Homologs in group_1861

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13510 FBDBKF_13510 100.0 Morganella morganii S1 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
NLDBIP_08910 NLDBIP_08910 100.0 Morganella morganii S4 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
LHKJJB_05355 LHKJJB_05355 100.0 Morganella morganii S3 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
HKOGLL_05560 HKOGLL_05560 100.0 Morganella morganii S5 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
F4V73_RS03250 F4V73_RS03250 86.6 Morganella psychrotolerans - LuxR C-terminal-related transcriptional regulator
PMI_RS07560 PMI_RS07560 50.2 Proteus mirabilis HI4320 - response regulator

Distribution of the homologs in the orthogroup group_1861

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1861

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P44845 2.6e-61 193 46 0 199 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31802 5.74e-60 189 44 2 212 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P0AF31 2.83e-33 121 37 1 208 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 2.83e-33 121 37 1 208 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 2.83e-33 121 37 1 208 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 2.83e-33 121 37 1 208 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
O07528 4.51e-29 110 33 3 207 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P55184 1.32e-28 109 30 2 206 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
P13800 2.3e-28 109 31 3 218 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q1M7A0 5.03e-26 102 33 5 196 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O32197 5.16e-26 102 32 2 199 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P54662 1.16e-25 102 28 2 218 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P9WGM5 1.63e-24 99 28 2 204 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 1.63e-24 99 28 2 204 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P94439 2.73e-23 95 29 3 212 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
Q7WZY4 1.48e-22 94 27 2 200 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
P96686 1.55e-22 94 29 2 203 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q7A0I0 1.91e-22 93 26 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 1.91e-22 93 26 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 1.91e-22 93 26 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 1.91e-22 93 26 1 203 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 1.91e-22 93 26 1 203 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 1.91e-22 93 26 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P56644 1.85e-21 90 26 1 198 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
P27667 2.08e-21 90 33 5 190 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGA9 7.45e-21 89 32 5 190 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 7.45e-21 89 32 5 190 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 7.45e-21 89 32 5 190 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 7.45e-21 89 32 5 190 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
Q6GE42 5.46e-20 87 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 5.46e-20 87 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L8Q6 5.52e-20 87 26 3 200 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q5HLK6 6.12e-20 87 25 3 201 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN75 7.39e-20 87 25 3 201 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A029 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 7.4e-20 86 26 2 200 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L7J5 1.26e-19 85 26 1 203 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
P26319 1.6e-19 85 28 3 197 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEL8 2.67e-19 85 30 4 196 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 2.67e-19 85 30 4 196 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
Q49YS9 3.03e-19 85 25 1 203 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HEP0 3.86e-19 84 26 1 203 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 3.86e-19 84 26 1 203 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CNP9 6.87e-19 84 25 1 203 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 6.87e-19 84 25 1 203 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WMF9 1.62e-18 83 25 1 208 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 1.62e-18 83 25 1 208 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A8R3S7 2.2e-18 82 26 1 194 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
O07019 2.9e-18 82 27 3 195 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
P0A4H2 1.32e-17 80 25 5 197 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 1.32e-17 80 25 5 197 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 1.32e-17 80 25 5 197 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P24908 2.48e-17 80 28 2 189 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACZ7 3.46e-16 76 24 1 188 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 3.46e-16 76 24 1 188 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 3.46e-16 76 24 1 188 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 3.46e-16 76 24 1 188 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
Q7CQM5 1.67e-15 75 27 1 194 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34723 2.17e-15 74 27 2 194 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
P14204 6.6e-14 70 27 5 209 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
A8R3T0 1.77e-13 69 27 3 205 3 agmR Glycerol metabolism activator Pseudomonas putida
Q51373 2.52e-13 69 21 1 206 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P29369 1.11e-12 67 25 3 205 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AED6 2.75e-12 66 21 1 191 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 2.75e-12 66 21 1 191 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 2.9e-12 66 21 1 191 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 2.9e-12 66 21 1 191 3 uvrY Response regulator UvrY Escherichia coli O157:H7
Q56127 1.71e-11 64 25 3 202 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
P58663 2.8e-11 63 24 3 202 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P69410 3e-11 63 24 3 202 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 3e-11 63 24 3 202 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 3e-11 63 24 3 202 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 3e-11 63 24 3 202 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 3e-11 63 24 3 202 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
O54294 9.16e-11 62 35 2 102 1 csgD Probable csgAB operon transcriptional regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P95582 1.24e-10 62 20 1 206 3 gacA Response regulator GacA Pseudomonas viridiflava
Q52376 2.12e-10 61 20 1 206 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P58664 2.97e-10 60 25 3 193 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
P32967 3.85e-10 60 21 2 205 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P23221 3.91e-10 60 26 6 195 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8KR08 4.41e-10 60 31 1 160 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P72781 1.58e-09 58 24 7 215 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52106 1.77e-09 58 35 2 94 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
Q46791 3.32e-09 56 30 1 129 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
Q3LWR6 3.37e-09 58 29 1 160 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 3.37e-09 58 29 1 160 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 3.37e-09 58 29 1 160 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P42421 3.75e-08 55 24 8 217 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P9WGN1 4.61e-08 55 27 2 124 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 4.61e-08 55 27 2 124 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O87940 7.16e-07 51 24 3 194 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
P21866 7.47e-07 51 29 3 117 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P39663 7.47e-07 51 23 5 170 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P58357 8.31e-07 51 28 5 121 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
P38684 1.15e-06 50 27 4 120 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P26487 2.06e-06 50 24 8 203 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9HV32 2.2e-06 50 26 3 138 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P11470 2.2e-06 47 41 1 70 1 gerE Spore germination protein GerE Bacillus subtilis (strain 168)
Q1XDE4 2.85e-06 49 29 5 168 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P37640 7.85e-06 48 42 0 54 1 yhjB Putative HTH-type transcriptional regulator YhjB Escherichia coli (strain K12)
Q7AKE4 1.22e-05 47 23 4 194 1 ramR Response regulator RamR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P9WGM3 1.33e-05 47 28 3 117 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.33e-05 47 28 3 117 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A1SMR4 1.34e-05 48 23 1 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
O69730 1.39e-05 47 26 1 102 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P45606 1.47e-05 47 21 5 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P10958 1.58e-05 47 22 4 208 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
P0AFJ5 1.63e-05 47 21 5 225 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 1.63e-05 47 21 5 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P24072 1.97e-05 45 22 1 114 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q2YSS2 2.43e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7MG94 2.46e-05 48 45 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain YJ016)
Q8D4P3 2.46e-05 48 45 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio vulnificus (strain CMCP6)
B8H358 2.71e-05 47 24 2 132 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 2.71e-05 47 24 2 132 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A7N5N6 2.72e-05 47 45 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio campbellii (strain ATCC BAA-1116)
A8Z181 2.86e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 2.86e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 2.86e-05 47 21 6 209 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 2.86e-05 47 21 6 209 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 2.86e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q7A1L2 3.03e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 3.03e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 3.03e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 3.03e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 3.03e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 3.03e-05 47 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q87FQ5 3.24e-05 47 45 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q932F1 3.59e-05 46 21 6 209 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0N8YGA2 3.61e-05 46 38 0 54 2 anoR Transcriptional activator protein AnoR Acinetobacter nosocomialis
Q6GJ11 3.73e-05 46 21 6 209 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
Q0VKZ4 4.63e-05 47 43 0 53 2 alkS HTH-type transcriptional regulator AlkS Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P45189 4.94e-05 46 28 4 121 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KNF3 4.97e-05 47 45 0 53 3 malT HTH-type transcriptional regulator MalT Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3YWK7 5.92e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Shigella sonnei (strain Ss046)
P23836 5.97e-05 45 23 5 161 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q31VL4 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Shigella boydii serotype 4 (strain Sb227)
Q1R5L6 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain UTI89 / UPEC)
B1LI79 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain SMS-3-5 / SECEC)
Q8CXX5 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TC49 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGU2 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O1:K1 / APEC
B7NMI3 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MDP4 5.98e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O45:K1 (strain S88 / ExPEC)
B6I2Y2 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain SE11)
B7NE23 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M2H9 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O8 (strain IAI1)
B5YTW9 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X701 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O157:H7
B7L4U8 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain 55989 / EAEC)
B7UKC3 6.03e-05 47 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0SZP7 6.26e-05 46 47 0 53 3 malT HTH-type transcriptional regulator MalT Shigella flexneri serotype 5b (strain 8401)
B7N1J6 6.26e-05 46 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O81 (strain ED1a)
A7ZSU8 6.26e-05 46 47 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83RR0 7.36e-05 45 23 5 161 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 7.36e-05 45 23 5 161 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q99U73 9.07e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P0C001 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 9.46e-05 45 27 3 112 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 9.46e-05 45 27 3 112 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q57QC3 0.000101 45 21 1 129 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q8EQQ3 0.000103 45 28 2 102 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q82Z76 0.00011 45 29 3 119 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
P0DM78 0.00014 45 20 1 129 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 0.00014 45 20 1 129 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 0.00014 45 20 1 129 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 0.00014 45 20 1 129 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 0.00014 45 20 1 129 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z7H2 0.000141 45 20 1 129 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
O78417 0.000176 44 25 4 163 3 ycf29 Probable transcriptional regulator ycf29 Guillardia theta
Q9CD68 0.000192 44 22 4 187 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q2NB98 0.000194 44 36 0 60 1 ELI_04755 Light-activated DNA-binding protein EL222 Erythrobacter litoralis (strain HTCC2594)
P59969 0.000213 45 38 0 49 4 BQ2027_MB0914C Putative HTH-type transcriptional regulator Mb0914c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG0 0.000213 45 38 0 49 4 MT0914 Putative HTH-type transcriptional regulator MT0914 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q20XE6 0.000247 44 26 1 100 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodopseudomonas palustris (strain BisB18)
Q167K9 0.000255 44 23 1 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A9MMA9 0.000264 45 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8X738 0.000265 43 23 5 161 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q57IV9 0.000274 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella choleraesuis (strain SC-B67)
Q8ZLI3 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z227 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella typhi
B4TY75 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella schwarzengrund (strain CVM19633)
B5BHH3 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella paratyphi A (strain AKU_12601)
A9MTT7 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PM00 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SVL9 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella newport (strain SL254)
B4TKU2 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella heidelberg (strain SL476)
B5R375 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella enteritidis PT4 (strain P125109)
B5F8N2 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella agona (strain SL483)
B5FKD6 0.000279 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella dublin (strain CT_02021853)
Q8CQ37 0.000282 43 21 7 209 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 0.000282 43 21 7 209 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B5R7J9 0.000282 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q0HIF6 0.000284 44 24 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
A8AQX2 0.000285 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WFK6 0.000304 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Enterobacter sp. (strain 638)
P96602 0.000347 43 20 3 190 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P06993 0.000375 44 45 0 53 1 malT HTH-type transcriptional regulator MalT Escherichia coli (strain K12)
A8A5M7 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli O9:H4 (strain HS)
B1X764 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain K12 / DH10B)
C4ZVX0 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain K12 / MC4100 / BW2952)
B1JHZ0 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664J3 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGR4 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pestis (strain Pestoides F)
Q8ZJI2 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pestis
B2K5W2 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2L4 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNW4 0.000375 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1IP47 0.000382 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7LSC1 0.000386 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7N976 0.000386 44 43 0 53 3 malT HTH-type transcriptional regulator MalT Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P9WMG1 0.000395 44 38 0 49 1 Rv0890c Putative HTH-type transcriptional regulator Rv0890c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q0HVI0 0.000416 43 24 1 102 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
A6TF41 0.000419 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XTR7 0.000419 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Klebsiella pneumoniae (strain 342)
A8GKU0 0.000431 44 45 0 53 3 malT HTH-type transcriptional regulator MalT Serratia proteamaculans (strain 568)
Q82EB1 0.000491 43 21 3 118 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
T2KMF4 0.000524 43 28 3 132 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P0CL17 0.000541 43 24 6 187 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 0.000541 43 24 6 187 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P15940 0.000549 43 25 1 138 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q742C1 0.000552 43 22 3 185 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 0.000552 43 22 3 185 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A7ME76 0.0006 43 45 0 53 3 malT HTH-type transcriptional regulator MalT Cronobacter sakazakii (strain ATCC BAA-894)
P54303 0.000687 43 32 2 79 3 phzR Transcriptional activator protein PhzR Pseudomonas chlororaphis
Q9L4M7 0.000687 43 38 0 52 3 alkS HTH-type transcriptional regulator AlkS Pseudomonas putida
A1JSF2 0.000689 43 45 0 53 3 malT HTH-type transcriptional regulator MalT Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q10WZ6 0.000833 43 24 2 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q2YC79 0.00086 43 21 1 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_08585
Feature type CDS
Gene citB
Product DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
Location 193833 - 194462 (strand: -1)
Length 630 (nucleotides) / 209 (amino acids)
In genomic island -

Contig

Accession ZDB_217
Length 250991 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1861
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Protein Sequence

MPHHTIMVIDDHPLLRYGFKMLLQPDYTLTIMPEFTDNNGLFSHIHQHTPRMIILDINVRAFSGIDFIKKLRHKKISSYILVFSQSRERNDIYAAIDAGADGYLLKNCDVDYLLSQIENAFKGKKIFSEAIYKILQEREHYHDPVSYLTQREADVLKELACGMKNKEIARALFISEETVKVHIRNILKKLNVSTRLAASLLYLKYRLPR

Flanking regions ( +/- flanking 50bp)

CGTTTTAATTAATATTATCTCATACCGTACACCCGGCAAGGGAGAACTCTATGCCTCATCACACTATTATGGTTATTGATGACCATCCGTTGTTACGCTATGGTTTTAAAATGCTTTTACAACCGGATTATACGTTAACCATCATGCCGGAATTTACTGACAACAATGGTCTGTTCAGCCATATCCATCAGCATACCCCCAGAATGATTATATTGGATATCAATGTCCGTGCTTTTTCCGGTATTGATTTTATTAAAAAATTACGCCACAAAAAAATATCCAGTTATATCCTGGTGTTTTCACAATCACGGGAACGGAATGATATATACGCTGCTATTGATGCCGGAGCTGATGGTTATTTATTAAAAAATTGCGATGTTGATTATTTATTAAGTCAGATTGAAAATGCGTTTAAAGGAAAAAAAATTTTCAGTGAGGCGATTTATAAAATTTTGCAGGAACGTGAACACTATCACGATCCGGTCAGTTACCTGACACAACGGGAAGCCGATGTTCTCAAAGAACTGGCCTGCGGGATGAAAAATAAGGAAATTGCACGGGCGCTGTTTATTTCGGAAGAGACAGTGAAAGTTCATATCCGCAATATACTGAAAAAGCTGAATGTCTCCACACGGCTCGCCGCCAGCCTGCTCTATCTGAAATACCGGCTGCCCCGCTGAGAGGGATCCCCGGGATGGCTGTCCGGGGGTTACTCGCTTTCTTCGTCGAT