Homologs in group_536

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_00350 EHELCC_00350 100.0 Morganella morganii S2 baeS Signal transduction histidine kinase
NLDBIP_03110 NLDBIP_03110 100.0 Morganella morganii S4 baeS Signal transduction histidine kinase
LHKJJB_04625 LHKJJB_04625 100.0 Morganella morganii S3 baeS Signal transduction histidine kinase
HKOGLL_02420 HKOGLL_02420 100.0 Morganella morganii S5 baeS Signal transduction histidine kinase
F4V73_RS07265 F4V73_RS07265 91.4 Morganella psychrotolerans - HAMP domain-containing sensor histidine kinase
PMI_RS09250 PMI_RS09250 62.9 Proteus mirabilis HI4320 - HAMP domain-containing sensor histidine kinase

Distribution of the homologs in the orthogroup group_536

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_536

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8XA47 0.0 549 62 1 470 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
P52101 0.0 548 62 1 470 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
A0QR01 5.74e-22 100 31 6 231 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P08401 1.2e-21 100 30 4 247 1 creC Sensor protein CreC Escherichia coli (strain K12)
P08982 3.23e-21 99 27 6 292 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 3.23e-21 99 27 6 292 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P9WGK5 1.33e-20 97 30 6 239 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.33e-20 97 30 6 239 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.33e-20 97 30 6 239 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A4P7TSF2 1.8e-20 97 27 6 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 1.8e-20 97 27 6 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 1.8e-20 97 27 6 292 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P35164 1.83e-20 97 25 6 272 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q44007 2.51e-20 97 25 9 327 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P41406 3.29e-20 96 27 6 292 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
B1WYT4 5.88e-20 94 28 8 277 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5A2P0 1.3e-19 94 27 7 238 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P54883 7.7e-19 92 28 6 243 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q8XBY4 8.04e-19 92 28 8 278 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q06240 8.49e-19 91 30 8 227 1 vanS Sensor protein VanS Enterococcus faecium
P23545 9e-19 92 31 5 231 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q9KHI5 1.04e-18 92 29 3 231 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O34206 1.23e-18 92 28 4 227 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P77485 1.3e-18 91 28 8 278 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8FK37 1.3e-18 91 28 8 278 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A4I8 1.81e-18 90 31 8 278 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 1.81e-18 90 31 8 278 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8Z332 2.06e-18 91 27 5 216 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P37461 2.34e-18 90 27 5 216 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8DPL8 3.78e-18 90 29 7 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 3.78e-18 90 29 7 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P14377 6.98e-18 89 25 5 219 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
P21865 8.06e-18 90 29 5 233 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q4L8M0 1.31e-17 88 24 6 295 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q9RDT3 1.68e-17 87 25 4 232 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q8X614 2.02e-17 88 25 5 217 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
P58356 2.43e-17 89 29 7 230 3 torS Sensor protein TorS Escherichia coli O157:H7
Q54SP4 3.09e-17 88 29 19 354 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
A6QD58 3.22e-17 88 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 3.52e-17 87 25 4 232 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 3.52e-17 87 25 4 232 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 3.52e-17 87 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ8 4.68e-17 87 24 5 234 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9CCJ1 5.15e-17 87 25 8 304 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q4A159 7.95e-17 86 25 5 235 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P94414 9.21e-17 86 28 6 234 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q6GKS6 1.23e-16 86 25 4 232 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
T2KMF4 1.59e-16 86 29 6 242 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q45614 1.79e-16 85 26 4 229 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q8CU87 2.21e-16 85 25 6 234 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 2.21e-16 85 25 6 234 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q03228 2.43e-16 85 28 4 235 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q55932 2.99e-16 84 30 5 227 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WGK9 3.08e-16 84 26 8 296 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 3.52e-16 84 26 8 296 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 3.52e-16 84 26 8 296 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P39453 3.63e-16 85 28 7 230 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q7A0W5 3.73e-16 84 25 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 3.73e-16 84 25 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 3.73e-16 84 25 7 303 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 3.73e-16 84 25 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 3.73e-16 84 25 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q2YY04 3.73e-16 84 25 8 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN3 3.73e-16 84 25 7 303 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 3.73e-16 84 25 7 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q6GGZ4 4.09e-16 84 25 8 303 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
P58402 4.36e-16 85 28 9 232 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P59342 5.87e-16 84 26 15 333 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P30855 6.43e-16 84 29 10 236 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P0AEC5 6.88e-16 84 30 8 214 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 6.88e-16 84 30 8 214 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 6.88e-16 84 30 8 214 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
A2BRQ6 1.04e-15 82 28 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A3PDI2 1.42e-15 81 28 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q7V113 2.18e-15 81 28 6 227 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B7KFU0 2.54e-15 81 26 5 234 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q7BWI3 3.49e-15 80 29 7 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q93CB7 3.87e-15 81 26 10 305 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q54YZ9 4.05e-15 82 26 10 262 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
A8G5E7 4.74e-15 80 28 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q9KLK7 5.62e-15 81 28 5 231 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
I1WSZ3 6.54e-15 80 25 7 297 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
A0QTK3 7.83e-15 80 27 8 291 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A0H3GPN8 9.46e-15 79 25 5 275 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q742C0 1.13e-14 79 26 9 295 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P40330 1.18e-14 80 29 9 248 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
O34989 1.19e-14 80 27 5 217 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P0DMK6 1.27e-14 79 25 7 297 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
P26762 1.34e-14 80 29 9 248 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B7K3M6 1.91e-14 78 26 8 259 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q7U871 2.13e-14 78 28 6 221 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q9Z5G7 2.14e-14 79 27 9 270 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q49ZT9 2.75e-14 78 23 5 283 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DMT2 2.82e-14 77 29 7 226 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P73276 3.74e-14 77 27 9 270 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q31AE8 3.87e-14 77 27 6 227 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
P0DMC6 4.06e-14 78 27 7 230 1 rcsC Sensor histidine kinase RcsC Escherichia coli
B2J946 4.18e-14 77 26 7 258 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q9APE0 4.18e-14 77 25 6 220 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
P0DMC5 4.59e-14 78 27 7 230 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0AE82 5.23e-14 77 24 5 295 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 5.23e-14 77 24 5 295 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 5.23e-14 77 24 5 295 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
A0QBR0 6.86e-14 77 26 9 295 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q551X9 7.77e-14 77 27 7 234 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q9HUI3 8.45e-14 77 30 10 238 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q55630 9.36e-14 76 24 8 266 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7A5H7 9.39e-14 77 26 5 232 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 9.39e-14 77 26 5 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q869S5 1.09e-13 77 30 8 214 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q1XD95 1.11e-13 77 24 6 256 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q0IBF4 1.15e-13 75 28 7 231 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P54302 1.16e-13 77 26 6 230 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q8ZPP5 1.17e-13 77 27 5 218 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8NWF3 1.19e-13 77 26 5 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.19e-13 77 26 5 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.19e-13 77 26 5 232 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.19e-13 77 26 5 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 1.2e-13 76 26 5 232 1 srrB Sensor protein SrrB Staphylococcus aureus
P58662 1.41e-13 77 27 6 228 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8NV46 1.45e-13 76 24 6 299 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.45e-13 76 24 6 299 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P16575 1.49e-13 77 28 7 239 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8E3C7 1.6e-13 75 26 7 226 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q8DKG0 1.68e-13 76 26 3 228 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6GGK7 1.68e-13 76 26 5 232 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q56128 1.7e-13 76 28 7 228 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P45608 1.81e-13 75 26 4 226 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P30847 1.91e-13 75 24 6 290 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q06067 2.12e-13 76 26 7 226 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P20169 2.19e-13 76 22 4 255 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0C0F6 2.4e-13 76 28 8 237 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8DXQ8 2.44e-13 75 26 7 226 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q2YZ23 2.54e-13 75 25 8 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3X0 2.57e-13 75 25 8 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 2.57e-13 75 25 8 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 2.57e-13 75 25 8 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 2.57e-13 75 25 8 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 2.57e-13 75 25 8 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8KIY1 2.59e-13 76 25 8 285 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 0.000132 48 19 7 232 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q07737 2.67e-13 75 25 9 294 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P0C0F7 2.74e-13 75 28 8 237 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q08408 2.89e-13 75 21 4 240 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q3AYV8 2.93e-13 74 29 7 222 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
A8Z553 3.26e-13 75 25 8 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 3.26e-13 75 25 8 302 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 3.26e-13 75 25 8 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 3.26e-13 75 25 8 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 3.26e-13 75 25 8 302 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q5A599 3.97e-13 75 27 7 237 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1B3X9 4.35e-13 74 26 10 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 4.35e-13 74 26 10 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A3Q5L8 4.88e-13 74 26 10 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q5HLN1 4.99e-13 74 23 7 284 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q52969 5.21e-13 74 24 2 221 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q87GU5 5.5e-13 75 24 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6GE72 5.83e-13 74 25 8 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q5HPC4 7.8e-13 73 25 11 309 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P42245 7.92e-13 72 26 3 215 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q8D5Z6 8.29e-13 74 27 6 231 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q8CRA8 8.38e-13 73 23 7 284 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7MD16 8.52e-13 74 27 6 231 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P37894 8.59e-13 74 26 5 228 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8YR50 9.47e-13 73 26 7 227 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q02541 9.51e-13 73 28 9 275 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
P48027 1.02e-12 74 26 15 357 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q57BR6 1.02e-12 74 27 8 238 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.02e-12 74 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.02e-12 74 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q3M8A7 1.21e-12 73 26 7 227 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YIM6 1.26e-12 73 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q04943 1.3e-12 73 30 12 295 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7V6P7 1.47e-12 72 27 9 267 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q8DMC5 1.64e-12 72 25 9 268 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8CSL7 1.74e-12 72 25 11 309 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A2C884 2.27e-12 72 27 9 267 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
A0PWB3 2.53e-12 72 27 8 270 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q06904 2.57e-12 72 24 8 246 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2JKD9 2.66e-12 71 26 6 243 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
A6X5X4 2.82e-12 72 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q2JWK9 3.08e-12 71 26 7 256 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q95PI2 4.29e-12 72 28 9 219 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
P9WGL3 5.18e-12 72 27 6 228 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 5.18e-12 72 27 6 228 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P18392 5.5e-12 71 25 7 275 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q9HZ47 5.75e-12 71 27 8 245 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL1 5.99e-12 71 27 7 263 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 5.99e-12 71 27 7 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 5.99e-12 71 27 7 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9ZHD4 6.33e-12 71 24 11 316 3 silS Probable sensor kinase SilS Salmonella typhimurium
A1KHB8 6.84e-12 71 27 7 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 6.84e-12 71 27 7 263 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
E0X9C7 7.16e-12 71 26 8 279 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 7.95e-07 55 20 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A0R3I7 7.53e-12 70 27 8 262 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1TEL6 8.07e-12 70 25 5 262 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q8FZ86 1.11e-11 71 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 1.11e-11 71 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q9F8D7 1.26e-11 70 28 11 246 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
B0JK50 1.29e-11 69 24 6 231 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P51392 1.47e-11 70 23 5 235 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
A5VRX4 1.53e-11 70 27 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P0A4I6 2.31e-11 69 24 5 235 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 2.31e-11 69 24 5 235 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9P896 2.66e-11 69 28 9 215 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O69729 2.7e-11 69 28 6 226 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O14002 3.18e-11 69 26 9 265 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5W4E3 3.44e-11 69 26 8 279 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 7.89e-07 55 20 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9HV31 4.19e-11 68 30 5 189 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47745 4.61e-11 68 25 11 309 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q2T0V9 6.36e-11 68 25 6 242 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9M715 6.46e-11 68 26 8 238 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
O31661 6.79e-11 68 25 7 221 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q8GP19 7.91e-11 67 24 8 251 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P0AEC4 7.96e-11 68 25 7 227 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 7.96e-11 68 25 7 227 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 8.31e-11 68 25 7 227 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q8DN03 1e-10 67 29 8 211 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 1e-10 67 29 8 211 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P76339 1.04e-10 67 26 8 250 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
E5KK10 1.11e-10 67 25 7 239 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q54U87 1.16e-10 68 23 7 257 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q7A1J2 1.35e-10 66 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.35e-10 66 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.35e-10 66 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.35e-10 66 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.35e-10 66 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
O33071 1.43e-10 66 30 10 228 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q6GIT7 1.51e-10 66 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q4L6C5 1.51e-10 66 24 2 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q47457 2.39e-10 66 25 9 310 3 pcoS Probable sensor protein PcoS Escherichia coli
P71380 2.83e-10 65 22 2 225 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34971 3.56e-10 66 26 5 225 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q5HHW5 5.93e-10 64 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 5.93e-10 64 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 5.93e-10 64 24 8 298 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q44930 5.98e-10 64 23 9 297 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q840P7 6.32e-10 64 24 8 298 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
P08400 7.72e-10 64 25 5 227 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P0A2D9 8.8e-10 63 27 10 237 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 8.8e-10 63 27 10 237 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
P28788 8.99e-10 63 28 9 240 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
P06218 1.3e-09 63 28 10 233 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q04804 1.39e-09 63 26 9 252 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23621 1.47e-09 63 27 3 225 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45609 1.78e-09 63 24 5 227 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
O34638 2.76e-09 62 25 6 286 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
P42707 2.76e-09 62 22 11 316 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
O32193 3.18e-09 62 24 11 296 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P19906 4.19e-09 61 27 9 232 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P0AFB7 4.77e-09 61 28 10 233 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 4.77e-09 61 28 10 233 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 4.77e-09 61 28 10 233 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
P72292 4.89e-09 62 26 8 237 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q2FWH7 4.9e-09 62 25 4 205 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P33639 6.19e-09 62 23 8 218 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q55168 6.54e-09 62 25 6 236 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9RQQ9 9.21e-09 61 25 8 266 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P49333 9.87e-09 61 30 11 232 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P44578 1.05e-08 60 27 8 227 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CTI3 1.05e-08 60 23 5 237 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.05e-08 60 23 5 237 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P09431 1.05e-08 60 26 8 231 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P9WGK7 1.67e-08 60 29 10 228 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.67e-08 60 29 10 228 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.67e-08 60 29 10 228 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O81122 1.92e-08 60 28 10 251 2 ETR1 Ethylene receptor Malus domestica
Q9XH58 3.06e-08 60 25 8 247 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q9K620 3.19e-08 58 26 7 228 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9M7M1 4.44e-08 59 28 8 236 2 ETR1 Ethylene receptor Prunus persica
O49230 5.32e-08 59 29 10 234 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q8Z7H3 9.92e-08 58 25 14 326 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 1.01e-07 57 25 14 326 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 1.01e-07 57 25 14 326 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 1.01e-07 57 25 14 326 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 1.01e-07 57 25 14 326 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 1.01e-07 57 25 14 326 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 1.01e-07 57 25 14 326 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
O35044 1.01e-07 57 22 6 231 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
P94608 1.48e-07 57 24 4 227 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q49XM6 1.56e-07 57 25 7 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9SSY6 1.82e-07 57 28 10 236 2 ETR1 Ethylene receptor 1 Cucumis sativus
P33113 1.97e-07 57 23 5 230 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q86CZ2 1.98e-07 57 26 9 235 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
O49187 1.99e-07 57 25 8 236 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q8X739 2.12e-07 57 25 15 319 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
O82436 2.2e-07 57 27 9 236 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9XH57 2.98e-07 56 27 8 236 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P10955 3.66e-07 56 27 8 233 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q5A872 3.98e-07 56 41 0 74 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A1A697 6.26e-07 55 22 12 364 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
O48929 6.66e-07 55 25 8 236 2 ETR1 Ethylene receptor Nicotiana tabacum
Q53RH0 7.24e-07 55 25 8 248 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 7.24e-07 55 25 8 248 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q9ZWL6 9.67e-07 55 27 8 236 2 ETR1 Ethylene receptor Passiflora edulis
P45336 9.7e-07 54 24 12 309 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3S4A7 1.08e-06 55 23 7 249 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q4UMD4 1.1e-06 54 21 8 323 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P23222 1.11e-06 54 23 5 226 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q54RP6 1.12e-06 55 24 9 233 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P10047 1.16e-06 54 26 6 218 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q54YH4 1.45e-06 55 23 8 231 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q41342 1.53e-06 54 25 7 235 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
P39764 1.56e-06 53 23 6 244 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q9SXL4 1.75e-06 54 22 7 291 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9KM24 2.03e-06 53 26 9 225 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9ZCU7 2.12e-06 53 21 8 323 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
Q9RC53 2.18e-06 53 27 4 140 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P23837 2.46e-06 53 24 15 319 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q9P4U6 2.47e-06 53 36 0 74 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q83RR1 2.55e-06 53 24 15 314 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
P0DOA0 2.69e-06 53 27 5 197 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
Q8FIB8 2.81e-06 53 25 15 319 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9RZA4 2.98e-06 53 25 3 220 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P74111 3.42e-06 53 21 2 228 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0C0Z0 5.6e-06 52 27 7 206 3 regB Sensor histidine kinase RegB Cereibacter sphaeroides
Q5AHA0 8.05e-06 52 25 10 233 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q3J6C1 1.14e-05 51 27 7 206 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9LCC2 1.15e-05 51 24 6 234 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q08430 1.26e-05 51 24 9 224 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q9R6X3 1.32e-05 51 24 9 259 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9HWR3 1.53e-05 51 23 6 230 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O24972 1.58e-05 50 23 7 226 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P39928 1.78e-05 51 38 0 75 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8ZLZ9 1.79e-05 50 26 5 226 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 1.84e-05 50 26 5 226 3 qseC Sensor protein QseC Salmonella typhi
P16497 2.04e-05 50 25 7 215 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P39664 3.24e-05 49 27 3 185 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O25026 4.58e-05 49 22 6 218 1 flgS Sensor histidine kinase FlgS Helicobacter pylori (strain ATCC 700392 / 26695)
A2YFR6 4.62e-05 50 34 0 73 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A3BE68 4.74e-05 49 34 0 73 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
Q9HU20 5.19e-05 49 24 8 206 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13633 6.1e-05 49 23 5 220 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
Q9C5U2 7.02e-05 49 20 12 348 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q04850 7.18e-05 49 22 12 258 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9I4F8 7.49e-05 48 26 7 248 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A7N6S2 8.63e-05 48 24 7 215 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P15939 8.87e-05 48 24 8 234 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HWA7 9.11e-05 48 32 5 114 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZEP3 9.27e-05 48 26 7 198 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q38846 0.000122 48 23 6 234 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P41503 0.000133 47 23 7 230 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
A7HD43 0.000134 47 23 6 224 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q49VK4 0.000145 47 24 6 210 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P07168 0.000254 47 24 8 230 3 virA Wide host range VirA protein Rhizobium radiobacter
P10799 0.000332 47 24 8 230 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P45675 0.000746 45 26 5 162 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
P40758 0.00079 45 25 4 123 1 glnK Sensor histidine kinase GlnK Bacillus subtilis (strain 168)
P45670 0.000805 45 24 9 237 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
B8AY75 0.00082 45 25 10 247 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
O05250 0.00082 45 28 3 108 3 malK Sensor histidine kinase MalK Bacillus subtilis (strain 168)
P26489 0.000842 45 23 5 225 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P10578 0.001 45 21 7 228 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q0DKM0 0.001 45 25 10 247 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_01195
Feature type CDS
Gene baeS
Product Signal transduction histidine kinase
Location 223095 - 224534 (strand: -1)
Length 1440 (nucleotides) / 479 (amino acids)

Contig

Accession contig_1
Length 309072 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_536
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2205 Signal transduction mechanisms (T) T K+-sensing histidine kinase KdpD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07711 two-component system, NtrC family, sensor histidine kinase GlrK [EC:2.7.13.3] Two-component system
Quorum sensing
-

Protein Sequence

MTILKKWRLFPRSLRQLVVVAFCLVLLPLLGLAWQAYQSFDELSNQAAQISISTVQDARRSEEMSSLALEMERSYRQYCVLGNETLKNVWHKQYLRYEDYLARQKQSTPDPRYTDDIAGSLGQLSVLQCENGEPVAAMTTHLEAFARSNADLVQAIREANFRRGEELQNAIARKGQSFGWQSLLVFVLSTGLIILFTRMIIGPVKVIERMVNRLGEGRNLIQRLDNFNGPRELRSLALRIVWLSERLDWLESQRHEFLRHISHELKTPLASMREGTELLADEVAGPLTADQKDVVSILSESSRHLQVLIEQLLEYNRTLVDSPTEAKWVNLDTVVHEVVNAHSLPARSKEITTDLALDETSVWAEPVLLTRVLDNLYSNAVHYGAESGKIRITSRKAGQHIQIDVANTGTPIPEEEQEMIFEPFYQGSLQRKGAVKGSGLGLSIARDCINRMGGELILVGSEGADVCFRIQLPFHTLLE

Flanking regions ( +/- flanking 50bp)

CTCTTATCCCGGATCCGGTTAGCATCATGCTCATGACAACAGGTTAAGAGATGACAATCTTGAAAAAATGGCGATTATTTCCGCGCTCGCTGCGTCAGCTGGTTGTAGTGGCATTCTGTCTGGTATTGCTGCCGTTGCTGGGACTGGCATGGCAGGCATATCAGAGTTTTGATGAGCTGAGTAATCAGGCGGCGCAAATCAGTATTTCAACCGTACAGGATGCGCGGCGCAGTGAGGAAATGTCGAGCCTGGCGCTGGAAATGGAGCGCAGCTACCGCCAGTACTGTGTGCTGGGTAATGAAACCCTGAAAAATGTCTGGCACAAACAGTATCTCCGCTATGAGGACTATCTCGCCCGCCAGAAGCAATCCACTCCGGATCCGCGCTATACTGATGATATCGCCGGCAGCCTCGGACAGTTGTCTGTCCTGCAGTGTGAGAACGGCGAGCCGGTTGCGGCGATGACCACCCATCTGGAAGCCTTTGCCCGCAGTAACGCTGATCTGGTGCAGGCTATCCGTGAGGCGAATTTCCGGCGCGGTGAGGAACTTCAGAATGCCATCGCCCGCAAAGGCCAGTCATTCGGCTGGCAGAGCCTGCTGGTGTTTGTCCTGAGCACCGGGCTTATCATTCTGTTTACCCGCATGATTATCGGGCCGGTAAAAGTGATTGAACGGATGGTTAACCGCCTGGGGGAAGGGCGCAACCTGATACAGCGCCTTGATAATTTTAACGGCCCGAGGGAACTGCGCTCGCTGGCGCTGCGGATTGTCTGGCTGAGTGAGCGCCTCGACTGGCTGGAATCCCAGCGTCATGAATTCCTGCGTCATATTTCCCATGAGCTGAAAACCCCGCTGGCCAGTATGCGTGAAGGTACCGAACTGCTGGCGGATGAAGTCGCGGGGCCGCTGACGGCGGATCAGAAAGATGTGGTATCAATATTGAGTGAAAGCAGCCGCCATTTGCAGGTGCTGATTGAACAGCTGCTGGAGTATAACCGCACACTGGTGGACAGCCCGACAGAAGCCAAATGGGTTAACCTCGATACGGTAGTGCATGAGGTGGTTAATGCCCACAGCTTACCGGCGAGAAGCAAAGAAATCACTACAGACCTTGCTCTGGATGAAACAAGTGTCTGGGCTGAACCCGTCTTATTAACACGTGTACTCGATAATCTCTACTCAAATGCGGTACACTATGGCGCTGAATCGGGTAAGATCCGGATAACCAGCCGGAAAGCCGGTCAGCATATACAGATTGATGTCGCCAATACCGGTACGCCGATCCCGGAAGAAGAGCAGGAAATGATCTTCGAACCGTTCTATCAGGGCTCGCTTCAGCGCAAAGGTGCTGTCAAAGGCAGCGGGCTGGGACTGAGTATTGCCCGGGATTGTATTAACCGTATGGGCGGCGAACTGATATTAGTCGGTTCTGAAGGTGCGGATGTGTGCTTCCGTATTCAGCTTCCGTTCCACACCTTACTGGAATAACAGGTCAGCATTAACTTGAAAATGACATTTAAGTCCCTGATTGCCGCCGT