Homologs in group_613

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01195 FBDBKF_01195 62.9 Morganella morganii S1 baeS Signal transduction histidine kinase
EHELCC_00350 EHELCC_00350 62.9 Morganella morganii S2 baeS Signal transduction histidine kinase
NLDBIP_03110 NLDBIP_03110 62.9 Morganella morganii S4 baeS Signal transduction histidine kinase
LHKJJB_04625 LHKJJB_04625 62.9 Morganella morganii S3 baeS Signal transduction histidine kinase
HKOGLL_02420 HKOGLL_02420 62.9 Morganella morganii S5 baeS Signal transduction histidine kinase
F4V73_RS07265 F4V73_RS07265 63.7 Morganella psychrotolerans - HAMP domain-containing sensor histidine kinase

Distribution of the homologs in the orthogroup group_613

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_613

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P52101 0.0 560 61 3 473 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q8XA47 0.0 559 61 3 473 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
P35164 1.2e-19 95 28 4 215 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P08982 1.15e-18 91 26 9 300 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.15e-18 91 26 9 300 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 1.46e-18 91 26 10 302 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q9KLK7 1.05e-17 90 30 7 230 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4L8M0 1.06e-17 89 25 6 295 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
A0A4P7TSF2 2.03e-17 88 25 9 300 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 2.03e-17 88 25 9 300 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 2.03e-17 88 25 9 300 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P9WGK8 2.84e-17 88 25 7 295 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 2.84e-17 88 25 7 295 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
T2KMF4 3.75e-17 88 29 6 240 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P9WGK9 4.52e-17 87 25 7 295 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O34206 9.03e-17 86 27 4 228 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q93CB7 9.45e-17 86 25 9 345 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P23545 1.13e-16 86 28 5 237 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q9CCJ1 1.43e-16 85 24 9 332 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P30847 2.15e-16 85 27 6 281 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P08401 2.96e-16 84 30 7 236 1 creC Sensor protein CreC Escherichia coli (strain K12)
A0QR01 6.92e-16 82 27 5 232 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGK5 1.06e-15 82 29 5 234 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.06e-15 82 29 5 234 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.06e-15 82 29 5 234 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KHI5 1.41e-15 83 26 2 225 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q44007 2.46e-15 81 26 6 293 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P42245 2.95e-15 80 25 5 241 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P0A4I8 7.35e-15 80 28 6 253 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 7.35e-15 80 28 6 253 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P20169 1.57e-14 79 24 3 235 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1XD95 3.4e-14 78 26 5 239 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
P51392 5.08e-14 78 25 5 235 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q06067 8.1e-14 77 27 8 245 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P58356 1.1e-13 77 28 7 230 3 torS Sensor protein TorS Escherichia coli O157:H7
A0QTK3 1.3e-13 76 24 7 295 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P54883 1.53e-13 75 26 5 229 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q8DN03 1.84e-13 75 25 10 295 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 1.84e-13 75 25 10 295 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P0DMC6 2.35e-13 76 29 7 223 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 2.44e-13 76 29 7 223 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q4LAJ8 3.73e-13 75 24 3 210 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
P39453 4.09e-13 75 28 7 230 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8ZPP5 4.52e-13 75 27 6 218 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5HLN1 5.07e-13 74 23 7 287 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8DPL8 5.91e-13 74 27 5 209 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 5.91e-13 74 27 5 209 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B7KFU0 7.42e-13 73 27 9 277 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
A5A2P0 8.06e-13 73 25 6 218 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P94414 8.57e-13 73 25 9 251 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q8CRA8 8.73e-13 73 23 7 287 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7MD16 9.29e-13 74 28 8 234 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
B1WYT4 9.56e-13 73 27 8 256 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P21865 9.64e-13 74 26 5 230 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
P9WGL3 9.98e-13 74 25 6 237 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 1.02e-12 74 25 6 237 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9HZ47 1.43e-12 73 26 7 249 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9RDT3 1.52e-12 72 25 6 219 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q56128 1.78e-12 73 29 7 223 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
A6QD58 2.04e-12 73 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
A8G5E7 2.05e-12 72 27 6 228 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q57BR6 2.15e-12 73 28 6 206 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 2.15e-12 73 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 2.15e-12 73 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q7A215 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 2.21e-12 72 25 6 219 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 2.21e-12 72 25 6 219 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 2.21e-12 72 25 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8YIM6 2.37e-12 73 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P58662 2.5e-12 73 28 6 223 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A2BRQ6 2.79e-12 71 27 5 228 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q8D5Z6 2.8e-12 72 28 8 234 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q45614 2.96e-12 72 24 6 221 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
A3PDI2 3.59e-12 71 27 5 228 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q4A159 3.92e-12 72 23 4 212 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P33639 4.31e-12 72 25 10 221 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0CI82 4.72e-12 72 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q08408 4.94e-12 71 23 6 251 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q8FZ86 5.01e-12 72 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q8CU87 5.93e-12 71 24 4 215 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 5.93e-12 71 24 4 215 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8Z553 6.36e-12 71 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 6.36e-12 71 24 7 295 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 6.36e-12 71 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 6.36e-12 71 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 6.36e-12 71 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
A6X5X4 7.03e-12 71 29 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q6GKS6 7.43e-12 71 24 6 219 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P0C0F6 7.81e-12 71 25 6 231 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q06240 7.97e-12 70 27 11 275 1 vanS Sensor protein VanS Enterococcus faecium
P0C0F7 8.3e-12 71 25 6 231 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q869S5 8.41e-12 71 28 9 231 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q6GGK7 8.95e-12 70 27 5 229 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
A9M715 1.02e-11 71 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P18392 1.09e-11 70 27 12 280 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q7A3X0 1.09e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 1.09e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 1.09e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 1.09e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 1.09e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YZ23 1.14e-11 70 25 5 292 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NV46 1.23e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.23e-11 70 24 7 295 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q9L523 1.34e-11 70 25 4 227 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 1.48e-11 70 25 4 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.48e-11 70 25 4 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.48e-11 70 25 4 227 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.48e-11 70 25 4 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
P14377 1.76e-11 69 21 4 216 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q7A5H7 2.23e-11 69 25 4 227 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 2.23e-11 69 25 4 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9HUI3 2.26e-11 70 28 8 232 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8X614 2.29e-11 69 21 4 216 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
O14002 2.47e-11 70 28 10 235 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q04804 2.74e-11 68 29 9 250 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7V113 2.81e-11 68 27 6 228 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q6GE72 3.23e-11 68 24 7 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
A5VRX4 3.24e-11 69 28 6 206 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P9WGL1 3.92e-11 68 26 10 278 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 3.92e-11 68 26 10 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 3.92e-11 68 26 10 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8Z332 4.31e-11 68 22 5 222 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P58402 4.44e-11 69 28 7 230 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P37461 4.46e-11 68 22 5 222 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O69729 4.66e-11 68 30 10 230 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P30855 5.51e-11 68 28 7 230 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q5A599 5.59e-11 68 29 12 251 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P54302 6.22e-11 68 25 6 231 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q8DKG0 7.03e-11 68 23 3 231 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A1KHB8 8.08e-11 67 26 10 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 8.08e-11 67 26 10 278 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q55630 8.64e-11 67 25 9 266 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q49ZT9 9.68e-11 67 22 5 289 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q742C0 1.01e-10 67 25 8 270 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P77485 1.08e-10 67 23 8 298 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
P71380 1.1e-10 67 25 4 226 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FK37 1.37e-10 67 23 8 298 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q87GU5 1.64e-10 67 24 8 237 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P59342 1.67e-10 67 25 17 337 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q54SP4 1.81e-10 67 29 11 256 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
B2J946 1.81e-10 66 24 7 282 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q0IBF4 1.85e-10 66 26 5 221 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
B7K3M6 1.87e-10 66 25 9 284 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q55932 2.15e-10 66 28 6 228 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7BWI3 2.17e-10 65 25 6 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q31AE8 2.47e-10 65 26 5 228 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q8DMC5 2.72e-10 65 26 7 251 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0AEC5 2.76e-10 66 25 17 337 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 2.76e-10 66 25 17 337 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 2.76e-10 66 25 17 337 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P45608 2.95e-10 65 24 4 226 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
A3Q5L8 2.98e-10 65 27 7 203 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
P37894 3.01e-10 66 25 5 229 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1B3X9 3.04e-10 65 27 8 205 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 3.04e-10 65 27 8 205 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
Q95PI2 3.26e-10 66 26 9 223 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q551X9 3.41e-10 66 27 6 212 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
A0R3I7 4.21e-10 65 25 8 240 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9ZHD4 4.29e-10 65 26 11 315 3 silS Probable sensor kinase SilS Salmonella typhimurium
A0QBR0 4.37e-10 65 25 8 270 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q9P896 4.71e-10 65 29 10 224 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8E3C7 5.2e-10 64 27 7 210 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
O31661 6.06e-10 65 23 6 219 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q8DXQ8 6.86e-10 64 27 7 210 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9APE0 8.64e-10 64 21 6 224 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q8XBY4 1.49e-09 63 22 8 298 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q04943 1.5e-09 63 25 10 295 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q54YZ9 1.75e-09 64 25 13 294 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P08400 1.88e-09 63 25 7 235 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P94608 2.08e-09 63 25 5 228 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8YR50 2.17e-09 62 26 5 224 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P0A4I6 2.51e-09 62 22 4 230 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 2.51e-09 62 22 4 230 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9Z5G7 2.85e-09 62 25 10 274 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q3M8A7 2.89e-09 62 26 5 224 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A0PWB3 2.91e-09 62 26 9 272 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q07737 3.07e-09 63 23 10 297 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
I1WSZ3 3.09e-09 62 23 5 223 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P0DMK6 3.17e-09 62 22 5 223 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q8KIY1 4.02e-09 62 27 8 246 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 7.12e-07 55 21 7 231 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
E0X9C7 4.06e-09 62 25 4 233 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 0.000309 47 20 6 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P45609 4.24e-09 62 25 7 235 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q840P7 5.14e-09 61 23 8 287 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q5HHW5 5.73e-09 61 23 8 287 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 5.73e-09 61 23 8 287 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 5.73e-09 61 23 8 287 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
O34989 7.04e-09 61 24 4 214 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q3AYV8 8.6e-09 60 24 6 223 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q8DMT2 9.46e-09 60 28 3 143 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q47745 1.12e-08 60 23 10 312 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q03228 1.21e-08 61 23 3 229 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2T0V9 1.24e-08 61 24 5 222 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A1TEL6 1.29e-08 60 23 7 236 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q7U871 1.32e-08 60 24 5 223 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q7A1J2 1.62e-08 60 23 8 287 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.62e-08 60 23 8 287 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.62e-08 60 23 8 287 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.62e-08 60 23 8 287 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.62e-08 60 23 8 287 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIT7 1.71e-08 59 23 8 287 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q8CTI3 1.76e-08 59 25 7 250 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.76e-08 59 25 7 250 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q52969 1.83e-08 60 23 7 228 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
P42707 1.96e-08 60 24 10 293 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
O33071 2.21e-08 60 25 7 232 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
O32193 2.26e-08 60 24 11 295 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
A0A0H3GPN8 2.27e-08 60 23 5 249 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q5HPC4 2.3e-08 60 25 12 313 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CSL7 2.72e-08 59 24 10 312 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q44930 3.03e-08 59 23 9 276 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
A5W4E3 3.17e-08 60 25 4 228 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 0.000331 47 20 6 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P48027 3.49e-08 59 23 15 392 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P39664 3.68e-08 59 27 6 186 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0AEC4 3.73e-08 59 24 6 209 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 3.73e-08 59 24 6 209 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 3.83e-08 59 24 6 209 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P9WGK7 3.89e-08 59 26 9 257 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 3.89e-08 59 26 9 257 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 3.89e-08 59 26 9 257 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7A0W5 3.9e-08 59 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 3.9e-08 59 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 3.9e-08 59 23 9 306 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 3.9e-08 59 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 3.9e-08 59 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 3.9e-08 59 23 9 306 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 3.9e-08 59 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
A2C884 3.92e-08 58 24 6 226 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
P39764 3.93e-08 58 23 8 273 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q6GGZ4 4e-08 59 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q2YY04 4.69e-08 58 23 9 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P76339 6.62e-08 58 23 9 329 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q54U87 6.79e-08 59 27 8 244 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
P0AFB7 7.03e-08 57 25 10 234 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 7.03e-08 57 25 10 234 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 7.03e-08 57 25 10 234 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
P72292 7.29e-08 58 25 11 312 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q2FWH7 7.49e-08 58 23 4 219 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2JWK9 9.63e-08 57 25 7 250 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
P33113 1.01e-07 57 24 7 243 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P06218 1.42e-07 57 24 9 230 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
P26762 1.46e-07 58 24 7 215 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7V6P7 1.48e-07 57 23 6 226 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q8GP19 1.6e-07 57 21 9 297 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
B0JK50 1.62e-07 57 30 2 121 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q2JKD9 1.65e-07 57 25 7 221 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9RQQ9 2.34e-07 57 24 7 247 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P40330 2.5e-07 57 25 7 214 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9HWR3 2.6e-07 57 22 5 229 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0DOA0 2.64e-07 57 29 4 188 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
Q54Q69 2.66e-07 57 28 7 181 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54RP6 2.71e-07 57 25 11 240 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q06904 3.38e-07 55 22 7 249 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P16575 4.34e-07 56 25 7 214 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P44578 5.34e-07 55 26 7 224 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9F8D7 5.5e-07 56 25 8 221 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P0AE82 5.9e-07 55 22 4 248 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 5.9e-07 55 22 4 248 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 5.9e-07 55 22 4 248 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q9HU20 5.99e-07 55 23 7 222 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HV31 1.07e-06 54 26 5 205 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A2D9 1.09e-06 54 23 9 232 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 1.09e-06 54 23 9 232 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
P73276 1.19e-06 54 23 9 255 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P19906 1.22e-06 53 25 9 232 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q02541 1.67e-06 54 24 8 282 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q4L6C5 1.9e-06 53 23 4 213 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
P28788 2.35e-06 53 23 9 247 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
Q3S4A7 2.65e-06 53 22 6 251 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P16497 2.75e-06 53 23 5 218 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P45336 3.78e-06 52 25 9 274 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9C5U1 5.36e-06 52 20 6 260 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q8FIB8 7.61e-06 52 25 13 303 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23837 7.74e-06 52 25 13 303 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q9C5U2 7.97e-06 52 21 6 284 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q83RR1 8.02e-06 52 25 13 303 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
P23621 1.09e-05 51 28 8 226 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9K620 1.24e-05 50 24 9 262 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q47457 1.74e-05 50 23 5 280 3 pcoS Probable sensor protein PcoS Escherichia coli
Q41342 2.93e-05 50 25 7 230 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q49XM6 4.62e-05 49 24 6 241 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q86CZ2 4.76e-05 50 23 8 246 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
O34638 5.02e-05 49 25 12 293 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q9R6X3 6.05e-05 49 25 6 208 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P42422 6.34e-05 48 22 6 211 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
P30844 7e-05 48 27 11 274 1 basS Sensor protein BasS Escherichia coli (strain K12)
P36557 7.12e-05 48 27 11 272 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04850 7.97e-05 48 24 11 225 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9M7M1 0.000134 48 24 7 232 2 ETR1 Ethylene receptor Prunus persica
Q9HWA7 0.000139 48 31 4 121 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
E5KK10 0.000165 48 20 7 239 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
O24972 0.00033 46 25 8 215 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
A7HD43 0.000354 46 23 8 218 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q54W36 0.000363 47 30 5 152 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54YH4 0.000409 47 24 7 229 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P49333 0.000409 46 25 7 240 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
O81122 0.000447 46 24 7 232 2 ETR1 Ethylene receptor Malus domestica
O49230 0.000583 46 24 8 253 2 ETR1 Ethylene receptor 1 Brassica oleracea
P09431 0.000622 45 22 8 231 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P07168 0.000645 46 25 9 232 3 virA Wide host range VirA protein Rhizobium radiobacter
P10799 0.000766 45 25 9 232 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
Q9P4U6 0.001 45 31 0 72 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09250
Feature type CDS
Gene -
Product HAMP domain-containing sensor histidine kinase
Location 2016236 - 2017684 (strand: -1)
Length 1449 (nucleotides) / 482 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_613
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2205 Signal transduction mechanisms (T) T K+-sensing histidine kinase KdpD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07711 two-component system, NtrC family, sensor histidine kinase GlrK [EC:2.7.13.3] Two-component system
Quorum sensing
-

Protein Sequence

MISLKKWRIFPRSLRQLVIMAFWMVLLPLLVLAYQAYQSLDQLSNQAAITNKNALADTERSEVMRNLAIEMEGNYRRYCVLRDKTDEEMYQQRYQQYSKMFSTLQQTIIPLSESKEAQALNTSLKTLKSIQCKNSEPTSQMQQALEQFSYANNRIVVLTKEIIFSRGEQLQMAIAEKGRYFGWQSLIVFVFSLILIALFTRMIIGPVKGIEKMINRLGEGRTLNNNLNSFQGPRELRSLAQRIIWLSERLAWLESQRHEFLRHISHELKTPLASMREGTELLADEVAGPLTLDQKEVVAILDNSSKQLQLLIEQLLDYNRKLSEVPQQIEEVDLTTLVNDVVLAHSLPARAKGIKTIISLDLKKCRAETTLLSRVIDNLYSNAVHYGAESGNIWISSYQIEQKIVIDIANKGTPIPESEQKMIFEPFFQGSLLRKGAVKGSGLGLSIAHDCIKRMDGELNIVHSDYADVCFRIELPLLSENK

Flanking regions ( +/- flanking 50bp)

TTTCTTGTTATTAAGTCATGTAGCATCGCATTACTCTAATAGGTGTTGAGATGATTTCATTGAAAAAGTGGCGTATTTTTCCCCGATCTTTAAGACAATTGGTTATCATGGCATTTTGGATGGTGCTGTTACCGCTTCTCGTCCTTGCCTATCAGGCTTATCAAAGTTTGGATCAGCTTAGTAACCAAGCCGCTATTACCAATAAAAATGCGTTAGCGGATACCGAGCGTAGCGAGGTGATGCGTAATTTAGCTATTGAAATGGAAGGAAATTATCGACGATATTGTGTATTGCGTGATAAAACTGATGAAGAAATGTATCAACAGCGTTATCAACAATACAGCAAAATGTTCTCTACCTTGCAGCAGACTATCATCCCTCTTTCTGAGTCTAAAGAAGCACAAGCCTTGAATACTTCTTTGAAAACGCTCAAATCAATTCAATGCAAAAATAGTGAACCCACTTCTCAAATGCAACAAGCATTAGAGCAATTTTCTTATGCCAATAACCGCATTGTCGTGTTAACTAAAGAGATTATTTTTAGTCGTGGCGAGCAACTACAAATGGCTATTGCTGAAAAAGGGCGTTATTTTGGTTGGCAAAGTTTAATTGTTTTTGTTTTTAGCCTGATTTTAATTGCCTTATTTACCCGTATGATCATCGGTCCGGTTAAAGGTATAGAAAAAATGATTAACCGATTGGGGGAAGGGCGTACATTAAATAATAACTTGAATTCGTTTCAGGGGCCACGTGAATTACGCTCTTTAGCTCAACGTATTATTTGGTTAAGTGAACGTCTTGCATGGCTAGAATCGCAACGCCATGAGTTTTTACGTCATATTTCTCATGAGTTAAAAACACCGTTAGCCAGTATGCGCGAAGGAACAGAATTATTAGCGGATGAAGTAGCAGGGCCTTTAACCTTAGATCAAAAAGAAGTCGTAGCTATTCTTGATAATAGTAGTAAACAACTTCAATTATTAATTGAGCAACTACTTGATTATAATCGTAAACTTTCCGAAGTACCTCAGCAAATTGAGGAAGTTGATTTAACCACATTAGTGAATGATGTGGTGTTAGCGCATAGTTTACCCGCCCGAGCGAAAGGCATTAAGACGATAATTTCACTTGATCTGAAAAAATGTCGAGCAGAAACGACGTTATTATCAAGAGTTATTGATAATCTCTACTCGAATGCGGTGCACTATGGCGCTGAATCGGGTAATATCTGGATCTCTAGTTATCAAATTGAACAGAAAATAGTTATTGATATAGCCAATAAAGGCACTCCGATCCCTGAATCAGAACAAAAAATGATTTTTGAGCCCTTTTTTCAAGGTTCTCTATTACGTAAAGGGGCTGTAAAAGGGAGTGGTTTGGGGTTAAGTATTGCTCATGACTGTATCAAAAGAATGGATGGCGAGTTAAATATTGTTCATTCTGACTATGCTGATGTCTGTTTTCGTATTGAACTACCGCTACTTTCTGAGAATAAATAATGCATATCAGGTCACAAAAACAGGTGTCTTTTCATCAGTATAAAAAATTA