Homologs in group_1226

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07145 FBDBKF_07145 91.7 Morganella morganii S1 serC 3-phosphoserine/phosphohydroxythreonine transaminase
EHELCC_03825 EHELCC_03825 91.7 Morganella morganii S2 serC 3-phosphoserine/phosphohydroxythreonine transaminase
NLDBIP_03825 NLDBIP_03825 91.7 Morganella morganii S4 serC 3-phosphoserine/phosphohydroxythreonine transaminase
LHKJJB_09655 LHKJJB_09655 91.7 Morganella morganii S3 serC 3-phosphoserine/phosphohydroxythreonine transaminase
HKOGLL_09320 HKOGLL_09320 91.7 Morganella morganii S5 serC 3-phosphoserine/phosphohydroxythreonine transaminase
PMI_RS03500 PMI_RS03500 81.7 Proteus mirabilis HI4320 serC 3-phosphoserine/phosphohydroxythreonine transaminase

Distribution of the homologs in the orthogroup group_1226

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1226

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ET24 0.0 628 81 1 362 3 serC Phosphoserine aminotransferase Proteus mirabilis (strain HI4320)
Q7N6D6 0.0 617 79 1 361 3 serC Phosphoserine aminotransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8RLW0 0.0 596 78 1 361 3 serC Phosphoserine aminotransferase Xenorhabdus nematophila (strain ATCC 19061 / DSM 3370 / CCUG 14189 / LMG 1036 / NCIMB 9965 / AN6)
A8GCH0 0.0 593 76 0 360 3 serC Phosphoserine aminotransferase Serratia proteamaculans (strain 568)
P19689 0.0 593 76 0 360 3 serC Phosphoserine aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q6D400 0.0 588 76 0 360 3 serC Phosphoserine aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DF64 0.0 586 76 0 360 3 serC Phosphoserine aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q66CI9 0.0 578 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TN19 0.0 578 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pestis (strain Pestoides F)
A9R7I1 0.0 578 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGB4 0.0 578 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pestis
B2KA22 0.0 578 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CA74 0.0 578 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
B1JRE0 0.0 577 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FJX0 0.0 577 74 0 360 3 serC Phosphoserine aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VC80 0.0 575 74 0 360 3 serC Phosphoserine aminotransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NUB0 0.0 556 71 0 360 3 serC Phosphoserine aminotransferase Sodalis glossinidius (strain morsitans)
A4W8S7 0.0 547 70 3 362 3 serC Phosphoserine aminotransferase Enterobacter sp. (strain 638)
Q9X4H1 0.0 546 69 1 362 3 serC Phosphoserine aminotransferase Edwardsiella ictaluri (strain 93-146)
A7MES8 0.0 542 70 0 360 3 serC Phosphoserine aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
B7LN70 0.0 538 69 3 362 3 serC Phosphoserine aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P55900 0.0 536 69 1 361 1 serC Phosphoserine aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T141 0.0 536 69 1 361 3 serC Phosphoserine aminotransferase Salmonella newport (strain SL254)
A8AIH6 0.0 536 70 3 362 3 serC Phosphoserine aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8FJB7 0.0 535 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJE6 0.0 535 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MS22 0.0 535 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O81 (strain ED1a)
Q1RDV1 0.0 534 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain UTI89 / UPEC)
A1A9I4 0.0 534 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O1:K1 / APEC
B5YT41 0.0 534 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XEA7 0.0 534 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O157:H7
B7MHL6 0.0 534 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NM68 0.0 533 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3Z3L5 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Shigella sonnei (strain Ss046)
Q83LP3 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Shigella flexneri
B1LJV7 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I8X9 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain SE11)
P23721 0.0 532 69 3 362 1 serC Phosphoserine aminotransferase Escherichia coli (strain K12)
B1IW24 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYL0 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O9:H4 (strain HS)
B1X847 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZQ33 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M835 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O8 (strain IAI1)
B7LD99 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli (strain 55989 / EAEC)
B7UMZ3 0.0 532 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32E24 0.0 531 69 3 362 3 serC Phosphoserine aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
A7ZJZ6 0.0 531 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
C0PXU3 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella paratyphi C (strain RKS4594)
Q57R24 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella choleraesuis (strain SC-B67)
B7NAQ6 0.0 531 69 3 362 3 serC Phosphoserine aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TUH4 0.0 531 69 3 362 3 serC Phosphoserine aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P62677 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella typhi
B4TRT8 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella schwarzengrund (strain CVM19633)
A9N7V7 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TD37 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella heidelberg (strain SL476)
P62676 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella gallinarum
B5R8J4 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QYQ7 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5FQ49 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella dublin (strain CT_02021853)
B5F159 0.0 531 69 1 361 3 serC Phosphoserine aminotransferase Salmonella agona (strain SL483)
Q31YU4 0.0 530 69 3 362 3 serC Phosphoserine aminotransferase Shigella boydii serotype 4 (strain Sb227)
A9MHX6 0.0 529 69 1 361 3 serC Phosphoserine aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6T700 0.0 529 68 1 361 1 serC Phosphoserine aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XY88 0.0 525 67 1 361 3 serC Phosphoserine aminotransferase Klebsiella pneumoniae (strain 342)
Q6LPD9 0.0 511 65 1 361 3 serC Phosphoserine aminotransferase Photobacterium profundum (strain SS9)
Q5E6F2 1.41e-179 505 65 1 360 3 serC Phosphoserine aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FCJ8 9.62e-178 500 65 1 360 3 serC Phosphoserine aminotransferase Aliivibrio fischeri (strain MJ11)
Q87QA3 1.44e-177 500 65 1 358 3 serC Phosphoserine aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1LTL2 5.33e-176 496 64 2 362 3 serC Phosphoserine aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q8D900 6.16e-176 496 65 1 358 3 serC Phosphoserine aminotransferase Vibrio vulnificus (strain CMCP6)
Q7MLH6 6.88e-176 496 65 1 358 3 serC Phosphoserine aminotransferase Vibrio vulnificus (strain YJ016)
C4K3B1 5.45e-173 488 64 4 367 3 serC Phosphoserine aminotransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
P81435 5.08e-160 455 56 2 361 3 serC Phosphoserine aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9KSU7 1.2e-159 454 61 1 358 3 serC Phosphoserine aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q492S5 2.82e-155 443 54 1 361 3 serC Phosphoserine aminotransferase Blochmanniella pennsylvanica (strain BPEN)
B8D7K4 5.08e-155 442 56 0 360 3 serC Phosphoserine aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57397 5.54e-155 442 57 0 360 3 serC Phosphoserine aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9A2 5.54e-155 442 57 0 360 3 serC Phosphoserine aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q6F961 3.07e-151 433 58 1 358 3 serC Phosphoserine aminotransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5QZ48 2.12e-148 426 56 2 360 3 serC Phosphoserine aminotransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A3M7Z0 2.9e-148 425 56 1 358 3 serC Phosphoserine aminotransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7I5D6 2.9e-148 425 56 1 358 3 serC Phosphoserine aminotransferase Acinetobacter baumannii (strain AB0057)
B7GY87 2.9e-148 425 56 1 358 3 serC Phosphoserine aminotransferase Acinetobacter baumannii (strain AB307-0294)
Q0I322 1.29e-147 424 57 1 355 3 serC Phosphoserine aminotransferase Histophilus somni (strain 129Pt)
B2HWW3 2.01e-147 423 56 1 358 3 serC Phosphoserine aminotransferase Acinetobacter baumannii (strain ACICU)
Q7VLP0 2.02e-147 423 56 2 363 3 serC Phosphoserine aminotransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VR40 6.06e-147 422 52 3 364 3 serC Phosphoserine aminotransferase Blochmanniella floridana
P59492 1.75e-146 421 52 2 366 3 serC Phosphoserine aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q02PX3 5.91e-145 417 55 1 358 3 serC Phosphoserine aminotransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V9J9 5.91e-145 417 55 1 358 3 serC Phosphoserine aminotransferase Pseudomonas aeruginosa (strain LESB58)
Q9HZ66 1.05e-144 416 55 1 358 1 serC Phosphoserine aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q12MU6 7.64e-144 414 56 3 364 3 serC Phosphoserine aminotransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q3SK88 4.65e-143 412 55 1 357 3 serC Phosphoserine aminotransferase Thiobacillus denitrificans (strain ATCC 25259)
A4XTE7 7.22e-143 412 54 1 359 3 serC Phosphoserine aminotransferase Pseudomonas mendocina (strain ymp)
Q4ZQ94 1.79e-142 411 55 1 358 3 serC Phosphoserine aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
Q057N5 2.99e-142 410 50 1 360 3 serC Phosphoserine aminotransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q3ILA3 6.27e-142 409 52 0 357 3 serC Phosphoserine aminotransferase Pseudoalteromonas translucida (strain TAC 125)
Q2SCF2 7.48e-142 409 55 2 358 3 serC Phosphoserine aminotransferase Hahella chejuensis (strain KCTC 2396)
Q1IDA2 1.42e-141 409 54 1 359 3 serC Phosphoserine aminotransferase Pseudomonas entomophila (strain L48)
P44336 2.41e-141 408 54 1 357 3 serC Phosphoserine aminotransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A4JCH1 3.05e-141 407 55 2 358 3 serC Phosphoserine aminotransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1S6D1 3.11e-141 408 55 2 364 3 serC Phosphoserine aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
P57881 3.3e-141 407 54 1 357 3 serC Phosphoserine aminotransferase Pasteurella multocida (strain Pm70)
Q88M07 3.34e-141 407 54 1 358 3 serC Phosphoserine aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B2T637 3.8e-141 407 54 2 358 3 serC Phosphoserine aminotransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
C1DRQ9 4.48e-141 407 54 1 358 3 serC Phosphoserine aminotransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q885T5 4.79e-141 407 55 1 358 3 serC Phosphoserine aminotransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6V2Q8 6.22e-141 407 55 1 356 3 serC Phosphoserine aminotransferase Pseudomonas aeruginosa (strain PA7)
A0KWN5 9.77e-141 406 55 3 364 3 serC Phosphoserine aminotransferase Shewanella sp. (strain ANA-3)
Q65S80 2e-140 405 52 2 362 3 serC Phosphoserine aminotransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0HIX3 3.25e-140 405 55 3 364 3 serC Phosphoserine aminotransferase Shewanella sp. (strain MR-4)
Q39IG4 2.46e-139 403 53 2 358 3 serC Phosphoserine aminotransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9ADV9 2.54e-139 403 54 0 357 3 serC Phosphoserine aminotransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q9RI02 2.75e-139 403 53 1 358 3 serC Phosphoserine aminotransferase Stutzerimonas stutzeri
A3D4A1 3.04e-139 402 54 3 364 3 serC Phosphoserine aminotransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B2JF00 3.16e-139 402 54 2 358 3 serC Phosphoserine aminotransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0HV09 4.09e-139 402 55 3 364 3 serC Phosphoserine aminotransferase Shewanella sp. (strain MR-7)
B8EA90 4.51e-139 402 54 3 364 3 serC Phosphoserine aminotransferase Shewanella baltica (strain OS223)
B1YV30 7.18e-139 402 54 2 358 3 serC Phosphoserine aminotransferase Burkholderia ambifaria (strain MC40-6)
Q0BH96 1.2e-138 401 54 2 358 3 serC Phosphoserine aminotransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q820S0 1.43e-138 401 54 5 370 3 serC Phosphoserine aminotransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A9L2Y2 2.03e-138 400 54 3 364 3 serC Phosphoserine aminotransferase Shewanella baltica (strain OS195)
B4EB45 3.77e-138 400 53 2 358 3 serC Phosphoserine aminotransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1JXR6 7.67e-138 399 52 0 357 3 serC Phosphoserine aminotransferase Burkholderia orbicola (strain MC0-3)
A4Y757 9.8e-138 399 54 3 363 3 serC Phosphoserine aminotransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0TT41 1.15e-137 399 54 2 364 3 serC Phosphoserine aminotransferase Shewanella halifaxensis (strain HAW-EB4)
Q8EEH2 1.35e-137 399 54 4 366 3 serC Phosphoserine aminotransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RJD3 1.36e-137 399 54 3 363 3 serC Phosphoserine aminotransferase Shewanella sp. (strain W3-18-1)
A6WNN5 1.79e-137 398 53 3 364 3 serC Phosphoserine aminotransferase Shewanella baltica (strain OS185)
Q1BY31 3.46e-137 397 52 0 357 3 serC Phosphoserine aminotransferase Burkholderia orbicola (strain AU 1054)
A0K5L8 3.46e-137 397 52 0 357 3 serC Phosphoserine aminotransferase Burkholderia cenocepacia (strain HI2424)
C3K6J5 1.65e-136 395 53 1 358 3 serC Phosphoserine aminotransferase Pseudomonas fluorescens (strain SBW25)
A6T1G7 3.75e-136 395 51 2 363 3 serC Phosphoserine aminotransferase Janthinobacterium sp. (strain Marseille)
C1D8N3 3.94e-136 395 54 4 359 3 serC Phosphoserine aminotransferase Laribacter hongkongensis (strain HLHK9)
A8H4A2 1.25e-134 391 54 4 366 3 serC Phosphoserine aminotransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FVN8 2.74e-134 390 53 2 364 3 serC Phosphoserine aminotransferase Shewanella sediminis (strain HAW-EB3)
Q8D268 5.03e-134 389 47 2 361 3 serC Phosphoserine aminotransferase Wigglesworthia glossinidia brevipalpis
Q081U0 6.85e-134 389 53 3 364 3 serC Phosphoserine aminotransferase Shewanella frigidimarina (strain NCIMB 400)
B1KF45 1.05e-133 389 53 4 365 3 serC Phosphoserine aminotransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A4G865 1.16e-131 383 50 2 363 3 serC Phosphoserine aminotransferase Herminiimonas arsenicoxydans
B2FKF0 2.01e-131 383 51 3 362 1 serC Phosphoserine aminotransferase Stenotrophomonas maltophilia (strain K279a)
Q8Y0Z0 2.66e-131 383 52 3 364 3 serC Phosphoserine aminotransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5CWI0 5.35e-131 382 50 3 363 3 serC Phosphoserine aminotransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B4SP45 1.51e-130 380 51 3 362 3 serC Phosphoserine aminotransferase Stenotrophomonas maltophilia (strain R551-3)
B5EPR5 3.18e-130 380 52 2 358 3 serC Phosphoserine aminotransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J6V1 3.18e-130 380 52 2 358 3 serC Phosphoserine aminotransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B2U882 2.28e-129 378 51 3 364 3 serC Phosphoserine aminotransferase Ralstonia pickettii (strain 12J)
Q5P7U7 1.14e-128 376 52 4 367 3 serC Phosphoserine aminotransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q9SHP0 1.31e-128 378 50 4 369 1 PSAT2 Phosphoserine aminotransferase 2, chloroplastic Arabidopsis thaliana
B8CMG9 1.63e-128 375 51 2 364 3 serC Phosphoserine aminotransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A1AWS0 1.15e-127 373 50 3 363 3 serC Phosphoserine aminotransferase Ruthia magnifica subsp. Calyptogena magnifica
B6J1E0 3.3e-127 372 50 3 361 3 serC Phosphoserine aminotransferase Coxiella burnetii (strain CbuG_Q212)
A9KCT6 6.02e-127 371 50 3 361 3 serC Phosphoserine aminotransferase Coxiella burnetii (strain Dugway 5J108-111)
Q96255 1.11e-126 373 49 2 360 1 PSAT1 Phosphoserine aminotransferase 1, chloroplastic Arabidopsis thaliana
Q83E12 2.92e-126 370 50 3 361 3 serC Phosphoserine aminotransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q7NVP1 4.02e-126 369 51 3 362 3 serC Phosphoserine aminotransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B6J893 4.78e-126 369 50 3 361 3 serC Phosphoserine aminotransferase Coxiella burnetii (strain CbuK_Q154)
A9NC17 1.81e-125 367 50 3 361 3 serC Phosphoserine aminotransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q21Y51 5.08e-125 367 49 4 372 3 serC Phosphoserine aminotransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A6VZ92 8.75e-124 363 50 2 360 3 serC Phosphoserine aminotransferase Marinomonas sp. (strain MWYL1)
B2SJJ1 1.56e-123 363 48 2 361 3 serC Phosphoserine aminotransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q8PA97 2.03e-123 362 49 4 366 3 serC Phosphoserine aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTC9 2.03e-123 362 49 4 366 3 serC Phosphoserine aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
Q5H079 3.28e-123 362 48 2 361 3 serC Phosphoserine aminotransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P354 3.28e-123 362 48 2 361 3 serC Phosphoserine aminotransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PLY7 6.73e-123 361 49 3 362 3 serC Phosphoserine aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BUZ3 7.11e-123 361 49 3 362 3 serC Phosphoserine aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A1VR16 3.63e-122 359 46 4 370 3 serC Phosphoserine aminotransferase Polaromonas naphthalenivorans (strain CJ2)
B0RUW3 7.33e-122 358 48 4 366 3 serC Phosphoserine aminotransferase Xanthomonas campestris pv. campestris (strain B100)
Q12CL3 5.71e-121 356 46 4 370 3 serC Phosphoserine aminotransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A9BM04 6.7e-120 353 47 4 370 3 serC Phosphoserine aminotransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1TSA3 9.92e-120 353 46 3 368 3 serC Phosphoserine aminotransferase Paracidovorax citrulli (strain AAC00-1)
Q87BU0 1.75e-117 347 48 3 364 3 serC Phosphoserine aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q81BC0 1.04e-116 345 46 2 358 3 serC Phosphoserine aminotransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9PB19 1.16e-116 345 48 3 364 3 serC Phosphoserine aminotransferase Xylella fastidiosa (strain 9a5c)
P52877 4.43e-116 346 48 4 369 1 PSA Phosphoserine aminotransferase, chloroplastic Spinacia oleracea
Q99K85 1.54e-115 343 45 4 365 1 Psat1 Phosphoserine aminotransferase Mus musculus
Q8Y3L0 1.95e-115 342 50 4 356 3 serC Phosphoserine aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q2L2T1 2.11e-115 342 48 4 375 3 serC Phosphoserine aminotransferase Bordetella avium (strain 197N)
Q71VT6 2.2e-115 342 50 4 356 3 serC Phosphoserine aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
B1HSU6 3.96e-115 341 46 2 359 3 serC Phosphoserine aminotransferase Lysinibacillus sphaericus (strain C3-41)
Q5F7A0 6e-115 341 47 4 365 3 serC Phosphoserine aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P10658 6.41e-115 341 45 4 365 2 PSAT1 Phosphoserine aminotransferase Oryctolagus cuniculus
Q9Y617 1.07e-114 340 46 4 365 1 PSAT1 Phosphoserine aminotransferase Homo sapiens
P57007 1.6e-114 340 47 4 365 3 serC Phosphoserine aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7W5Z9 7.34e-114 338 46 4 376 3 serC Phosphoserine aminotransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGU2 7.34e-114 338 46 4 376 3 serC Phosphoserine aminotransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O34370 8.83e-114 338 47 4 365 3 serC Phosphoserine aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7VZG4 8.93e-114 338 46 4 376 3 serC Phosphoserine aminotransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9IJI3 1.63e-113 338 46 4 376 3 serC Phosphoserine aminotransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A1KV48 2.54e-113 337 47 4 365 3 serC Phosphoserine aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q926T3 2.89e-113 337 49 4 356 3 serC Phosphoserine aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q734W9 3.08e-113 337 46 2 358 3 serC Phosphoserine aminotransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
A9B6Q3 3.92e-113 336 46 2 358 3 serC Phosphoserine aminotransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q638W1 5.86e-113 336 45 2 358 3 serC Phosphoserine aminotransferase Bacillus cereus (strain ZK / E33L)
Q6HGI0 1.25e-111 332 45 1 357 3 serC Phosphoserine aminotransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q88ZU5 3.91e-111 331 46 3 357 3 serC Phosphoserine aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A3CPJ2 9.45e-111 330 47 4 363 3 serC Phosphoserine aminotransferase Streptococcus sanguinis (strain SK36)
Q5X5E7 9.55e-111 330 44 3 364 3 serC Phosphoserine aminotransferase Legionella pneumophila (strain Paris)
C3P210 4.15e-110 328 45 2 358 3 serC Phosphoserine aminotransferase Bacillus anthracis (strain A0248)
Q9VAN0 4.48e-110 328 45 4 363 2 CG11899 Probable phosphoserine aminotransferase Drosophila melanogaster
Q5ZVM2 7.88e-110 328 44 3 361 3 serC Phosphoserine aminotransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9CHW5 8.23e-110 328 48 7 364 3 serC Phosphoserine aminotransferase Lactococcus lactis subsp. lactis (strain IL1403)
A5IBR0 8.89e-110 328 44 3 364 3 serC Phosphoserine aminotransferase Legionella pneumophila (strain Corby)
Q5WWT0 1.42e-109 327 44 3 361 3 serC Phosphoserine aminotransferase Legionella pneumophila (strain Lens)
Q5L296 3.28e-109 326 47 3 360 3 serC Phosphoserine aminotransferase Geobacillus kaustophilus (strain HTA426)
Q6ALW3 6.8e-109 325 47 3 356 3 serC Phosphoserine aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A2RIS2 1.22e-108 325 46 8 369 3 serC Phosphoserine aminotransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q031D5 1.59e-108 325 47 7 368 3 serC Phosphoserine aminotransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q59196 1.89e-108 324 45 2 357 1 serC Phosphoserine aminotransferase Niallia circulans
Q8F930 5.94e-107 320 46 1 357 3 serC Phosphoserine aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72VI2 5.94e-107 320 46 1 357 3 serC Phosphoserine aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q1D2L9 8.05e-107 320 47 3 357 3 serC Phosphoserine aminotransferase Myxococcus xanthus (strain DK1622)
A8YW78 1.54e-106 320 43 3 358 3 serC Phosphoserine aminotransferase Lactobacillus helveticus (strain DPC 4571)
A4VU42 1.03e-105 317 46 4 358 3 serC Phosphoserine aminotransferase Streptococcus suis (strain 05ZYH33)
A4W0D4 1.03e-105 317 46 4 358 3 serC Phosphoserine aminotransferase Streptococcus suis (strain 98HAH33)
B8FLC3 2.24e-105 317 45 2 360 3 serC Phosphoserine aminotransferase Desulfatibacillum aliphaticivorans
Q9RME2 3.21e-105 316 43 2 358 1 serC Phosphoserine aminotransferase Alkalihalobacillus alcalophilus
B9DTW4 8.63e-105 315 45 4 363 3 serC Phosphoserine aminotransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A9A0A5 1.73e-104 314 44 2 359 3 serC Phosphoserine aminotransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
P91856 2.03e-104 314 43 4 362 3 F26H9.5 Probable phosphoserine aminotransferase Caenorhabditis elegans
Q8DSV3 4.86e-104 313 45 4 359 3 serC Phosphoserine aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q55CQ6 8.5e-104 313 43 8 367 3 serC Probable phosphoserine aminotransferase Dictyostelium discoideum
Q03JH6 1.15e-102 310 45 6 360 3 serC Phosphoserine aminotransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LYP0 1.15e-102 310 45 6 360 3 serC Phosphoserine aminotransferase Streptococcus thermophilus (strain CNRZ 1066)
Q5WHT9 2e-102 309 44 4 362 3 serC Phosphoserine aminotransferase Shouchella clausii (strain KSM-K16)
Q9KDM4 7.21e-102 307 44 2 361 3 serC Phosphoserine aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5M3A4 1.44e-101 307 45 6 360 3 serC Phosphoserine aminotransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
B0SKW4 8.75e-101 305 43 3 360 3 serC Phosphoserine aminotransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCE2 8.75e-101 305 43 3 360 3 serC Phosphoserine aminotransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A0LK14 1.49e-99 301 44 3 359 3 serC Phosphoserine aminotransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8E3Y3 3.12e-98 298 44 4 359 3 serC Phosphoserine aminotransferase Streptococcus agalactiae serotype III (strain NEM316)
Q7UQL3 2.78e-96 294 44 6 365 3 serC Phosphoserine aminotransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P80862 1.73e-95 291 41 3 361 1 serC Phosphoserine aminotransferase Bacillus subtilis (strain 168)
B6YQL2 3.65e-94 288 42 5 358 3 serC Phosphoserine aminotransferase Azobacteroides pseudotrichonymphae genomovar. CFP2
B2GBS2 3.38e-93 285 42 5 357 3 serC Phosphoserine aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A7H543 1.1e-92 284 41 7 359 3 serC Phosphoserine aminotransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A6L9B7 1.4e-92 283 41 4 358 3 serC Phosphoserine aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q9PIH3 1.54e-92 283 41 7 359 1 serC Phosphoserine aminotransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VY45 9.03e-92 281 40 7 359 3 serC Phosphoserine aminotransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q5HWE5 1.99e-91 281 41 7 359 3 serC Phosphoserine aminotransferase Campylobacter jejuni (strain RM1221)
A8FKB5 2.5e-91 280 41 7 359 3 serC Phosphoserine aminotransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q7MV30 1.2e-89 276 40 4 360 3 serC Phosphoserine aminotransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RID6 1.2e-89 276 40 4 360 3 serC Phosphoserine aminotransferase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B9KDM7 1.24e-88 273 40 6 362 3 serC Phosphoserine aminotransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q8A8L4 7.89e-88 271 39 6 359 3 serC Phosphoserine aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
C4L432 9.16e-88 271 42 5 354 3 serC Phosphoserine aminotransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q64UR4 3.35e-85 265 38 5 358 3 serC Phosphoserine aminotransferase Bacteroides fragilis (strain YCH46)
Q5LDN9 3.35e-85 265 38 5 358 3 serC Phosphoserine aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6L5A6 1.56e-83 260 40 6 359 3 serC Phosphoserine aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A5FH28 1.56e-82 258 40 4 356 3 serC Phosphoserine aminotransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A5EV80 2.24e-82 258 37 4 359 3 serC Phosphoserine aminotransferase Dichelobacter nodosus (strain VCS1703A)
A6GXC2 5.89e-80 251 39 4 356 3 serC Phosphoserine aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
P33330 1.11e-78 249 38 7 386 1 SER1 Phosphoserine aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q10349 1.69e-78 249 35 6 383 3 SPAC1F12.07 Putative phosphoserine aminotransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q03W65 1.03e-74 238 37 5 360 3 serC Phosphoserine aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A1TF55 3.59e-18 88 27 13 327 3 serC Putative phosphoserine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1B3G6 7.49e-15 78 23 12 341 3 serC Putative phosphoserine aminotransferase Mycobacterium sp. (strain MCS)
A1ULN4 7.49e-15 78 23 12 341 3 serC Putative phosphoserine aminotransferase Mycobacterium sp. (strain KMS)
A3Q635 7.49e-15 78 23 12 341 3 serC Putative phosphoserine aminotransferase Mycobacterium sp. (strain JLS)
A0QBI3 6.48e-14 75 24 10 327 3 serC Putative phosphoserine aminotransferase Mycobacterium avium (strain 104)
Q742L2 1.01e-13 75 24 12 341 3 serC Putative phosphoserine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
O33062 1.2e-12 72 23 12 360 3 serC Putative phosphoserine aminotransferase Mycobacterium leprae (strain TN)
C1ATN6 1.29e-11 68 24 13 361 3 serC Phosphoserine aminotransferase Rhodococcus opacus (strain B4)
P9WQ73 2.16e-11 68 23 15 374 1 serC Phosphoserine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ72 2.16e-11 68 23 15 374 3 serC Phosphoserine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63515 2.16e-11 68 23 15 374 3 serC Putative phosphoserine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0S6R3 4.9e-11 67 24 13 361 3 serC Phosphoserine aminotransferase Rhodococcus jostii (strain RHA1)
Q9X1C0 6.02e-07 54 23 9 280 1 TM_1400 Serine-pyruvate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A1SEM0 1.36e-06 53 21 9 336 3 serC Phosphoserine aminotransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q7PRG3 5.13e-05 48 23 13 298 1 HKT 3-hydroxykynurenine transaminase Anopheles gambiae
A4QCG9 6.11e-05 48 21 12 334 3 serC Phosphoserine aminotransferase Corynebacterium glutamicum (strain R)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01330
Feature type CDS
Gene serC
Product 3-phosphoserine/phosphohydroxythreonine transaminase
Location 288578 - 289663 (strand: 1)
Length 1086 (nucleotides) / 361 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1226
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00266 Aminotransferase class-V

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1932 Coenzyme transport and metabolism (H)
Amino acid transport and metabolism (E)		 HE Phosphoserine aminotransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MSQVYNFSAGPAMLPVEVLRRAEQELCNWRGLGTSVMEISHRSNEFMAVAKEAENNLRQLLAVPDNYKVLFCHGGARGHFAALPMNLLGENTKADYIVGGYWAECAAEEAQKYCTPNIIDIRTETADGVGVKPMSEWALSDDAAYVHYCPNETIDGIAIHEEPDFGDKIVIADYSSAILSKPLDVSRFGVIYAGAQKNIGPAGLTLVIIREDLLGKARKETPSILDYTVLSENDSMFNTPPTFAWYLSGMVFKWLIEQGGLQEIAQRNYEKAKLLYEAVDHSDFYINRVAGANRSLMNVPFQMADPSLDSKFLEEAQAQGLVSLKGHRVSGGMRASIYNAMSLEGVKALVEFMAEFERRHS

Flanking regions ( +/- flanking 50bp)

CTGCAGTTTGAATGAATAAGGGTATAAATTTACGAAATAGGGTGGGGTCAATGAGTCAGGTATATAATTTTAGTGCCGGTCCGGCCATGCTGCCGGTTGAAGTACTGCGCCGTGCTGAGCAGGAGTTGTGCAACTGGCGCGGGCTGGGAACCTCGGTGATGGAAATCAGCCACCGCAGCAACGAATTTATGGCAGTAGCAAAAGAAGCGGAAAATAATCTGCGCCAGTTACTGGCTGTGCCGGATAATTATAAAGTCCTGTTCTGTCATGGCGGTGCACGCGGGCACTTTGCTGCACTGCCGATGAATCTGCTGGGTGAGAACACTAAGGCAGACTATATTGTCGGCGGTTACTGGGCGGAATGTGCGGCAGAAGAAGCACAAAAATATTGCACACCAAATATTATTGATATCAGAACAGAAACCGCAGACGGCGTCGGTGTGAAACCGATGAGTGAATGGGCGCTCAGTGATGATGCGGCGTATGTTCACTATTGCCCGAATGAAACCATTGATGGTATCGCCATCCATGAAGAGCCGGATTTCGGCGACAAAATTGTGATCGCTGATTACTCCTCTGCGATCCTCTCTAAACCGCTGGATGTCAGCCGCTTCGGGGTTATCTATGCCGGCGCACAGAAAAATATCGGCCCGGCGGGTCTGACCCTGGTCATTATCCGTGAGGATTTACTGGGCAAAGCGCGCAAAGAAACCCCGTCCATTCTTGATTACACCGTACTGAGTGAAAACGACTCGATGTTCAATACGCCGCCGACTTTTGCCTGGTATCTTTCCGGGATGGTCTTTAAGTGGCTGATTGAGCAGGGCGGCTTACAGGAAATTGCTCAGCGCAACTATGAAAAAGCAAAATTGCTTTATGAAGCCGTGGATCACAGTGATTTCTATATTAACCGCGTTGCCGGGGCGAACCGTTCCCTGATGAATGTGCCGTTCCAGATGGCAGACCCGTCACTTGACAGCAAATTCCTTGAAGAAGCACAGGCGCAGGGTCTGGTATCACTGAAAGGTCACCGGGTTTCCGGCGGCATGCGTGCTTCCATTTATAATGCGATGTCCCTTGAGGGTGTTAAGGCGCTGGTTGAGTTTATGGCAGAGTTCGAGCGCCGCCACAGCTGATTTTCTTCGCAGACATTTTACCGGACCCGGGTTTGCGCCCGGGTCCGTTT