Homologs in group_990

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05480 FBDBKF_05480 80.0 Morganella morganii S1 nhaB sodium/proton antiporter NhaB
EHELCC_12110 EHELCC_12110 80.0 Morganella morganii S2 nhaB sodium/proton antiporter NhaB
NLDBIP_12450 NLDBIP_12450 80.0 Morganella morganii S4 nhaB sodium/proton antiporter NhaB
LHKJJB_12310 LHKJJB_12310 80.0 Morganella morganii S3 nhaB sodium/proton antiporter NhaB
HKOGLL_10925 HKOGLL_10925 80.0 Morganella morganii S5 nhaB sodium/proton antiporter NhaB
F4V73_RS03820 F4V73_RS03820 79.8 Morganella psychrotolerans nhaB sodium/proton antiporter NhaB

Distribution of the homologs in the orthogroup group_990

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_990

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EXU4 0.0 1031 100 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Proteus mirabilis (strain HI4320)
Q7N3Z4 0.0 861 81 1 515 3 nhaB Na(+)/H(+) antiporter NhaB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JQP8 0.0 805 78 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DG45 0.0 781 73 1 514 3 nhaB Na(+)/H(+) antiporter NhaB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A9R9D6 0.0 781 77 1 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Angola)
A8GFG0 0.0 781 73 3 519 3 nhaB Na(+)/H(+) antiporter NhaB Serratia proteamaculans (strain 568)
Q6D4M9 0.0 780 73 1 514 3 nhaB Na(+)/H(+) antiporter NhaB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JLH7 0.0 771 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66AQ9 0.0 770 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3Q0 0.0 770 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FI95 0.0 770 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TJC7 0.0 769 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis (strain Pestoides F)
Q1CJ89 0.0 769 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74U12 0.0 769 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis
Q1C7V3 0.0 769 77 0 514 3 nhaB Na(+)/H(+) antiporter NhaB Yersinia pestis bv. Antiqua (strain Antiqua)
A6TAW7 0.0 729 72 3 515 3 nhaB Na(+)/H(+) antiporter NhaB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P44706 0.0 729 70 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QNB8 0.0 728 70 3 512 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus influenzae (strain 86-028NP)
C5B9W2 0.0 728 70 2 515 3 nhaB Na(+)/H(+) antiporter NhaB Edwardsiella ictaluri (strain 93-146)
B7UQ70 0.0 726 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NJF4 0.0 726 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A4WBF5 0.0 724 71 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Enterobacter sp. (strain 638)
B7LSJ8 0.0 723 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B4TXX6 0.0 721 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella schwarzengrund (strain CVM19633)
A9MVW2 0.0 719 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SUJ8 0.0 719 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella newport (strain SL254)
Q8ZP14 0.0 719 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TKD6 0.0 719 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella heidelberg (strain SL476)
Q8Z684 0.0 718 70 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella typhi
B5BI47 0.0 718 70 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi A (strain AKU_12601)
C0Q328 0.0 718 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi C (strain RKS4594)
Q5PCR8 0.0 718 70 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5R2W4 0.0 718 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella enteritidis PT4 (strain P125109)
B5FTM8 0.0 718 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella dublin (strain CT_02021853)
Q57NK6 0.0 718 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella choleraesuis (strain SC-B67)
B5F4E1 0.0 718 70 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella agona (strain SL483)
B5R8Z5 0.0 718 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q6LNY8 0.0 717 68 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Photobacterium profundum (strain SS9)
A9MP57 0.0 714 70 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XQ77 0.0 713 72 3 515 3 nhaB Na(+)/H(+) antiporter NhaB Klebsiella pneumoniae (strain 342)
Q0TII9 0.0 712 72 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q56577 0.0 711 68 3 514 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio alginolyticus
Q3Z2W2 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Shigella sonnei (strain Ss046)
Q32H30 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Shigella dysenteriae serotype 1 (strain Sd197)
Q31ZM7 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Shigella boydii serotype 4 (strain Sb227)
B2TZB2 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I9P7 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain SE11)
B7N3Z0 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AFA7 0.0 711 71 3 513 1 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12)
B1IUA6 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FI24 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZZC0 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O9:H4 (strain HS)
B1XA73 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12 / DH10B)
C4ZTM7 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXA0 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O8 (strain IAI1)
B5YXL0 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFA8 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O157:H7
A7ZKV7 0.0 711 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1RCR0 0.0 710 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain UTI89 / UPEC)
A1AAA9 0.0 710 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O1:K1 / APEC
B7MTW4 0.0 710 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O81 (strain ED1a)
B7MK83 0.0 710 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LHY1 0.0 709 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain SMS-3-5 / SECEC)
A7MNK6 0.0 709 70 3 515 3 nhaB Na(+)/H(+) antiporter NhaB Cronobacter sakazakii (strain ATCC BAA-894)
B7LGU6 0.0 709 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Escherichia coli (strain 55989 / EAEC)
Q83RQ5 0.0 708 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Shigella flexneri
Q0T5L5 0.0 708 71 3 513 3 nhaB Na(+)/H(+) antiporter NhaB Shigella flexneri serotype 5b (strain 8401)
Q8DAG9 0.0 708 69 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio vulnificus (strain CMCP6)
Q7MJN8 0.0 707 69 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio vulnificus (strain YJ016)
Q8ED79 0.0 706 67 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8AFR5 0.0 705 71 1 512 3 nhaB Na(+)/H(+) antiporter NhaB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C3LNK5 0.0 704 67 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain M66-2)
Q9KQU7 0.0 704 67 3 516 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6Z3 0.0 704 67 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8H5C2 0.0 703 67 4 511 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TRI8 0.0 702 67 4 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella halifaxensis (strain HAW-EB4)
A0KVP8 0.0 700 66 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain ANA-3)
Q87N04 0.0 698 68 3 515 1 nhaB Na(+)/H(+) antiporter NhaB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1S6X4 0.0 697 67 4 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KL08 0.0 695 67 2 511 3 nhaB Na(+)/H(+) antiporter NhaB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7VLW5 0.0 694 68 2 514 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio atlanticus (strain LGP32)
A6VQI8 0.0 691 67 3 515 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CPJ1 0.0 691 70 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Pasteurella multocida (strain Pm70)
Q0HW68 0.0 691 66 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain MR-7)
Q0HJX2 0.0 691 66 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain MR-4)
Q5E4B7 0.0 686 67 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio fischeri (strain ATCC 700601 / ES114)
B1KIB5 0.0 684 67 4 511 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella woodyi (strain ATCC 51908 / MS32)
Q65VH3 0.0 684 65 4 516 3 nhaB Na(+)/H(+) antiporter NhaB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q083H3 0.0 683 67 3 517 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella frigidimarina (strain NCIMB 400)
B5FFH5 0.0 683 66 3 516 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio fischeri (strain MJ11)
B6EIG5 0.0 682 67 4 516 3 nhaB Na(+)/H(+) antiporter NhaB Aliivibrio salmonicida (strain LFI1238)
Q12NQ8 0.0 682 65 3 508 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4SN80 0.0 679 66 2 511 3 nhaB Na(+)/H(+) antiporter NhaB Aeromonas salmonicida (strain A449)
A7MZT6 0.0 671 68 4 516 3 nhaB Na(+)/H(+) antiporter NhaB Vibrio campbellii (strain ATCC BAA-1116)
A4Y624 0.0 671 65 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RKH2 0.0 671 65 2 513 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sp. (strain W3-18-1)
A3QEZ3 0.0 670 65 4 512 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FW97 0.0 668 65 4 511 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella sediminis (strain HAW-EB3)
A9KY79 0.0 664 64 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS195)
A6WM74 0.0 664 64 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS185)
A3D3H1 0.0 664 64 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAH3 0.0 664 64 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella baltica (strain OS223)
Q7VKY3 0.0 664 65 3 509 3 nhaB Na(+)/H(+) antiporter NhaB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8CPD7 0.0 662 64 4 510 3 nhaB Na(+)/H(+) antiporter NhaB Shewanella piezotolerans (strain WP3 / JCM 13877)
Q15S32 0.0 654 64 3 514 3 nhaB Na(+)/H(+) antiporter NhaB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B4RU97 0.0 654 65 2 511 3 nhaB Na(+)/H(+) antiporter NhaB Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B0BT71 0.0 652 64 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0G7 0.0 652 64 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZ40 0.0 649 63 2 512 3 nhaB Na(+)/H(+) antiporter NhaB Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q2SJ43 0.0 627 63 2 492 3 nhaB Na(+)/H(+) antiporter NhaB Hahella chejuensis (strain KCTC 2396)
C4L804 0.0 594 62 4 520 3 nhaB Na(+)/H(+) antiporter NhaB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
C5BJA8 0.0 590 62 4 500 3 nhaB Na(+)/H(+) antiporter NhaB Teredinibacter turnerae (strain ATCC 39867 / T7901)
A6VW03 0.0 588 57 1 500 3 nhaB Na(+)/H(+) antiporter NhaB Marinomonas sp. (strain MWYL1)
Q0VQ74 0.0 577 58 1 513 3 nhaB Na(+)/H(+) antiporter NhaB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4KBY6 0.0 572 60 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KD25 0.0 559 60 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas fluorescens (strain Pf0-1)
A1U7H0 0.0 558 59 2 498 3 nhaB Na(+)/H(+) antiporter NhaB Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q88FQ6 0.0 543 58 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1IBG0 0.0 536 58 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas entomophila (strain L48)
A5W1F0 0.0 533 58 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KMR7 0.0 531 58 2 503 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas putida (strain GB-1)
Q21J49 2.7e-180 518 58 2 496 3 nhaB Na(+)/H(+) antiporter NhaB Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A6V701 1.33e-168 489 58 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain PA7)
Q9I2S5 2.79e-161 470 59 2 501 1 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KW3 2.79e-161 470 59 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VB57 2.79e-161 470 59 2 501 3 nhaB Na(+)/H(+) antiporter NhaB Pseudomonas aeruginosa (strain LESB58)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07325
Feature type CDS
Gene nhaB
Product sodium/proton antiporter NhaB
Location 1605160 - 1606704 (strand: 1)
Length 1545 (nucleotides) / 514 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_990
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06450 Bacterial Na+/H+ antiporter B (NhaB)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3067 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)		 CP Na+/H+ antiporter NhaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03314 Na+:H+ antiporter, NhaB family - -

Protein Sequence

MDMSIRQALLKNFMGNSPDWYKLAIITFLIINPLIFFFVDPFIAGWLLVVEFIFTLAMALKCYPLQPGGLLAIEAVIIGMTTPKQIGHEIANNLEVILLLVFMVAGIYFMKQLLLFAFTKLLLSIRSKRLLSLAFCFASAFLSAFLDALTVIAVVISVSLGFYSIYHNFASNQADAELSNDGFIDSTEKKQTLEQFRAFLRSLMMHAGVGTALGGVMTMVGEPQNLIIAKHLEWDFVTFFIRMSPVTIPVFFAGLAVCYLVERFKLFGYGAELPELVRKVLTDYDKKNSEKRTQQEKAQLLIQALIGIWLIVALALHLAEVGIIGLSVIILATTFCGITEEHALGKAFEEALPFTALLTVFFSVVAVIIDQQLFGPIIQFVLQASESSQLSLFYLFNGLLSAISDNVFVGTVYISEALSALQEGLISQSQYEHIGVAINTGTNLPSVATPNGQAAFLFLLTSALSPLIRLSYGRMVMMALPYTIVMTLLGLLAVEFWLVPMTHWLYEIGLIAIP

Flanking regions ( +/- flanking 50bp)

ATTGCGCATTTTAGGCGCCTAAAATCTCTATTCGGAGGATAAAAAACATAATGGATATGAGTATAAGACAAGCATTACTGAAAAATTTCATGGGGAACTCCCCTGATTGGTATAAGCTTGCTATTATTACTTTTTTAATCATCAACCCACTGATTTTTTTCTTTGTTGACCCTTTCATTGCTGGCTGGCTACTCGTTGTTGAGTTTATCTTCACTTTAGCCATGGCATTAAAATGTTATCCGCTACAACCAGGGGGATTACTTGCTATTGAGGCCGTCATTATTGGTATGACAACGCCGAAACAAATAGGTCATGAAATAGCCAACAACCTTGAAGTCATTTTATTACTGGTCTTTATGGTTGCGGGTATTTATTTTATGAAGCAATTACTTCTATTTGCTTTTACAAAATTACTCCTCTCTATTCGATCTAAACGCTTATTATCATTAGCATTCTGTTTTGCTAGTGCCTTTTTATCTGCTTTTTTAGACGCTTTAACCGTGATTGCCGTGGTGATCAGTGTTTCTTTAGGCTTCTATTCCATCTACCATAACTTTGCCTCTAACCAGGCTGATGCAGAGTTAAGCAATGATGGCTTTATTGATAGCACAGAGAAAAAACAGACCTTAGAACAATTCCGTGCTTTCTTACGTAGCTTAATGATGCATGCCGGTGTTGGTACAGCATTAGGTGGTGTGATGACGATGGTTGGTGAGCCACAAAACTTGATCATTGCAAAACACTTAGAATGGGATTTTGTCACCTTCTTTATCAGGATGTCACCCGTTACTATTCCCGTTTTCTTTGCTGGACTTGCAGTATGTTATTTGGTTGAGCGCTTTAAGCTGTTTGGTTATGGTGCCGAGCTACCTGAATTAGTGCGTAAAGTTCTCACTGACTACGATAAAAAGAACAGTGAAAAACGAACTCAACAAGAAAAAGCCCAGTTATTAATCCAAGCATTAATTGGTATTTGGTTAATTGTTGCACTGGCCTTACACCTTGCTGAGGTTGGTATTATTGGTCTTTCTGTTATTATCTTAGCCACCACTTTCTGTGGTATCACTGAAGAGCACGCTTTAGGTAAAGCTTTTGAAGAAGCACTGCCTTTCACCGCATTACTTACGGTATTCTTCTCCGTTGTTGCCGTGATTATTGATCAACAGCTATTTGGTCCTATTATTCAATTTGTTCTACAGGCATCAGAATCTTCACAACTGTCACTCTTTTATCTCTTTAATGGCCTACTTTCTGCCATTTCAGATAATGTATTTGTGGGTACGGTCTATATCAGTGAAGCATTAAGCGCATTGCAAGAAGGATTAATTAGCCAATCTCAATATGAACATATTGGTGTCGCAATTAATACTGGGACTAACTTACCGTCAGTGGCAACGCCAAACGGACAAGCGGCTTTCTTATTCTTATTAACTTCAGCATTATCCCCGCTGATCCGCTTATCTTATGGACGTATGGTGATGATGGCTCTTCCTTATACCATTGTTATGACACTGTTAGGATTACTAGCTGTAGAATTCTGGCTCGTGCCAATGACACATTGGTTATATGAAATTGGCTTAATCGCTATTCCATAAAAAACCATCATGAAATGAGTATTTTTTAGGGCTTTTAATGTTTAAAAGCC