Homologs in group_1823

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13510 FBDBKF_13510 86.6 Morganella morganii S1 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
EHELCC_08585 EHELCC_08585 86.6 Morganella morganii S2 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
NLDBIP_08910 NLDBIP_08910 86.6 Morganella morganii S4 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
LHKJJB_05355 LHKJJB_05355 86.6 Morganella morganii S3 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
HKOGLL_05560 HKOGLL_05560 86.6 Morganella morganii S5 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
PMI_RS07560 PMI_RS07560 48.8 Proteus mirabilis HI4320 - response regulator

Distribution of the homologs in the orthogroup group_1823

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1823

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31802 1.53e-59 189 44 2 212 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P44845 6.65e-59 187 45 0 200 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AF31 9.34e-30 112 34 1 208 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 9.34e-30 112 34 1 208 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 9.34e-30 112 34 1 208 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 9.34e-30 112 34 1 208 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
P55184 1.7e-28 109 29 2 207 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
O07528 1.36e-27 107 31 3 207 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P13800 4.07e-27 106 30 2 219 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P54662 6.85e-27 105 29 2 219 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
O32197 1.57e-26 104 31 2 199 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P9WGM5 1.57e-26 104 29 2 204 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 1.57e-26 104 29 2 204 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7A0I0 5.71e-26 102 28 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 5.71e-26 102 28 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 5.71e-26 102 28 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 5.71e-26 102 28 1 203 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 5.71e-26 102 28 1 203 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 5.71e-26 102 28 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q1M7A0 8.4e-25 99 33 6 200 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q4L7J5 3.63e-23 95 29 1 203 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
Q5HEP0 2.26e-22 93 28 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 2.26e-22 93 28 1 203 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7WZY4 4.61e-22 92 27 2 212 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q8CNP9 7.62e-22 92 27 1 203 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 7.62e-22 92 27 1 203 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49YS9 1.97e-21 90 28 3 204 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P94439 2.56e-21 90 30 6 213 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
P96686 1.01e-20 89 29 2 199 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P26319 1.09e-20 89 29 3 197 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8CN75 1.27e-20 89 26 3 201 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLK6 1.28e-20 89 26 3 201 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0A4H2 3.8e-20 87 24 2 195 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 3.8e-20 87 24 2 195 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 3.8e-20 87 24 2 195 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0AEL8 1.31e-19 85 30 4 196 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.31e-19 85 30 4 196 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
Q6GE42 1.71e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 1.71e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
O07019 1.96e-19 85 28 2 194 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
Q7A029 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 2.04e-19 85 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WMF9 2.39e-19 85 26 1 199 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 2.39e-19 85 26 1 199 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P56644 4.8e-19 84 25 1 199 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
Q4L8Q6 6.39e-19 84 25 3 200 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
P27667 1.69e-17 80 31 6 204 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P24908 2.03e-17 80 28 2 189 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AGA9 5.55e-17 78 31 5 190 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 5.55e-17 78 31 5 190 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 5.55e-17 78 31 5 190 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 5.55e-17 78 31 5 190 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
A8R3S7 1.05e-16 78 26 3 196 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
O34723 2.78e-16 77 27 2 194 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q7CQM5 1.26e-15 75 28 3 195 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14204 6.09e-15 73 27 6 212 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
A8R3T0 8.31e-15 73 27 3 205 3 agmR Glycerol metabolism activator Pseudomonas putida
P29369 2.34e-14 72 27 3 205 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q51373 1.56e-13 69 22 2 207 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACZ7 4.78e-13 68 24 1 184 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 4.78e-13 68 24 1 184 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 4.78e-13 68 24 1 184 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 4.78e-13 68 24 1 184 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
P0AED6 9.1e-13 67 19 1 206 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 9.1e-13 67 19 1 206 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 9.67e-13 67 19 1 206 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 9.67e-13 67 19 1 206 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P95582 7.6e-11 62 20 1 206 3 gacA Response regulator GacA Pseudomonas viridiflava
P72781 1.33e-10 62 24 7 227 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q52376 1.54e-10 61 20 1 206 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P32967 1.56e-10 61 20 2 205 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P58664 1.01e-09 59 27 6 195 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
Q56127 1.52e-09 58 24 1 200 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
Q46791 1.89e-09 57 30 4 135 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
P69410 2.2e-09 58 24 1 200 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 2.2e-09 58 24 1 200 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 2.2e-09 58 24 1 200 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 2.2e-09 58 24 1 200 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 2.2e-09 58 24 1 200 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
P58663 2.27e-09 58 24 1 200 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23221 2.58e-08 55 25 8 199 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O54294 2.58e-08 55 31 1 102 1 csgD Probable csgAB operon transcriptional regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52106 3.37e-08 55 50 0 51 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
Q8KR08 4.71e-08 54 32 3 144 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P42421 5.38e-08 54 24 8 217 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P29904 8.22e-08 54 27 4 179 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
P38684 9.55e-08 53 29 4 120 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
Q3LWR6 1.14e-07 53 30 3 144 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.14e-07 53 30 3 144 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.14e-07 53 30 3 144 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P58357 1.51e-07 53 29 4 120 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
P9WGN1 6.51e-07 51 27 2 124 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 6.51e-07 51 27 2 124 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P26487 7.08e-07 51 25 8 205 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P21866 7.54e-07 51 29 4 118 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
A0A0N8YGA2 1.86e-06 50 28 4 140 2 anoR Transcriptional activator protein AnoR Acinetobacter nosocomialis
P37640 3.41e-06 49 42 0 54 1 yhjB Putative HTH-type transcriptional regulator YhjB Escherichia coli (strain K12)
O69730 4.42e-06 49 27 1 102 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P11470 5.18e-06 46 40 1 70 1 gerE Spore germination protein GerE Bacillus subtilis (strain 168)
Q167K9 6.31e-06 49 27 1 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9HV32 6.35e-06 48 25 3 141 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23836 1.8e-05 47 26 1 101 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 3.07e-05 47 26 1 101 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 3.07e-05 47 26 1 101 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9I6V9 4.55e-05 47 26 3 129 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0VKZ4 5.13e-05 47 43 0 51 2 alkS HTH-type transcriptional regulator AlkS Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
T2KMF4 5.84e-05 47 27 2 122 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
A1SMR4 6.11e-05 46 23 2 126 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8Z7H2 6.12e-05 45 25 1 101 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q20XE6 7e-05 46 27 1 100 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodopseudomonas palustris (strain BisB18)
P0DM78 7.41e-05 45 25 1 101 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 7.41e-05 45 25 1 101 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 7.41e-05 45 25 1 101 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 7.41e-05 45 25 1 101 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 7.41e-05 45 25 1 101 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O87940 8.29e-05 45 23 3 190 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
Q0HIF6 9.09e-05 45 26 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
P24072 9.26e-05 43 22 1 114 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P39663 9.38e-05 45 24 4 170 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7MG94 0.000113 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain YJ016)
Q8D4P3 0.000113 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain CMCP6)
Q10WZ6 0.000119 45 30 6 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q57QC3 0.000121 45 24 1 101 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
A7N5N6 0.000122 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio campbellii (strain ATCC BAA-1116)
Q0HVI0 0.000122 45 26 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q87FQ5 0.000136 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O85128 0.000142 45 27 2 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8X738 0.000146 44 26 1 101 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q21ZZ9 0.00015 45 30 2 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B8H358 0.000154 44 24 2 132 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 0.000154 44 24 2 132 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1MC14 0.000166 45 26 2 113 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P10958 0.000171 44 21 3 197 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q9ZEP4 0.000187 44 24 5 119 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2NB98 0.000204 44 36 0 60 1 ELI_04755 Light-activated DNA-binding protein EL222 Erythrobacter litoralis (strain HTCC2594)
Q9L4M7 0.000225 45 40 0 52 3 alkS HTH-type transcriptional regulator AlkS Pseudomonas putida
Q9KNF3 0.00023 45 43 0 51 3 malT HTH-type transcriptional regulator MalT Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3YWK7 0.000235 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Shigella sonnei (strain Ss046)
Q31VL4 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Shigella boydii serotype 4 (strain Sb227)
Q1R5L6 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain UTI89 / UPEC)
B6I2Y2 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain SE11)
B7NE23 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AGU2 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O1:K1 / APEC
B7M2H9 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O8 (strain IAI1)
B5YTW9 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X701 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O157:H7
B7L4U8 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain 55989 / EAEC)
B7MDP4 0.000243 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8CXX5 0.000246 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0SZP7 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Shigella flexneri serotype 5b (strain 8401)
B1LI79 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain SMS-3-5 / SECEC)
Q0TC49 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N1J6 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O81 (strain ED1a)
B7NMI3 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UKC3 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSU8 0.000248 45 45 0 51 3 malT HTH-type transcriptional regulator MalT Escherichia coli O139:H28 (strain E24377A / ETEC)
P9WGM3 0.000366 43 26 3 117 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 0.000366 43 26 3 117 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2RUI8 0.000459 43 29 2 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q6LU34 0.000464 43 28 2 102 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Photobacterium profundum (strain SS9)
Q2KCH8 0.000502 43 23 2 130 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P59969 0.000615 43 36 0 49 4 BQ2027_MB0914C Putative HTH-type transcriptional regulator Mb0914c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG0 0.000615 43 36 0 49 4 MT0914 Putative HTH-type transcriptional regulator MT0914 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O78417 0.000654 42 26 5 163 3 ycf29 Probable transcriptional regulator ycf29 Guillardia theta
Q7AKE4 0.000678 42 23 4 194 1 ramR Response regulator RamR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1BRL2 0.00072 43 26 5 131 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
Q82Z76 0.000729 42 29 3 117 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
Q8EQQ3 0.000784 42 22 7 208 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q52990 0.000879 42 22 5 172 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q13SY2 0.001 42 27 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03250
Feature type CDS
Gene -
Product LuxR C-terminal-related transcriptional regulator
Location 692620 - 693249 (strand: -1)
Length 630 (nucleotides) / 209 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1823
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Protein Sequence

MPHHTIMVIDDHPLLRYGFQMLLQPDYALTIMPEPTDNAGLFAYIHQHVPRMIILDINIHAFSGIDFIKKLRHKRVPSYILVFSQSQERNDIYAAIDAGADGYILKNCDVDYLADQIKNAFQGKKIFSESVCKILQEREHFHDPITYLTRRESDVLKELACGMKNKEIARALYISEETVKVHIRNILKKLNVSTRLAASLLYLKHRLPR

Flanking regions ( +/- flanking 50bp)

CGCCATAATTAATATGGCTTCATACCGTACACCCGGCAAGGGAGAATTCTATGCCTCATCACACTATTATGGTTATTGATGACCACCCGTTGTTACGCTATGGTTTTCAAATGCTTTTACAGCCGGATTACGCGCTGACCATCATGCCTGAGCCAACGGATAACGCGGGGCTTTTTGCCTATATTCATCAGCATGTTCCCCGCATGATTATATTAGATATTAATATTCACGCTTTTTCAGGAATTGATTTCATTAAGAAACTCCGCCATAAAAGAGTGCCCAGTTATATTCTGGTATTTTCACAGTCACAAGAGCGAAATGATATATACGCGGCTATTGATGCTGGGGCTGATGGTTATATATTGAAGAATTGCGATGTTGATTATTTAGCAGATCAGATAAAGAATGCATTTCAGGGGAAAAAAATATTCAGCGAATCTGTCTGTAAAATATTACAGGAGCGGGAGCATTTTCATGACCCGATAACCTATCTTACCCGGCGGGAGTCAGATGTTCTGAAAGAACTGGCCTGCGGGATGAAAAATAAAGAGATAGCAAGGGCGCTGTATATTTCAGAAGAAACGGTAAAAGTACACATCCGTAATATCCTGAAAAAACTGAATGTCTCCACGCGGCTGGCAGCCAGCCTGTTGTATCTCAAACACCGGCTCCCCCGCTGAGCGGATATCCCCGGGCGCGTCTTGGGGATTATTCGTTTTCACTGTCAATA