Homologs in group_1057

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05480 FBDBKF_05480 100.0 Morganella morganii S1 nhaB sodium/proton antiporter NhaB
EHELCC_12110 EHELCC_12110 100.0 Morganella morganii S2 nhaB sodium/proton antiporter NhaB
NLDBIP_12450 NLDBIP_12450 100.0 Morganella morganii S4 nhaB sodium/proton antiporter NhaB
HKOGLL_10925 HKOGLL_10925 100.0 Morganella morganii S5 nhaB sodium/proton antiporter NhaB
F4V73_RS03820 F4V73_RS03820 94.2 Morganella psychrotolerans nhaB sodium/proton antiporter NhaB
PMI_RS07325 PMI_RS07325 80.0 Proteus mirabilis HI4320 nhaB sodium/proton antiporter NhaB

Distribution of the homologs in the orthogroup group_1057

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1057

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EXU4 0.0 849 79 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Proteus mirabilis (strain HI4320)
Q7N3Z4 0.0 839 78 0 515 3 nhaB Na(+)/H(+) antiporter NhaB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JQP8 0.0 800 77 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GFG0 0.0 771 72 1 519 3 nhaB Na(+)/H(+) antiporter NhaB Serratia proteamaculans (strain 568)
Q6D4M9 0.0 770 71 1 514 3 nhaB Na(+)/H(+) antiporter NhaB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DG45 0.0 766 71 1 512 3 nhaB Na(+)/H(+) antiporter NhaB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A9R9D6 0.0 766 76 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Angola)
B1JLH7 0.0 762 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66AQ9 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3Q0 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FI95 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TJC7 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis (strain Pestoides F)
Q1CJ89 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74U12 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis
Q1C7V3 0.0 756 76 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Antiqua)
C5B9W2 0.0 754 72 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Edwardsiella ictaluri (strain 93-146)
A6TAW7 0.0 739 72 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TXX6 0.0 727 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella schwarzengrund (strain CVM19633)
A4WBF5 0.0 727 71 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Enterobacter sp. (strain 638)
A9MP57 0.0 727 72 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XQ77 0.0 726 72 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Klebsiella pneumoniae (strain 342)
B7NJF4 0.0 726 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8Z684 0.0 725 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella typhi
B5BI47 0.0 725 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi A (strain AKU_12601)
A9MVW2 0.0 725 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PCR8 0.0 725 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5F4E1 0.0 725 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella agona (strain SL483)
B7UQ70 0.0 725 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4SUJ8 0.0 725 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella newport (strain SL254)
Q8ZP14 0.0 724 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q328 0.0 724 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi C (strain RKS4594)
B4TKD6 0.0 724 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella heidelberg (strain SL476)
B5R2W4 0.0 724 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella enteritidis PT4 (strain P125109)
B5FTM8 0.0 724 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella dublin (strain CT_02021853)
Q57NK6 0.0 724 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella choleraesuis (strain SC-B67)
B5R8Z5 0.0 723 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7LSJ8 0.0 723 71 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P44706 0.0 717 67 2 508 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QNB8 0.0 717 67 2 508 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus influenzae (strain 86-028NP)
A0KL08 0.0 717 69 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q1RCR0 0.0 714 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain UTI89 / UPEC)
A1AAA9 0.0 714 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O1:K1 / APEC
B7MTW4 0.0 714 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O81 (strain ED1a)
B7MK83 0.0 714 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3Z2W2 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella sonnei (strain Ss046)
Q32H30 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella dysenteriae serotype 1 (strain Sd197)
Q31ZM7 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella boydii serotype 4 (strain Sb227)
B2TZB2 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I9P7 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain SE11)
B7N3Z0 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AFA7 0.0 713 71 2 512 1 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12)
B1IUA6 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FI24 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZZC0 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O9:H4 (strain HS)
B1XA73 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12 / DH10B)
C4ZTM7 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXA0 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O8 (strain IAI1)
B5YXL0 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFA8 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O157:H7
A7ZKV7 0.0 713 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0TII9 0.0 712 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83RQ5 0.0 712 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella flexneri
Q0T5L5 0.0 712 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Shigella flexneri serotype 5b (strain 8401)
B7LGU6 0.0 711 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain 55989 / EAEC)
B1LHY1 0.0 711 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain SMS-3-5 / SECEC)
A4SN80 0.0 710 69 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Aeromonas salmonicida (strain A449)
Q6LNY8 0.0 708 68 3 508 3 nhaB Na(+)/H(+) antiporter NhaB Photobacterium profundum (strain SS9)
A7MNK6 0.0 706 70 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Cronobacter sakazakii (strain ATCC BAA-894)
Q56577 0.0 705 69 4 507 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio alginolyticus
A8AFR5 0.0 704 71 3 511 3 nhaB Na(+)/H(+) antiporter NhaB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C3LNK5 0.0 702 68 3 508 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain M66-2)
Q9KQU7 0.0 702 68 3 508 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6Z3 0.0 702 68 3 508 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8DAG9 0.0 699 69 3 515 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio vulnificus (strain CMCP6)
Q7MJN8 0.0 699 69 3 515 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio vulnificus (strain YJ016)
Q65VH3 0.0 692 65 2 513 3 nhaB Na(+)/H(+) antiporter NhaB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87N04 0.0 689 69 4 507 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E4B7 0.0 689 68 3 506 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8ED79 0.0 688 67 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B5FFH5 0.0 686 68 3 506 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio fischeri (strain MJ11)
B7VLW5 0.0 685 68 4 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio atlanticus (strain LGP32)
B6EIG5 0.0 684 67 4 518 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio salmonicida (strain LFI1238)
A8H5C2 0.0 681 66 3 499 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A0KVP8 0.0 675 65 2 502 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain ANA-3)
B0TRI8 0.0 675 66 3 499 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella halifaxensis (strain HAW-EB4)
Q9CPJ1 0.0 675 68 3 501 3 nhaB Na(+)/H(+) antiporter NhaB Pasteurella multocida (strain Pm70)
B1KIB5 0.0 674 66 5 518 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella woodyi (strain ATCC 51908 / MS32)
Q0HW68 0.0 672 66 4 507 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain MR-7)
Q0HJX2 0.0 672 66 4 507 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain MR-4)
A1S6X4 0.0 669 66 4 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QEZ3 0.0 667 67 3 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FW97 0.0 666 67 4 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sediminis (strain HAW-EB3)
A6VQI8 0.0 666 64 3 511 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VKY3 0.0 666 64 2 506 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1RKH2 0.0 665 67 2 497 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain W3-18-1)
Q083H3 0.0 665 66 2 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella frigidimarina (strain NCIMB 400)
Q12NQ8 0.0 665 64 4 510 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4Y624 0.0 664 67 2 497 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0BT71 0.0 662 64 2 508 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0G7 0.0 662 64 2 508 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A7MZT6 0.0 661 68 4 517 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio campbellii (strain ATCC BAA-1116)
A3MZ40 0.0 659 64 2 508 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8CPD7 0.0 658 66 3 498 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella piezotolerans (strain WP3 / JCM 13877)
A9KY79 0.0 655 66 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS195)
A6WM74 0.0 655 66 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS185)
A3D3H1 0.0 655 66 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAH3 0.0 655 66 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS223)
B4RU97 0.0 644 65 3 504 3 nhaB Na(+)/H(+) antiporter NhaB Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q15S32 0.0 633 63 4 509 3 nhaB Na(+)/H(+) antiporter NhaB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2SJ43 0.0 629 63 3 494 3 nhaB Na(+)/H(+) antiporter NhaB Hahella chejuensis (strain KCTC 2396)
A6VW03 0.0 595 59 2 493 3 nhaB Na(+)/H(+) antiporter NhaB Marinomonas sp. (strain MWYL1)
C4L804 0.0 591 62 2 510 3 nhaB Na(+)/H(+) antiporter NhaB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
C5BJA8 0.0 590 63 3 498 3 nhaB Na(+)/H(+) antiporter NhaB Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q0VQ74 0.0 586 59 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1U7H0 0.0 576 61 2 497 3 nhaB Na(+)/H(+) antiporter NhaB Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4KBY6 0.0 569 59 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KD25 0.0 561 61 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas fluorescens (strain Pf0-1)
Q1IBG0 0.0 545 59 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas entomophila (strain L48)
Q21J49 0.0 544 61 3 501 3 nhaB Na(+)/H(+) antiporter NhaB Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q88FQ6 0.0 541 59 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W1F0 0.0 538 59 2 504 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KMR7 0.0 536 59 2 504 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain GB-1)
A6V701 2.29e-170 493 58 2 505 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain PA7)
Q9I2S5 2.96e-163 475 58 2 505 1 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7VB57 2.96e-163 475 58 2 505 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain LESB58)
Q02KW3 3.19e-163 475 58 2 505 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain UCBPP-PA14)
P9WPD7 5.83e-06 52 24 13 380 1 Rv2685 Uncharacterized transporter Rv2685 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD6 5.83e-06 52 24 13 380 3 MT2759 Uncharacterized transporter MT2759 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A607 1.69e-05 50 24 4 206 3 BQ2027_MB2703 Uncharacterized transporter Mb2703 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPD9 1.69e-05 50 24 4 206 3 Rv2684 Uncharacterized transporter Rv2684 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD8 1.84e-05 50 24 4 206 3 MT2758 Uncharacterized transporter MT2758 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P46838 2.19e-05 50 26 5 210 3 ag45 46 kDa membrane protein Mycobacterium leprae (strain TN)
Q54GU0 0.000255 47 26 13 277 2 arsB Putative transporter arsB Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12310
Feature type CDS
Gene nhaB
Product sodium/proton antiporter NhaB
Location 73337 - 74884 (strand: -1)
Length 1548 (nucleotides) / 515 (amino acids)
In genomic island -

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1057
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06450 Bacterial Na+/H+ antiporter B (NhaB)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3067 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)
CP Na+/H+ antiporter NhaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03314 Na+:H+ antiporter, NhaB family - -

Protein Sequence

MEISMRQAFLKNFMGHSPDWYKLAIILFLIINPVVYFFIDPFTAGWLLVIEFIFTLAMALKCYPLQPGGLLAIEAVLIGMTSPAQISHEIVNNLEVILLLIFMVAGIYFMKQLLLFLFTKLLLSIRSKRALSLAFCLASAFLSAFLDALTVIAVVISVSVGFYAIYHQYASSGKETVTLSDDEFIDSTEKRQTLDQFRAFLRSLMMHAGIGTALGGVMTMVGEPQNLIIAKHAGWDFVNFFLRMAPVTIPVFVCGLLVCYLVERFKLFGYGAELPERVRAVLEDNAQKSAARRTKQEKMQLIVQGLIGIWLITALAFHLAEVGLIGLSVIILATAFCGITEEHALGEAFEEALPFTALLTVFFSVVAVIVDQKLFTPFIQFVLSSDPSSQLSLFYLFNGLLSAVSDNVFVGTVYINEAMTAMKAGLVSYTQYEYLAVAINTGTNLPSVATPNGQAAFLFLLTSALAPLIRLSYGKMVIMALPYTIVMTLVGFFGVELWLVPVSEWMAANGVITLP

Flanking regions ( +/- flanking 50bp)

AGTTATACGCGGATCATCTTTTCACCCCCTGCGGAGGACACACAGCAACAATGGAAATATCAATGCGGCAGGCCTTCCTGAAGAACTTCATGGGTCACTCCCCTGACTGGTATAAGCTTGCTATTATTCTTTTTTTAATTATAAATCCGGTTGTTTACTTCTTTATTGACCCTTTTACAGCCGGCTGGCTGCTGGTCATTGAGTTTATTTTCACCCTTGCGATGGCGCTGAAATGCTATCCGCTGCAACCCGGCGGCCTGCTGGCGATTGAGGCGGTACTGATCGGCATGACATCGCCGGCGCAAATCAGCCATGAGATTGTGAATAACCTTGAGGTTATCCTGCTGCTGATCTTTATGGTTGCCGGTATTTACTTTATGAAGCAGCTGCTGCTGTTTCTGTTTACCAAACTGCTCCTGTCTATCCGTTCCAAACGCGCGCTTTCTCTTGCTTTCTGTCTGGCAAGTGCCTTTTTATCCGCGTTTCTGGATGCACTGACGGTGATCGCCGTGGTGATCAGTGTGTCTGTCGGGTTTTATGCGATTTATCATCAGTATGCCTCTTCCGGAAAAGAAACGGTGACGCTCAGTGATGATGAATTTATCGACAGCACCGAAAAGCGCCAGACACTCGACCAGTTCCGCGCCTTTCTGCGCAGCCTGATGATGCATGCCGGTATCGGTACTGCTCTCGGCGGCGTGATGACCATGGTCGGTGAACCGCAGAACCTGATTATTGCCAAACATGCCGGATGGGATTTCGTGAATTTCTTCCTGCGCATGGCGCCGGTAACAATTCCGGTATTTGTCTGTGGTCTGCTGGTCTGCTACCTGGTGGAACGGTTTAAACTGTTCGGTTACGGTGCGGAACTGCCGGAGCGGGTCAGAGCCGTACTGGAGGATAATGCACAAAAATCTGCAGCACGCCGGACAAAACAGGAAAAAATGCAGTTAATTGTTCAGGGCCTTATCGGTATCTGGCTTATCACTGCACTGGCCTTCCATCTGGCCGAAGTCGGGCTGATCGGTTTATCAGTGATTATTCTGGCGACAGCATTCTGCGGGATCACGGAAGAACATGCTCTCGGTGAGGCTTTCGAAGAAGCACTGCCGTTTACCGCGCTGCTGACCGTGTTCTTTTCTGTTGTTGCAGTGATTGTTGACCAGAAATTATTCACACCGTTTATCCAGTTTGTCCTCAGTTCGGATCCGTCGTCGCAGTTGTCGCTGTTCTATCTGTTCAACGGCCTGCTTTCGGCGGTCTCTGATAACGTCTTTGTCGGCACGGTCTATATCAATGAGGCAATGACGGCGATGAAAGCCGGACTGGTATCCTATACACAGTATGAATATCTGGCCGTTGCTATCAATACCGGGACAAACCTGCCGTCAGTGGCGACACCAAACGGCCAGGCGGCATTCCTGTTCCTGCTGACGTCCGCACTGGCACCGCTGATCCGGCTTTCCTACGGAAAAATGGTGATCATGGCGCTGCCTTATACCATCGTGATGACACTGGTCGGTTTCTTCGGTGTTGAATTATGGCTGGTGCCGGTTTCAGAATGGATGGCTGCCAATGGTGTGATTACACTGCCGTAACCACCTTTTTACACTGCACTAACCGGAATAACAGTGTTATTCCGGTTTTT