Homologs in group_1524

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09845 FBDBKF_09845 96.0 Morganella morganii S1 gltA citrate synthase
EHELCC_04645 EHELCC_04645 96.0 Morganella morganii S2 gltA citrate synthase
NLDBIP_04645 NLDBIP_04645 96.0 Morganella morganii S4 gltA citrate synthase
LHKJJB_13985 LHKJJB_13985 96.0 Morganella morganii S3 gltA citrate synthase
HKOGLL_12550 HKOGLL_12550 96.0 Morganella morganii S5 gltA citrate synthase
PMI_RS02775 PMI_RS02775 86.2 Proteus mirabilis HI4320 - citrate synthase

Distribution of the homologs in the orthogroup group_1524

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1524

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABH7 0.0 755 81 0 426 1 gltA Citrate synthase Escherichia coli (strain K12)
P0ABH8 0.0 755 81 0 426 3 gltA Citrate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O68883 0.0 754 81 0 426 3 gltA Citrate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14165 0.0 642 68 1 428 1 gltA Citrate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P51033 0.0 617 67 5 432 3 gltA Citrate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
O33915 0.0 610 68 4 424 3 gltA Citrate synthase Rhizobium meliloti (strain 1021)
P51037 0.0 608 68 4 424 3 ccsA Citrate synthase, chromosomal Rhizobium tropici
P51034 0.0 600 66 4 424 3 gltA Citrate synthase Bartonella quintana (strain Toulouse)
P51038 0.0 595 66 4 424 3 pcsA Citrate synthase, plasmid Rhizobium tropici
P20902 0.0 589 65 3 416 3 gltA Citrate synthase Acinetobacter calcoaceticus subsp. anitratus
P94325 0.0 578 64 4 423 3 gltA Citrate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P18789 0.0 577 63 3 421 3 gltA Citrate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P20901 0.0 566 62 4 419 1 aarA Citrate synthase Acetobacter aceti
Q1RGV8 0.0 548 61 4 422 3 gltA Citrate synthase Rickettsia bellii (strain RML369-C)
Q59778 0.0 547 61 5 421 3 gltA Citrate synthase Rickettsia sibirica (strain ATCC VR-151 / 246)
Q59776 0.0 547 61 5 421 3 gltA Citrate synthase Rickettsia slovaca (strain 13-B)
P09948 0.0 546 59 5 427 3 gltA Citrate synthase Rickettsia prowazekii (strain Madrid E)
Q59732 0.0 546 60 5 421 3 gltA Citrate synthase Rickettsia africae (strain ESF-5)
P51040 0.0 545 60 5 421 3 gltA Citrate synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P51042 0.0 545 60 5 421 3 gltA Citrate synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P51043 0.0 543 59 5 427 3 gltA Citrate synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q59734 0.0 533 61 4 409 3 gltA Citrate synthase (Fragment) Rickettsia bellii
Q59759 0.0 531 61 5 409 3 gltA Citrate synthase (Fragment) Rickettsia parkeri
Q59768 0.0 528 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia rhipicephali
Q59748 0.0 528 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia massiliae
Q59730 0.0 528 61 5 409 3 gltA Citrate synthase (Fragment) Rickettsia akari
Q59136 0.0 527 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia conorii subsp. caspia (strain A-167)
Q59741 0.0 526 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia helvetica
P51039 0.0 526 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia australis
Q59742 0.0 525 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia japonica
P51041 0.0 523 60 5 408 3 gltA Citrate synthase (Fragment) Rickettsia canadensis
Q59198 1.39e-179 506 73 1 320 3 gltA Citrate synthase (Fragment) Bartonella doshiae
P51032 2.51e-178 503 71 1 320 3 gltA Citrate synthase (Fragment) Bartonella elizabethae
P51036 5.89e-177 499 71 1 318 3 gltA Citrate synthase (Fragment) Bartonella vinsonii
Q59258 7.33e-175 494 70 1 321 3 gltA Citrate synthase (Fragment) Bartonella taylorii
P51031 3.54e-171 485 69 1 320 3 gltA Citrate synthase (Fragment) Bartonella bacilliformis
P9WPD5 5.31e-164 471 54 3 410 1 gltA2 Citrate synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD4 5.31e-164 471 54 3 410 3 gltA2 Citrate synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P42457 9.07e-140 409 49 4 407 3 gltA Citrate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q86AV6 3.9e-133 395 47 6 398 3 gltA Citrate synthase Dictyostelium discoideum
Q8MQU6 2.58e-127 380 47 5 392 2 cshA Citrate synthase, peroxisomal Dictyostelium discoideum
P56062 6.94e-120 358 43 5 411 3 gltA Citrate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZN37 6.56e-119 356 43 5 411 3 gltA Citrate synthase Helicobacter pylori (strain J99 / ATCC 700824)
P49299 7.05e-119 359 44 7 417 1 None Citrate synthase, glyoxysomal Cucurbita maxima
Q9SJH7 4.22e-118 357 45 6 400 2 CSY3 Citrate synthase 3, peroxisomal Arabidopsis thaliana
Q9LXS6 2.05e-117 355 45 5 394 2 CSY2 Citrate synthase 2, peroxisomal Arabidopsis thaliana
Q9LXS7 1.8e-110 336 44 7 395 2 CSY1 Citrate synthase 1, peroxisomal Arabidopsis thaliana
Q59977 2.01e-89 279 38 6 374 3 gltA Citrate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51045 2.72e-77 248 35 6 384 3 gltA Citrate synthase Acidithiobacillus ferridurans
Q2TXF1 2.68e-71 234 32 4 385 3 oryE Citrate synthase-like protein oryE Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q53554 1.34e-68 225 36 9 364 1 gltA Citrate synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9RWB2 1.84e-68 224 35 6 376 1 gltA Citrate synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
D4GS06 5.11e-67 221 35 10 388 1 citZ Citrate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P80148 1.06e-65 218 34 4 361 1 gltA Citrate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A0A3G1DJJ8 2.35e-63 214 33 5 388 2 R3 Citrate synthase-like protein Phoma sp. (strain ATCC 20986 / MF5453)
P27660 4.46e-62 208 33 7 374 3 ctsA Citrate synthase Heyndrickxia coagulans
P39120 4.58e-62 208 34 9 377 1 citZ Citrate synthase 2 Bacillus subtilis (strain 168)
P39119 3.16e-59 200 31 7 372 1 citA Citrate synthase 1 Bacillus subtilis (strain 168)
P45858 1.55e-58 199 32 7 374 1 mmgD Citrate/2-methylcitrate synthase Bacillus subtilis (strain 168)
Q59939 1.28e-57 196 33 11 373 3 citZ Citrate synthase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P21553 2.48e-56 193 32 8 373 1 gltA Citrate synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
P51035 3.34e-54 179 75 1 111 3 gltA Citrate synthase (Fragment) Bartonella vinsonii subsp. berkhoffii
A0A345BJN4 1.08e-51 182 32 7 362 1 clz17 Citrate synthase-like protein clz17 Cochliobolus lunatus
O34002 9.31e-49 173 30 8 391 1 gltA 2-methylcitrate synthase Antarctic bacterium DS2-3R
Q8NSH7 3.61e-48 172 29 6 380 1 prpC1 2-methylcitrate synthase 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSL1 2.73e-47 169 30 7 362 1 prpC2 2-methylcitrate synthase 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q56063 5.61e-46 166 31 9 363 1 prpC 2-methylcitrate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8EJW2 1.36e-45 165 27 8 378 3 prpC 2-methylcitrate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q937N9 1.55e-45 165 30 7 350 1 prpC 2-methylcitrate synthase Cupriavidus necator
P26491 9.82e-45 162 28 7 374 3 gltA Citrate synthase Mycolicibacterium smegmatis
P31660 1.26e-44 162 30 9 363 1 prpC 2-methylcitrate synthase Escherichia coli (strain K12)
B8MKZ3 1.89e-44 163 28 8 396 1 tstJ Alkylcitrate synthase tstJ Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A348HAY5 1.67e-42 158 27 9 424 1 phiJ Alkylcitrate synthase phiJ Fungal sp. (strain ATCC 74256)
I6Y9Q3 6.92e-39 147 29 7 353 1 prpC 2-methylcitrate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
H8F0D7 6.92e-39 147 29 7 353 1 gltA1 2-methylcitrate synthase Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P9WPD3 6.17e-32 128 27 13 392 1 citA Putative citrate synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD2 6.17e-32 128 27 13 392 3 citA Putative citrate synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63778 6.17e-32 128 27 13 392 1 citA Putative citrate synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q28DK1 9.58e-30 123 29 16 391 2 cs Citrate synthase, mitochondrial Xenopus tropicalis
Q0QHL3 1e-29 123 26 15 403 2 None Probable citrate synthase, mitochondrial Glossina morsitans morsitans
Q54KL0 3.46e-29 121 25 17 429 3 DDB_G0287281 Citrate synthase-related protein DDB_G0287281 Dictyostelium discoideum
Q7ZWZ5 1.32e-27 117 28 16 391 2 cs Citrate synthase, mitochondrial Xenopus laevis
Q9W401 2.6e-27 116 26 16 403 2 Cs1 Probable citrate synthase, mitochondrial Drosophila melanogaster
Q7ZVY5 3.91e-27 116 26 15 388 2 cs Citrate synthase, mitochondrial Danio rerio
P0C1Z2 5.23e-27 115 26 14 390 2 CS Citrate synthase, mitochondrial Macaca fascicularis
Q6S9V6 2.57e-26 114 28 17 389 2 cs Citrate synthase, mitochondrial Xiphias gladius
Q29RK1 2.91e-26 113 26 14 390 1 CS Citrate synthase, mitochondrial Bos taurus
Q16P20 3.02e-26 113 27 19 397 3 AAEL011789 Probable citrate synthase 2, mitochondrial Aedes aegypti
Q17GM7 3.11e-26 113 27 19 397 3 AAEL002956 Probable citrate synthase 1, mitochondrial Aedes aegypti
Q9CZU6 3.33e-26 113 26 14 390 1 Cs Citrate synthase, mitochondrial Mus musculus
Q553V1 3.4e-26 113 25 13 399 3 cs Citrate synthase, mitochondrial Dictyostelium discoideum
Q6S9V8 1.67e-25 111 28 17 389 2 cs Citrate synthase, mitochondrial Thunnus obesus
Q6S9V9 1.67e-25 111 28 17 389 2 cs Citrate synthase, mitochondrial Thunnus albacares
O75390 1.84e-25 111 25 13 401 1 CS Citrate synthase, mitochondrial Homo sapiens
Q6S9V5 1.96e-25 111 28 17 387 2 cs Citrate synthase, mitochondrial Kajikia audax
Q6S9V7 2.59e-25 110 28 17 389 2 cs Citrate synthase, mitochondrial Katsuwonus pelamis
Q8VHF5 2.7e-25 110 25 14 390 1 Cs Citrate synthase, mitochondrial Rattus norvegicus
Q61JF9 5.47e-25 110 26 15 400 3 cts-1 Probable citrate synthase, mitochondrial Caenorhabditis briggsae
P34575 6.37e-25 109 26 15 400 3 cts-1 Probable citrate synthase, mitochondrial Caenorhabditis elegans
P00889 9.11e-25 109 25 14 390 1 CS Citrate synthase, mitochondrial Sus scrofa
Q0GNE0 9.5e-25 109 27 15 402 2 CS Citrate synthase, mitochondrial Iguana iguana
Q4S5X1 1.68e-24 108 27 17 389 3 cs Citrate synthase, mitochondrial Tetraodon nigroviridis
P23007 2.62e-24 107 25 14 390 1 CS Citrate synthase, mitochondrial Gallus gallus
P34085 5.27e-24 107 27 13 351 2 cit-1 Citrate synthase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q0GNE1 7.28e-24 106 26 15 402 2 CS Citrate synthase, mitochondrial Amblyrhynchus cristatus
C7C436 5.91e-23 103 27 18 390 1 mcsA 2-methylcitrate synthase, mitochondrial Gibberella moniliformis
C7C435 2.77e-22 102 26 17 390 1 mcsA 2-methylcitrate synthase, mitochondrial Fusarium solani
Q6C793 5.19e-22 101 25 13 385 1 YALI0E02684g 2-methylcitrate synthase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
P24118 6.43e-22 100 26 16 362 1 None Citrate synthase, mitochondrial Tetrahymena thermophila
P08679 8.41e-22 100 26 14 364 1 CIT2 Citrate synthase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P79024 1.53e-21 100 26 10 348 3 CIT Citrate synthase, mitochondrial Candida tropicalis
O00098 1.98e-21 99 28 16 387 2 citA Citrate synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O80433 3.47e-21 99 24 13 350 2 CS Citrate synthase, mitochondrial Daucus carota
P00890 1.87e-20 96 25 15 387 1 CIT1 Citrate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4QDX3 2.05e-20 96 27 17 362 3 LmjF18.0680 Probable citrate synthase, mitochondrial Leishmania major
P49298 9.79e-20 94 24 15 394 2 CIT Citrate synthase, mitochondrial Citrus maxima
Q9TEM3 1.39e-19 94 26 17 394 1 mcsA 2-methylcitrate synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A4HXU4 1.68e-19 94 30 13 272 3 LinJ18.0690 Probable citrate synthase, mitochondrial Leishmania infantum
Q0QEL7 1.15e-18 87 30 8 221 1 CS Citrate synthase, mitochondrial (Fragment) Mesocricetus auratus
Q10306 2.37e-18 90 26 13 395 3 cit1 Probable citrate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P20115 2.48e-18 90 23 11 348 1 CSY4 Citrate synthase 4, mitochondrial Arabidopsis thaliana
A0A0S3QTD0 3.25e-18 89 25 15 395 1 gltA Citrate synthase Thermosulfidibacter takaii (strain DSM 17441 / JCM 13301 / NBRC 103674 / ABI70S6)
P51044 7.34e-18 89 26 14 353 2 cit-1 Citrate synthase, mitochondrial Aspergillus niger
Q43175 3.09e-17 87 27 9 268 2 None Citrate synthase, mitochondrial Solanum tuberosum
Q9M1D3 8.34e-17 85 23 15 393 1 CSY5 Citrate synthase 5, mitochondrial Arabidopsis thaliana
Q50I20 1.31e-16 85 25 17 394 1 mcsA 2-methylcitrate synthase, mitochondrial Aspergillus fumigatus
B0YD89 1.31e-16 85 25 17 394 1 mcsA 2-methylcitrate synthase, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
P83372 1.7e-16 84 26 10 263 1 MCSI Citrate synthase, mitochondrial Fragaria ananassa
A4H9H8 5.82e-16 83 28 12 272 3 LbrM18_V2.0760 Probable citrate synthase, mitochondrial Leishmania braziliensis
P43635 9.75e-16 82 25 15 399 1 CIT3 Citrate synthase 3, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00500
Feature type CDS
Gene -
Product citrate synthase
Location 105273 - 106559 (strand: -1)
Length 1287 (nucleotides) / 428 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1524
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00285 Citrate synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0372 Energy production and conversion (C) C Citrate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MSNIKAELTINGIKVTDLDVLTPTLGQSVIDVRALGNQGYYTFDPGFTSTASCESKITYIDGDEGILLHRGFPIEELAMKSDYLEVCYILLYGEAPDQKEYDVFKETVKRHTMIHEQITRLFNGFRRDSHPMAVLCGVTGALAAFYHDSLDVNNPRHREIAAYRLLSKMPTVAAMCYKYSTGQPFVYPKNNLSYAGNFLRMMFATPCEEYVVNPVLERAMDRILILHADHEQNASTSTVRTAGSSGANPFACIAAGIASLWGPAHGGANEACLRMLEEIQTVEHIPAFIERAKDKNDSFRLMGFGHRVYKNHDPRAKVMRETCHEVLNELGLNDSLLEVAMELERIALNDPYFIEKKLYPNVDFYSGIILKALGIPSNMFTVIFAIGRTIGWIAHWSEMHDDGIKIARPRQLYTGYTERPFETKVNNR

Flanking regions ( +/- flanking 50bp)

TGAATGAATAAGGGTATAAAACAAATAATAAATGCGCTAAGGAGACCTACATGTCTAATATAAAGGCGGAGCTGACAATTAACGGTATCAAGGTAACTGATCTCGATGTCCTGACTCCTACCCTCGGTCAGTCTGTGATCGACGTCAGGGCGCTGGGCAACCAGGGTTACTATACCTTTGATCCCGGCTTCACCTCCACCGCGTCGTGTGAATCAAAAATTACATATATCGATGGTGATGAAGGTATCCTGTTACACCGCGGCTTCCCGATTGAAGAGCTGGCGATGAAATCTGATTACCTGGAAGTGTGCTATATCCTGCTGTATGGCGAAGCACCTGACCAGAAAGAGTATGACGTATTTAAAGAGACGGTAAAACGTCACACCATGATCCACGAGCAAATAACCCGCTTATTCAACGGGTTCCGCCGTGACTCTCACCCGATGGCCGTTCTGTGTGGTGTTACCGGGGCGCTGGCGGCGTTCTATCATGACTCTCTGGATGTAAACAACCCGCGTCACCGCGAAATTGCCGCTTACCGTCTGCTCTCCAAAATGCCGACTGTTGCTGCAATGTGCTATAAATATTCAACCGGACAGCCGTTTGTTTATCCTAAGAATAATCTCTCCTACGCCGGTAATTTCCTGCGCATGATGTTTGCCACACCTTGTGAAGAGTATGTGGTCAATCCTGTGCTGGAACGCGCAATGGACAGAATTCTTATTCTGCATGCGGATCATGAACAAAATGCATCCACTTCAACAGTACGGACTGCCGGTTCTTCCGGTGCCAACCCGTTTGCCTGTATCGCTGCCGGTATCGCATCCCTCTGGGGACCTGCACACGGCGGGGCAAACGAAGCCTGCCTGCGTATGCTGGAAGAGATCCAGACAGTGGAGCACATTCCTGCCTTTATTGAGCGTGCGAAAGATAAAAATGACTCTTTCCGCCTGATGGGCTTTGGTCACCGCGTGTATAAAAATCATGACCCGCGTGCCAAAGTGATGCGTGAAACCTGCCATGAAGTCCTCAATGAGCTGGGGCTGAATGACAGCCTGCTGGAAGTGGCGATGGAGCTTGAGCGTATCGCACTGAATGACCCGTACTTTATTGAGAAAAAACTCTACCCTAATGTGGATTTCTATTCAGGTATCATTCTGAAAGCACTGGGTATTCCGTCAAATATGTTTACGGTGATTTTTGCTATCGGACGCACCATCGGCTGGATAGCCCACTGGAGCGAGATGCACGACGACGGTATCAAGATCGCCCGTCCGCGTCAGCTCTATACCGGCTACACTGAGCGTCCGTTTGAGACTAAAGTTAACAACCGTTAATAATAGTAACAAGACAAAAATACCCGGTAATAAAACCCTCTCAGGAGGGT