 25 7 258 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q2JWK9 1.24e-11 69 26 7 252 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q3M8A7 1.25e-11 69 30 2 131 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9HZ47 1.32e-11 70 26 7 246 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI3 1.45e-11 70 27 11 247 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DN03 1.5e-11 69 29 8 208 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 1.5e-11 69 29 8 208 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P48027 2.6e-11 69 25 15 358 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
A0PWB3 3.92e-11 68 27 7 266 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q7A1J2 4.14e-11 67 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 4.14e-11 67 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 4.14e-11 67 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 4.14e-11 67 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 4.14e-11 67 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q04804 4.36e-11 68 27 9 251 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6GIT7 4.53e-11 67 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
P18392 6.03e-11 67 26 9 269 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q2T0V9 7.19e-11 68 25 6 242 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9HV31 8.35e-11 67 30 4 192 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58363 1.09e-10 67 24 7 227 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P0AEC4 1.11e-10 67 24 7 227 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 1.11e-10 67 24 7 227 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
A1TEL6 1.19e-10 67 25 7 260 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q9ZHD4 1.37e-10 67 24 10 315 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q57BR6 1.58e-10 67 25 7 237 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.58e-10 67 25 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.58e-10 67 25 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q47745 1.61e-10 66 26 12 312 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q5HHW5 1.63e-10 66 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.63e-10 66 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.63e-10 66 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q8YIM6 1.68e-10 67 25 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q840P7 1.74e-10 65 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q7V6P7 2.44e-10 65 26 7 220 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q47457 2.54e-10 66 24 7 308 3 pcoS Probable sensor protein PcoS Escherichia coli
A2C884 2.57e-10 65 26 7 220 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q8D5Z6 2.82e-10 66 24 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
O31661 3e-10 66 22 9 263 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
A6X5X4 3.19e-10 66 25 7 236 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9F8D7 3.24e-10 66 27 10 236 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q7MD16 3.41e-10 66 24 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P0A4I6 3.81e-10 65 23 5 239 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 3.81e-10 65 23 5 239 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P09431 3.97e-10 65 27 9 234 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P28788 5.99e-10 64 27 8 232 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
Q54U87 6e-10 65 22 7 302 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q07737 6.01e-10 65 26 11 296 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
O69729 6.62e-10 64 25 11 320 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O33071 7.77e-10 64 29 9 247 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P08400 8.22e-10 64 25 5 227 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P71380 8.9e-10 64 22 2 225 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P10955 1.28e-09 63 27 8 242 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
B0CI82 1.38e-09 64 25 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8FZ86 1.4e-09 64 25 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
A5VRX4 1.77e-09 63 25 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P45609 1.92e-09 63 24 5 227 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P42707 3.6e-09 62 21 10 316 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
Q8GP19 4.75e-09 62 25 9 254 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q9RQQ9 5.56e-09 62 26 8 249 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45336 6.61e-09 61 26 12 304 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9M715 8.23e-09 62 24 7 237 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q86CZ2 8.51e-09 62 26 7 234 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
P44578 1.17e-08 60 28 8 225 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4L6C5 1.56e-08 60 22 7 302 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
O14002 1.59e-08 61 25 8 237 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0A2D9 1.82e-08 59 26 9 232 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 1.82e-08 59 26 9 232 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
E5KK10 2.24e-08 60 23 7 239 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P06218 2.84e-08 59 27 9 232 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q8CTI3 2.88e-08 59 25 8 238 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.88e-08 59 25 8 238 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55168 3.35e-08 59 24 5 242 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WGK7 3.37e-08 59 29 9 247 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 3.37e-08 59 29 9 247 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 3.37e-08 59 29 9 247 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O81122 3.91e-08 59 27 8 236 2 ETR1 Ethylene receptor Malus domestica
Q4UMD4 4e-08 59 21 9 328 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P94608 4.06e-08 59 24 4 227 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P19906 4.31e-08 58 27 10 232 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P33113 4.39e-08 58 24 6 236 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P33639 4.6e-08 59 22 6 218 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q44930 5.12e-08 58 23 10 283 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P23621 6.54e-08 58 26 3 231 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54RP6 7.73e-08 58 24 9 233 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
O34638 7.98e-08 58 25 7 288 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q8Z3P2 8.11e-08 58 27 5 226 3 qseC Sensor protein QseC Salmonella typhi
Q9K620 8.25e-08 57 26 8 228 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8ZLZ9 9.93e-08 57 27 5 226 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFB7 1.09e-07 57 26 9 232 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 1.09e-07 57 26 9 232 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 1.09e-07 57 26 9 232 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q9SXL4 1.13e-07 58 23 7 270 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
O32193 1.16e-07 57 23 8 245 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
O34971 1.3e-07 58 26 6 238 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q9M7M1 1.3e-07 57 27 8 236 2 ETR1 Ethylene receptor Prunus persica
Q53RH0 1.42e-07 57 27 9 249 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 1.42e-07 57 27 9 249 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
O35044 1.77e-07 56 23 7 235 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q9XH57 1.98e-07 57 27 8 236 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9XH58 2.01e-07 57 25 8 247 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
P72292 2.46e-07 57 25 7 227 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q2FWH7 3.14e-07 56 24 5 220 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9SSY6 3.51e-07 56 27 9 236 2 ETR1 Ethylene receptor 1 Cucumis sativus
P16497 4.54e-07 56 25 6 215 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q9HU20 4.72e-07 55 25 6 204 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q41342 5.27e-07 55 27 8 237 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
P0DM80 5.82e-07 55 23 12 316 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 5.82e-07 55 23 12 316 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 5.82e-07 55 23 12 316 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 5.82e-07 55 23 12 316 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 5.82e-07 55 23 12 316 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 5.82e-07 55 23 12 316 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 5.92e-07 55 23 12 316 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P49333 6.72e-07 55 27 9 232 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q54YH4 6.85e-07 55 23 5 226 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
O82436 7.93e-07 55 27 9 236 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
P39764 8.49e-07 55 23 7 268 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q49XM6 9.28e-07 54 26 7 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9ZWL6 2.58e-06 53 26 8 236 2 ETR1 Ethylene receptor Passiflora edulis
O49230 2.8e-06 53 27 9 233 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9P4U6 2.82e-06 53 36 0 74 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q83RR1 3.14e-06 53 24 15 321 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 3.14e-06 53 24 14 318 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23837 3.26e-06 53 24 15 321 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q3S4A7 3.29e-06 53 22 14 373 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P10047 3.83e-06 53 24 9 275 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q5A872 4.48e-06 53 40 0 74 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9C5U1 5.03e-06 53 21 6 258 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
A1A697 6.77e-06 52 21 7 285 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q3J6C1 6.85e-06 52 27 7 206 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O49187 7.73e-06 52 25 8 236 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P26489 8.05e-06 52 24 7 228 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9HWR3 8.18e-06 52 22 7 234 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23222 9.27e-06 51 23 5 226 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O48929 9.28e-06 52 24 7 235 2 ETR1 Ethylene receptor Nicotiana tabacum
Q9ZEP3 1.1e-05 51 27 7 198 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9LCC2 1.1e-05 51 25 7 247 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P74111 1.23e-05 51 22 4 234 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9RZA4 1.4e-05 51 28 5 221 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P41503 1.96e-05 50 25 9 232 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
P39664 2.49e-05 50 27 5 189 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9C5U2 2.73e-05 50 20 10 342 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q04850 2.85e-05 50 24 10 216 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A3BE68 2.85e-05 50 31 2 100 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
P0C0Z0 2.9e-05 50 26 6 206 3 regB Sensor histidine kinase RegB Cereibacter sphaeroides
A2YFR6 3.16e-05 50 31 2 100 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A7HD43 3.59e-05 49 25 8 222 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q5AHA0 5.36e-05 49 24 11 243 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
O25026 6.52e-05 48 21 6 218 1 flgS Sensor histidine kinase FlgS Helicobacter pylori (strain ATCC 700392 / 26695)
Q9RC53 7.17e-05 48 24 10 241 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KM24 9.43e-05 48 26 10 229 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9R6X3 0.000108 48 23 6 225 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O24972 0.000141 47 23 7 244 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P39928 0.000188 48 37 0 75 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q49VK4 0.000192 47 23 6 210 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P15939 0.000274 47 23 8 233 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1A698 0.000353 47 24 5 161 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q9I4F8 0.000358 46 25 7 248 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P33529 0.00037 47 23 7 222 2 PHY Phytochrome Mougeotia scalaris
P07168 0.000411 46 23 8 234 3 virA Wide host range VirA protein Rhizobium radiobacter
Q38846 0.000445 46 24 7 235 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q6GJ10 0.000462 45 22 8 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
P0DOA0 0.0005 46 36 1 74 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P10799 0.000552 46 23 8 234 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P42422 0.000649 45 19 6 222 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
A1A696 0.000704 46 20 7 273 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A2WYI4 0.000742 45 20 7 273 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
P40719 0.000766 45 27 7 220 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P10578 0.000835 45 23 9 255 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07265
Feature type CDS
Gene -
Product HAMP domain-containing sensor histidine kinase
Location 1511877 - 1513316 (strand: -1)
Length 1440 (nucleotides) / 479 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_536
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2205 Signal transduction mechanisms (T) T K+-sensing histidine kinase KdpD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07711 two-component system, NtrC family, sensor histidine kinase GlrK [EC:2.7.13.3] Two-component system
Quorum sensing
-

Protein Sequence

MTILKKWRLFPRSLRQLVVVAFCLVLLPLLGLAWQAYQSFDDLSNQAAQISIATVQDARQSEEMSGLALEMERSYRQYCVLGNETLKNVWNKQYARYEEYLSRRKQSDQDPRYTDVISASLGQLSVLKCENGEPVAAMTTHLEAFAKGNADLVQAVREINFRRGEELQNAIAQKGQSFGWQSLLVFVLSTGLIILFTRMIIGPVKVIDRMVNRLGEGRNLVQRLDHFKGPRELRSLAQRIIWLSERLAWLESQRHEFLRHISHELKTPLASMREGTELLADEVAGPLTADQKEVVTILSDCSRHLQTLIEQLLEYNRTLVDSPTEAKWVNLDTVVQEVVSAHSLPARSKGITTGVELDETSVWAEPVLLTRVLDNLYSNAVHYGAESGNIRITSHKAGQHIQIDVANTGTPIPEEEQGMIFEPFYQGSLQRKGAVKGSGLGLSIARDCINRMGGELILVGSEGADVCFRIQLPFHTLLE

Flanking regions ( +/- flanking 50bp)

TCTCTTAGCGCAGACTCAGTTAGCATCAGCACATGACAACAGGTTAAGAGATGACAATCTTGAAGAAATGGCGATTATTTCCGCGCTCTTTGCGACAACTCGTGGTGGTTGCATTCTGTCTGGTGCTGCTGCCCTTGCTGGGGCTGGCCTGGCAGGCGTATCAGAGTTTTGATGATCTGAGTAATCAGGCGGCACAAATCAGTATTGCGACAGTTCAGGATGCCCGGCAAAGTGAAGAGATGTCGGGTCTTGCGCTGGAAATGGAGCGCAGTTACCGTCAGTATTGTGTGTTGGGTAACGAAACACTGAAAAATGTCTGGAACAAACAATATGCCCGCTATGAAGAATATCTCAGCCGCCGGAAGCAGTCTGATCAGGATCCGCGCTATACTGATGTTATCTCCGCCAGTCTCGGGCAATTATCTGTACTGAAATGTGAAAACGGCGAACCGGTTGCAGCTATGACAACCCATCTGGAAGCGTTTGCCAAAGGCAATGCTGATTTGGTTCAGGCTGTCCGTGAAATTAACTTCCGGCGCGGCGAAGAGCTGCAAAATGCCATTGCACAGAAAGGTCAGTCTTTCGGTTGGCAGAGCCTGCTGGTTTTTGTTCTGAGCACCGGGCTGATTATCCTGTTTACCCGGATGATTATCGGACCGGTGAAAGTGATTGACCGGATGGTTAACCGTCTCGGTGAAGGGCGCAATCTGGTGCAGCGTCTTGATCACTTCAAAGGTCCCCGCGAACTGCGCTCACTGGCGCAGCGGATTATCTGGCTGAGTGAGCGCCTCGCCTGGCTGGAATCCCAGCGGCATGAATTTTTGCGCCATATATCCCATGAACTGAAAACACCGCTGGCGAGCATGCGCGAAGGAACTGAATTGCTGGCAGATGAAGTTGCCGGTCCGCTGACTGCGGATCAGAAAGAAGTGGTGACTATTCTCAGTGATTGCAGCCGTCACTTACAAACACTGATTGAACAACTGCTGGAATACAACCGGACACTGGTGGACAGCCCGACAGAAGCCAAATGGGTTAACCTGGATACGGTAGTGCAGGAGGTTGTCAGCGCGCACAGTTTACCGGCGAGAAGCAAAGGGATCACCACAGGAGTAGAGCTGGACGAGACAAGTGTCTGGGCTGAGCCTGTGTTATTAACGCGTGTACTCGATAATCTCTACTCAAATGCGGTACACTATGGCGCTGAATCGGGTAATATCCGGATAACCAGCCACAAGGCAGGTCAGCACATACAGATTGATGTCGCCAATACCGGTACACCAATCCCGGAAGAGGAGCAGGGAATGATCTTTGAACCTTTCTACCAGGGCTCACTTCAGCGCAAAGGTGCCGTAAAAGGCAGCGGGCTGGGGCTGAGTATCGCGCGGGATTGCATTAACCGGATGGGCGGCGAACTGATATTAGTCGGTTCTGAAGGTGCGGATGTCTGCTTCCGTATCCAGCTTCCGTTCCACACCTTACTGGAATAACAGGTCAGCTATTAATTTGAACATGATATTTAAGTCCCTGATTGCCGTCG