Homologs in group_990

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05480 FBDBKF_05480 94.2 Morganella morganii S1 nhaB sodium/proton antiporter NhaB
EHELCC_12110 EHELCC_12110 94.2 Morganella morganii S2 nhaB sodium/proton antiporter NhaB
NLDBIP_12450 NLDBIP_12450 94.2 Morganella morganii S4 nhaB sodium/proton antiporter NhaB
LHKJJB_12310 LHKJJB_12310 94.2 Morganella morganii S3 nhaB sodium/proton antiporter NhaB
HKOGLL_10925 HKOGLL_10925 94.2 Morganella morganii S5 nhaB sodium/proton antiporter NhaB
PMI_RS07325 PMI_RS07325 79.8 Proteus mirabilis HI4320 nhaB sodium/proton antiporter NhaB

Distribution of the homologs in the orthogroup group_990

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_990

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EXU4 0.0 850 79 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Proteus mirabilis (strain HI4320)
Q7N3Z4 0.0 833 78 0 515 3 nhaB Na(+)/H(+) antiporter NhaB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JQP8 0.0 787 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GFG0 0.0 769 71 1 519 3 nhaB Na(+)/H(+) antiporter NhaB Serratia proteamaculans (strain 568)
A9R9D6 0.0 758 75 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Angola)
Q6D4M9 0.0 755 69 1 514 3 nhaB Na(+)/H(+) antiporter NhaB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JLH7 0.0 754 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
C6DG45 0.0 753 70 1 514 3 nhaB Na(+)/H(+) antiporter NhaB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q66AQ9 0.0 749 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3Q0 0.0 749 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FI95 0.0 749 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TJC7 0.0 748 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis (strain Pestoides F)
Q1CJ89 0.0 748 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74U12 0.0 748 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis
Q1C7V3 0.0 748 75 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Antiqua)
C5B9W2 0.0 736 71 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Edwardsiella ictaluri (strain 93-146)
A4WBF5 0.0 725 70 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Enterobacter sp. (strain 638)
A6TAW7 0.0 724 71 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TXX6 0.0 719 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella schwarzengrund (strain CVM19633)
B7UQ70 0.0 719 70 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NJF4 0.0 717 70 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5BI47 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi A (strain AKU_12601)
Q5PCR8 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUJ8 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella newport (strain SL254)
Q8Z684 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella typhi
C0Q328 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi C (strain RKS4594)
B5R2W4 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella enteritidis PT4 (strain P125109)
B5FTM8 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella dublin (strain CT_02021853)
Q57NK6 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella choleraesuis (strain SC-B67)
B5F4E1 0.0 717 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella agona (strain SL483)
A9MVW2 0.0 716 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A9MP57 0.0 716 70 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZP14 0.0 716 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TKD6 0.0 716 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella heidelberg (strain SL476)
B7LSJ8 0.0 716 70 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5R8Z5 0.0 716 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5XQ77 0.0 715 71 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Klebsiella pneumoniae (strain 342)
Q4QNB8 0.0 710 66 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus influenzae (strain 86-028NP)
P44706 0.0 709 66 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1RCR0 0.0 708 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain UTI89 / UPEC)
A1AAA9 0.0 708 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O1:K1 / APEC
B7MTW4 0.0 708 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O81 (strain ED1a)
B7MK83 0.0 708 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O45:K1 (strain S88 / ExPEC)
Q6LNY8 0.0 707 67 2 513 3 nhaB Na(+)/H(+) antiporter NhaB Photobacterium profundum (strain SS9)
A0KL08 0.0 706 68 3 517 3 nhaB Na(+)/H(+) antiporter NhaB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8FI24 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TII9 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q32H30 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella dysenteriae serotype 1 (strain Sd197)
Q31ZM7 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella boydii serotype 4 (strain Sb227)
B2TZB2 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I9P7 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain SE11)
B7N3Z0 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AFA7 0.0 706 71 2 512 1 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12)
B1IUA6 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZC0 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O9:H4 (strain HS)
B1XA73 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12 / DH10B)
C4ZTM7 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXA0 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O8 (strain IAI1)
B5YXL0 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFA8 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O157:H7
A7ZKV7 0.0 706 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z2W2 0.0 705 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella sonnei (strain Ss046)
B7LGU6 0.0 704 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain 55989 / EAEC)
Q56577 0.0 704 69 4 508 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio alginolyticus
Q83RQ5 0.0 704 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella flexneri
Q0T5L5 0.0 704 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella flexneri serotype 5b (strain 8401)
B1LHY1 0.0 703 70 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain SMS-3-5 / SECEC)
C3LNK5 0.0 701 69 3 508 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain M66-2)
Q9KQU7 0.0 701 69 3 508 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6Z3 0.0 701 69 3 508 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A4SN80 0.0 701 68 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Aeromonas salmonicida (strain A449)
Q8DAG9 0.0 697 68 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio vulnificus (strain CMCP6)
A7MNK6 0.0 696 69 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Cronobacter sakazakii (strain ATCC BAA-894)
Q7MJN8 0.0 696 68 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio vulnificus (strain YJ016)
A8AFR5 0.0 693 70 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7VLW5 0.0 690 68 2 514 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio atlanticus (strain LGP32)
Q8ED79 0.0 689 67 2 506 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87N04 0.0 686 68 4 508 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65VH3 0.0 685 65 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5E4B7 0.0 685 67 3 507 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio fischeri (strain ATCC 700601 / ES114)
A8H5C2 0.0 684 67 3 499 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B6EIG5 0.0 683 67 4 518 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio salmonicida (strain LFI1238)
B5FFH5 0.0 682 67 3 507 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio fischeri (strain MJ11)
A0KVP8 0.0 681 66 2 505 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain ANA-3)
B0TRI8 0.0 679 67 3 499 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella halifaxensis (strain HAW-EB4)
Q0HW68 0.0 677 67 2 505 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain MR-7)
Q0HJX2 0.0 677 67 2 505 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain MR-4)
A1S6X4 0.0 676 67 3 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KIB5 0.0 673 68 3 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella woodyi (strain ATCC 51908 / MS32)
A8FW97 0.0 672 67 3 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sediminis (strain HAW-EB3)
A3QEZ3 0.0 672 67 3 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1RKH2 0.0 667 67 2 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain W3-18-1)
A4Y624 0.0 667 67 2 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8CPD7 0.0 665 67 3 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella piezotolerans (strain WP3 / JCM 13877)
Q12NQ8 0.0 664 63 3 517 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q083H3 0.0 663 66 2 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella frigidimarina (strain NCIMB 400)
Q9CPJ1 0.0 663 67 2 496 3 nhaB Na(+)/H(+) antiporter NhaB Pasteurella multocida (strain Pm70)
A7MZT6 0.0 662 68 4 518 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio campbellii (strain ATCC BAA-1116)
Q7VKY3 0.0 662 63 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VQI8 0.0 657 63 1 513 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BT71 0.0 652 63 2 514 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0G7 0.0 652 63 2 514 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZ40 0.0 650 62 2 514 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A9KY79 0.0 649 65 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS195)
A6WM74 0.0 649 65 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS185)
A3D3H1 0.0 649 65 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAH3 0.0 649 65 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS223)
B4RU97 0.0 639 64 2 504 3 nhaB Na(+)/H(+) antiporter NhaB Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q15S32 0.0 633 62 4 509 3 nhaB Na(+)/H(+) antiporter NhaB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2SJ43 0.0 622 62 3 500 3 nhaB Na(+)/H(+) antiporter NhaB Hahella chejuensis (strain KCTC 2396)
A6VW03 0.0 594 58 2 494 3 nhaB Na(+)/H(+) antiporter NhaB Marinomonas sp. (strain MWYL1)
C4L804 0.0 589 62 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
C5BJA8 0.0 579 62 3 498 3 nhaB Na(+)/H(+) antiporter NhaB Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q0VQ74 0.0 577 58 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1U7H0 0.0 573 61 2 497 3 nhaB Na(+)/H(+) antiporter NhaB Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4KBY6 0.0 570 59 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KD25 0.0 561 60 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas fluorescens (strain Pf0-1)
Q1IBG0 0.0 544 59 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas entomophila (strain L48)
Q88FQ6 0.0 538 58 2 504 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q21J49 0.0 536 61 3 503 3 nhaB Na(+)/H(+) antiporter NhaB Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A5W1F0 0.0 536 59 2 504 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KMR7 0.0 532 58 2 504 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain GB-1)
A6V701 8.34e-171 494 58 3 506 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain PA7)
Q9I2S5 1.89e-163 476 59 3 506 1 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7VB57 1.89e-163 476 59 3 506 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain LESB58)
Q02KW3 1.98e-163 475 59 3 506 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain UCBPP-PA14)
P9WPD7 4.31e-07 55 25 17 432 1 Rv2685 Uncharacterized transporter Rv2685 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD6 4.31e-07 55 25 17 432 3 MT2759 Uncharacterized transporter MT2759 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P46838 2.25e-06 53 25 11 298 3 ag45 46 kDa membrane protein Mycobacterium leprae (strain TN)
P9WPD8 7.2e-05 48 23 4 210 3 MT2758 Uncharacterized transporter MT2758 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A607 7.52e-05 48 23 4 210 3 BQ2027_MB2703 Uncharacterized transporter Mb2703 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPD9 7.52e-05 48 23 4 210 3 Rv2684 Uncharacterized transporter Rv2684 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q2FFH9 0.001 45 21 8 272 3 sdcS Sodium-dependent dicarboxylate transporter SdcS Staphylococcus aureus (strain USA300)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03820
Feature type CDS
Gene nhaB
Product sodium/proton antiporter NhaB
Location 807514 - 809061 (strand: -1)
Length 1548 (nucleotides) / 515 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_990
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06450 Bacterial Na+/H+ antiporter B (NhaB)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3067 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)		 CP Na+/H+ antiporter NhaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03314 Na+:H+ antiporter, NhaB family - -

Protein Sequence

MEMSMRQAFLKNFMGHSPDWYKLAIISFLIINPIVYFLIDPFTAGWLLVIEFIFTLAMALKCYPLQPGGLLAIEAVIIGMTSPDQISHEIMNNLEVILLLIFMVAGIYFMKQLLLFLFTKMLLTIRSKRALSLAFCLASAFLSAFLDALTVIAVVISVSVGFYAIFHQYASSQKEILPLSDDHFIDSAEKKQTLEQFRAFLRSLMMHAGIGTALGGVMTMVGEPQNLIIAKHAGWDFINFFLRMAPVTIPVFFCGLLVCYLVERFRLFGYGAELPERVRAVLEDNAQKSAAHRTKQEKMQLIVQGVIGLWLIFALAFHLAEVGLIGLSVIILATAFCGITEEHALGEAFEEALPFTALLTVFFSVVAVIVDQKLFTPFIQFVLSSDPSSQLSLFYLFNGLLSAVSDNVFVGTVYINEAMTAMKEGLVSYTQYEYLAVAINTGTNLPSVATPNGQAAFLFLLTSALAPLIRLSYGKMVMMALPYTIVMTLVGFFGVELWLVPVSEWMAGQGIITLP

Flanking regions ( +/- flanking 50bp)

ATCTTCATGCTGCTTTTCCCTGCAACCCCTACGGAGGACACACAGCAATAATGGAAATGTCAATGCGGCAAGCCTTCCTGAAAAACTTTATGGGTCATTCACCTGACTGGTACAAGCTTGCTATTATTTCGTTTTTAATAATAAATCCGATTGTTTACTTTCTTATCGACCCGTTTACGGCGGGCTGGTTATTAGTTATTGAGTTTATCTTTACGCTCGCGATGGCGCTCAAGTGCTACCCCCTGCAACCGGGTGGTCTGCTGGCGATAGAAGCGGTTATCATCGGGATGACGTCTCCCGATCAAATCAGCCATGAAATAATGAATAACCTTGAAGTTATTTTATTGCTGATTTTTATGGTCGCCGGTATCTACTTTATGAAGCAGTTGCTGCTGTTTCTGTTCACGAAAATGTTGCTAACTATCCGCTCAAAACGGGCACTTTCCCTGGCGTTCTGTCTTGCCAGTGCCTTTTTATCTGCCTTTCTCGATGCACTGACAGTGATAGCCGTTGTTATCAGCGTTTCTGTCGGTTTTTATGCCATTTTTCATCAGTATGCCTCTTCACAAAAAGAGATATTACCCCTCAGTGATGATCATTTTATCGACAGCGCAGAGAAAAAACAGACACTGGAACAGTTCCGCGCGTTTTTACGCAGCCTGATGATGCATGCCGGTATAGGTACAGCACTGGGCGGAGTGATGACCATGGTGGGTGAACCACAGAACCTGATTATCGCCAAACATGCCGGATGGGATTTTATTAATTTCTTCCTGCGTATGGCACCGGTGACGATCCCGGTCTTTTTTTGCGGTTTACTGGTCTGTTATCTGGTCGAACGTTTCAGATTGTTTGGTTATGGTGCAGAGTTACCGGAACGGGTCAGAGCCGTACTTGAAGATAATGCACAAAAATCTGCCGCACACCGGACCAAACAAGAAAAAATGCAGCTGATTGTTCAGGGGGTTATCGGCCTCTGGCTGATTTTTGCACTGGCATTTCATCTCGCGGAAGTCGGGCTTATCGGGTTGTCGGTTATCATCCTGGCAACGGCTTTTTGCGGGATCACGGAAGAGCATGCTCTGGGTGAAGCCTTTGAGGAAGCGCTGCCGTTTACCGCGCTGCTGACTGTCTTTTTCTCTGTTGTTGCGGTGATTGTTGATCAGAAACTGTTTACGCCGTTTATTCAGTTTGTTCTCAGTTCTGACCCCTCCTCGCAGCTTTCACTGTTTTACCTGTTCAACGGGCTGCTCTCAGCCGTTTCCGATAATGTCTTTGTCGGAACCGTCTATATTAATGAAGCAATGACCGCGATGAAGGAAGGGCTGGTTTCCTATACACAGTATGAATACCTCGCCGTTGCTATCAATACCGGGACAAATCTGCCGTCAGTGGCAACCCCGAATGGTCAGGCTGCATTCCTGTTCCTGCTGACCTCCGCACTGGCACCGCTTATCCGCCTTTCCTACGGGAAAATGGTGATGATGGCGCTGCCTTATACCATTGTGATGACCCTTGTCGGTTTCTTTGGTGTCGAACTGTGGCTGGTTCCGGTTTCAGAATGGATGGCGGGTCAGGGTATCATTACGCTGCCGTAACAGATGTATTACACTAAACTAACCGGAATAACGCTGTTATTCCGGTTTTT