Homologs in group_2086

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15600 FBDBKF_15600 100.0 Morganella morganii S1 yidC membrane protein insertase YidC
NLDBIP_16410 NLDBIP_16410 100.0 Morganella morganii S4 yidC membrane protein insertase YidC
LHKJJB_16395 LHKJJB_16395 100.0 Morganella morganii S3 yidC membrane protein insertase YidC
HKOGLL_16165 HKOGLL_16165 100.0 Morganella morganii S5 yidC membrane protein insertase YidC
F4V73_RS17555 F4V73_RS17555 93.0 Morganella psychrotolerans yidC membrane protein insertase YidC
PMI_RS15485 PMI_RS15485 75.0 Proteus mirabilis HI4320 yidC membrane protein insertase YidC

Distribution of the homologs in the orthogroup group_2086

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2086

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DK98 0.0 821 72 6 547 3 yidC Membrane protein insertase YidC Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6CYR0 0.0 814 72 6 547 3 yidC Membrane protein insertase YidC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8Z9U3 0.0 808 72 5 549 3 yidC Membrane protein insertase YidC Yersinia pestis
C5BF61 0.0 805 71 4 543 3 yidC Membrane protein insertase YidC Edwardsiella ictaluri (strain 93-146)
A8G7P8 0.0 803 71 7 551 3 yidC Membrane protein insertase YidC Serratia proteamaculans (strain 568)
A7MN02 0.0 800 71 4 548 3 yidC Membrane protein insertase YidC Cronobacter sakazakii (strain ATCC BAA-894)
B2VCE6 0.0 798 71 6 552 3 yidC Membrane protein insertase YidC Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WGH2 0.0 786 70 6 552 3 yidC Membrane protein insertase YidC Enterobacter sp. (strain 638)
A8ACL7 0.0 780 69 6 552 3 yidC Membrane protein insertase YidC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0Q2L3 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi C (strain RKS4594)
A9MJT7 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5BIL8 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi A (strain AKU_12601)
A9MX83 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKU2 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5EYX5 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella agona (strain SL483)
Q3YWA8 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Shigella sonnei (strain Ss046)
B5RFY3 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QUQ4 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella enteritidis PT4 (strain P125109)
Q1R4M9 0.0 775 69 5 548 1 yidC Membrane protein insertase YidC Escherichia coli (strain UTI89 / UPEC)
B1LL32 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain SMS-3-5 / SECEC)
B6I3T8 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain SE11)
B7NF23 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IX33 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P65624 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TB02 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHN9 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O1:K1 / APEC
A8A6G7 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O9:H4 (strain HS)
B7M558 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O8 (strain IAI1)
B7N210 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O81 (strain ED1a)
B7NR08 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXA9 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O157:H7 (strain EC4115 / EHEC)
P65625 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O157:H7
B7L849 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain 55989 / EAEC)
B7MGC7 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMH2 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P25714 0.0 775 69 5 548 1 yidC Membrane protein insertase YidC Escherichia coli (strain K12)
B1X9T4 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain K12 / DH10B)
C4ZYY3 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain K12 / MC4100 / BW2952)
Q8ZKY4 0.0 774 69 6 552 3 yidC Membrane protein insertase YidC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TN10 0.0 774 69 6 552 3 yidC Membrane protein insertase YidC Salmonella schwarzengrund (strain CVM19633)
B4SYB1 0.0 773 69 6 552 3 yidC Membrane protein insertase YidC Salmonella newport (strain SL254)
Q329B2 0.0 773 69 5 548 3 yidC Membrane protein insertase YidC Shigella dysenteriae serotype 1 (strain Sd197)
Q31UV9 0.0 773 69 5 548 3 yidC Membrane protein insertase YidC Shigella boydii serotype 4 (strain Sb227)
B2TUS3 0.0 773 69 5 548 3 yidC Membrane protein insertase YidC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK48 0.0 773 69 5 548 3 yidC Membrane protein insertase YidC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P59783 0.0 773 69 5 548 3 yidC Membrane protein insertase YidC Shigella flexneri
Q8Z2N7 0.0 772 69 5 548 3 yidC Membrane protein insertase YidC Salmonella typhi
Q57HZ7 0.0 772 68 6 552 3 yidC Membrane protein insertase YidC Salmonella choleraesuis (strain SC-B67)
B4TAV2 0.0 772 68 6 552 3 yidC Membrane protein insertase YidC Salmonella heidelberg (strain SL476)
B5FN13 0.0 772 68 6 552 3 yidC Membrane protein insertase YidC Salmonella dublin (strain CT_02021853)
A7ZTR1 0.0 771 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O139:H28 (strain E24377A / ETEC)
A6TG08 0.0 757 68 6 548 3 yidC Membrane protein insertase YidC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZP5 0.0 755 68 6 548 3 yidC Membrane protein insertase YidC Klebsiella pneumoniae (strain 342)
Q6LW55 0.0 636 57 6 549 3 yidC Membrane protein insertase YidC Photobacterium profundum (strain SS9)
Q87TR5 0.0 634 57 5 550 3 yidC Membrane protein insertase YidC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N0X9 0.0 631 57 5 550 3 yidC Membrane protein insertase YidC Vibrio campbellii (strain ATCC BAA-1116)
Q65VC2 0.0 628 55 5 551 3 yidC Membrane protein insertase YidC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UD72 0.0 625 55 5 554 3 yidC Membrane protein insertase YidC Haemophilus influenzae (strain PittEE)
P44973 0.0 625 55 5 554 3 yidC Membrane protein insertase YidC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C3LP77 0.0 624 55 7 555 3 yidC Membrane protein insertase YidC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVY4 0.0 624 55 7 555 3 yidC Membrane protein insertase YidC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F484 0.0 624 55 7 555 3 yidC Membrane protein insertase YidC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q4QLR0 0.0 622 54 5 554 3 yidC Membrane protein insertase YidC Haemophilus influenzae (strain 86-028NP)
B3H2D6 0.0 619 54 5 554 3 yidC Membrane protein insertase YidC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B6EP40 0.0 618 56 8 554 3 yidC Membrane protein insertase YidC Aliivibrio salmonicida (strain LFI1238)
B0BR23 0.0 618 54 5 554 3 yidC Membrane protein insertase YidC Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A0KQZ7 0.0 616 53 4 551 3 yidC Membrane protein insertase YidC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6VR61 0.0 613 55 4 548 3 yidC Membrane protein insertase YidC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P29431 0.0 610 56 6 535 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0I0Z1 0.0 608 53 3 550 3 yidC Membrane protein insertase YidC Histophilus somni (strain 129Pt)
B7VGH7 0.0 608 56 7 549 3 yidC Membrane protein insertase YidC Vibrio atlanticus (strain LGP32)
B0URU3 0.0 607 53 3 550 3 yidC Membrane protein insertase YidC Histophilus somni (strain 2336)
B8D8H9 0.0 607 57 6 534 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8D6T3 0.0 606 57 6 534 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
C4LDZ4 0.0 605 54 6 556 3 yidC Membrane protein insertase YidC Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P57131 0.0 605 57 6 534 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9CLQ2 0.0 601 53 3 550 3 yidC Membrane protein insertase YidC Pasteurella multocida (strain Pm70)
A4STS5 0.0 599 52 4 551 3 yidC Membrane protein insertase YidC Aeromonas salmonicida (strain A449)
Q8DDI2 0.0 597 55 5 549 3 yidC Membrane protein insertase YidC Vibrio vulnificus (strain CMCP6)
Q7MQK5 0.0 597 55 5 549 3 yidC Membrane protein insertase YidC Vibrio vulnificus (strain YJ016)
Q7VPM2 0.0 597 54 6 548 3 yidC Membrane protein insertase YidC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8F6M2 0.0 592 52 6 559 3 yidC Membrane protein insertase YidC Glaesserella parasuis serovar 5 (strain SH0165)
Q8D3I8 0.0 573 51 7 541 3 yidC Membrane protein insertase YidC Wigglesworthia glossinidia brevipalpis
A1T0M9 0.0 558 54 5 503 3 yidC Membrane protein insertase YidC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1RQE9 0.0 543 49 7 549 3 yidC Membrane protein insertase YidC Shewanella sp. (strain W3-18-1)
A4YCM2 0.0 543 49 7 549 3 yidC Membrane protein insertase YidC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0TQH1 0.0 542 50 7 553 3 yidC Membrane protein insertase YidC Shewanella halifaxensis (strain HAW-EB4)
A8HAI0 0.0 540 50 7 553 3 yidC Membrane protein insertase YidC Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q0HD64 0.0 540 50 8 550 3 yidC Membrane protein insertase YidC Shewanella sp. (strain MR-4)
Q07VS6 0.0 540 49 8 550 3 yidC Membrane protein insertase YidC Shewanella frigidimarina (strain NCIMB 400)
A0KR32 0.0 539 49 8 550 3 yidC Membrane protein insertase YidC Shewanella sp. (strain ANA-3)
Q3IK55 0.0 539 50 8 555 3 yidC Membrane protein insertase YidC Pseudoalteromonas translucida (strain TAC 125)
Q0HPE6 0.0 538 49 8 550 3 yidC Membrane protein insertase YidC Shewanella sp. (strain MR-7)
A9KX20 0.0 538 49 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS195)
A6WUK4 0.0 538 49 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS185)
A3DAS8 0.0 538 49 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDW5 0.0 538 49 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS223)
Q8EKT6 0.0 535 49 8 551 3 yidC Membrane protein insertase YidC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3QJT1 0.0 535 48 6 550 3 yidC Membrane protein insertase YidC Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q89B34 0.0 531 50 7 528 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A8FP42 0.0 528 48 7 552 3 yidC Membrane protein insertase YidC Shewanella sediminis (strain HAW-EB3)
B8CH68 0.0 527 50 8 551 3 yidC Membrane protein insertase YidC Shewanella piezotolerans (strain WP3 / JCM 13877)
B1KQ65 0.0 526 49 8 553 3 yidC Membrane protein insertase YidC Shewanella woodyi (strain ATCC 51908 / MS32)
Q12HM8 0.0 523 48 7 550 3 yidC Membrane protein insertase YidC Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1S1G5 3.16e-180 521 48 8 551 3 yidC Membrane protein insertase YidC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q15MS7 1.63e-176 511 46 8 556 3 yidC Membrane protein insertase YidC Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A4VS82 2.35e-164 481 44 8 561 3 yidC Membrane protein insertase YidC Stutzerimonas stutzeri (strain A1501)
Q7U351 1.46e-163 479 48 6 558 3 yidC Membrane protein insertase YidC Blochmanniella floridana
C3K1G2 3.09e-163 478 45 8 559 3 yidC Membrane protein insertase YidC Pseudomonas fluorescens (strain SBW25)
Q4K395 4.29e-163 478 44 9 565 3 yidC Membrane protein insertase YidC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1JFV4 8.31e-163 477 45 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain W619)
B0KRC1 2.38e-161 473 44 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain GB-1)
P0A141 1.59e-160 471 44 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida
P0A140 1.59e-160 471 44 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBB7 1.7e-160 471 44 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1I2H4 1.32e-159 469 43 8 562 3 yidC Membrane protein insertase YidC Pseudomonas entomophila (strain L48)
Q3K428 2.43e-159 468 44 8 560 3 yidC Membrane protein insertase YidC Pseudomonas fluorescens (strain Pf0-1)
C1DNF7 1.46e-158 466 44 6 559 3 yidC Membrane protein insertase YidC Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A6W3V1 2.79e-157 462 43 10 560 3 yidC Membrane protein insertase YidC Marinomonas sp. (strain MWYL1)
Q9HT06 5.2e-156 460 42 8 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DE0 5.92e-156 460 42 8 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V7A5 5.92e-156 460 42 8 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain LESB58)
A6VF45 4.08e-155 458 42 9 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain PA7)
A4Y1A0 2.46e-153 454 42 9 585 3 yidC Membrane protein insertase YidC Pseudomonas mendocina (strain ymp)
Q48BF2 3.36e-153 452 42 7 562 3 yidC Membrane protein insertase YidC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZL11 3.51e-153 452 42 7 562 3 yidC Membrane protein insertase YidC Pseudomonas syringae pv. syringae (strain B728a)
Q87TS1 2.1e-152 451 41 7 560 3 yidC Membrane protein insertase YidC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B3PIU1 5.96e-151 446 42 9 559 3 yidC Membrane protein insertase YidC Cellvibrio japonicus (strain Ueda107)
A1U7J4 1.14e-149 444 41 9 567 3 yidC Membrane protein insertase YidC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2S6M5 2.33e-147 438 42 6 508 3 yidC Membrane protein insertase YidC Hahella chejuensis (strain KCTC 2396)
Q3J6L8 6.32e-139 416 40 10 560 3 yidC Membrane protein insertase YidC Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q21DG0 9.64e-138 413 38 10 568 3 yidC Membrane protein insertase YidC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VKU7 4.13e-137 412 38 10 585 3 yidC Membrane protein insertase YidC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B8GRD1 7.95e-137 410 42 12 567 3 yidC Membrane protein insertase YidC Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
C5BKL7 2.8e-136 409 38 10 567 3 yidC Membrane protein insertase YidC Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5X0M2 1.23e-134 405 41 9 550 3 yidC Membrane protein insertase YidC Legionella pneumophila (strain Paris)
A5IIK4 1.64e-134 404 41 9 550 3 yidC Membrane protein insertase YidC Legionella pneumophila (strain Corby)
Q5ZR81 4.08e-134 404 41 9 550 3 yidC Membrane protein insertase YidC Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WSE9 1.06e-133 402 41 9 550 3 yidC Membrane protein insertase YidC Legionella pneumophila (strain Lens)
Q0A4L5 2.71e-133 402 38 9 553 3 yidC Membrane protein insertase YidC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B6J8U7 2.92e-130 394 38 10 564 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain CbuK_Q154)
A9KBT1 3.01e-130 394 38 10 564 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain Dugway 5J108-111)
P45650 4.03e-130 394 38 9 564 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBA5 4.03e-130 394 38 9 564 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J2B4 5.23e-130 393 38 9 564 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain CbuG_Q212)
A9IJB7 3.05e-128 389 41 10 488 3 yidC Membrane protein insertase YidC Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q602M6 6.64e-128 387 40 12 555 3 yidC Membrane protein insertase YidC Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2Y5A8 1.8e-127 387 38 12 580 3 yidC Membrane protein insertase YidC Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2KTI5 5.19e-127 385 40 9 505 3 yidC Membrane protein insertase YidC Bordetella avium (strain 197N)
Q7W2K1 1.25e-126 385 40 11 494 3 yidC Membrane protein insertase YidC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P65622 1.37e-126 384 40 11 494 3 yidC Membrane protein insertase YidC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P65623 1.37e-126 384 40 11 494 3 yidC Membrane protein insertase YidC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5P4P4 7.2e-126 382 37 10 561 3 yidC Membrane protein insertase YidC Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1WWE3 7.44e-126 382 38 10 559 3 yidC Membrane protein insertase YidC Halorhodospira halophila (strain DSM 244 / SL1)
Q477Q4 1.08e-123 377 36 8 560 3 yidC Membrane protein insertase YidC Dechloromonas aromatica (strain RCB)
Q1GXL6 3.1e-122 373 38 9 557 3 yidC Membrane protein insertase YidC Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
O51829 8.27e-121 358 68 0 238 3 yidC Membrane protein insertase YidC (Fragment) Buchnera aphidicola subsp. Myzus persicae
Q2STM0 4.27e-119 365 39 9 488 3 yidC Membrane protein insertase YidC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B0TW73 5.38e-119 365 41 9 512 3 yidC Membrane protein insertase YidC Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2JJR8 7.14e-119 364 36 14 577 3 yidC Membrane protein insertase YidC Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B2T7U1 7.26e-119 364 36 13 562 3 yidC Membrane protein insertase YidC Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A0Q419 3.86e-118 362 39 13 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. novicida (strain U112)
Q13SH4 4.83e-118 362 36 13 562 3 yidC Membrane protein insertase YidC Paraburkholderia xenovorans (strain LB400)
B3R883 5.39e-118 362 40 9 485 3 yidC Membrane protein insertase YidC Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0K5C1 5.88e-118 362 39 8 485 3 yidC Membrane protein insertase YidC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P59810 8.66e-118 363 40 9 490 3 yidC Membrane protein insertase YidC Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2SE60 1.12e-117 361 39 13 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. mediasiatica (strain FSC147)
A4J015 1.25e-117 361 39 13 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NI56 1.25e-117 361 39 13 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JK8 1.25e-117 361 39 13 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BNY1 8.04e-117 359 39 12 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5M8 8.04e-117 359 39 12 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. holarctica (strain LVS)
A7N9L6 8.04e-117 359 39 12 549 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q63YW1 9.89e-117 359 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain K96243)
A3N477 9.89e-117 359 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain 668)
Q3JXI3 9.89e-117 359 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain 1710b)
A3NPX1 9.89e-117 359 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain 1106a)
A1V7D5 1.75e-116 358 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain SAVP1)
Q62EM4 1.75e-116 358 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain ATCC 23344)
A2S8D6 1.75e-116 358 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain NCTC 10229)
A3MS20 1.75e-116 358 39 9 486 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain NCTC 10247)
Q8Y3H6 3.98e-116 357 36 12 562 3 yidC Membrane protein insertase YidC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2U820 1.07e-115 356 39 9 489 3 yidC Membrane protein insertase YidC Ralstonia pickettii (strain 12J)
Q0BAQ2 2.24e-115 355 38 9 504 3 yidC Membrane protein insertase YidC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YQJ7 2.9e-115 355 38 9 504 3 yidC Membrane protein insertase YidC Burkholderia ambifaria (strain MC40-6)
Q39BQ2 1.69e-114 353 39 8 488 3 yidC Membrane protein insertase YidC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1LH91 1.71e-114 353 39 9 513 3 yidC Membrane protein insertase YidC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BSF7 1.04e-113 351 38 8 490 3 yidC Membrane protein insertase YidC Burkholderia orbicola (strain AU 1054)
A0KBN3 1.04e-113 351 38 8 490 3 yidC Membrane protein insertase YidC Burkholderia cenocepacia (strain HI2424)
B4E7D5 1.72e-113 350 38 8 484 3 yidC Membrane protein insertase YidC Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
C1D6H8 2.06e-113 350 37 12 562 3 yidC Membrane protein insertase YidC Laribacter hongkongensis (strain HLHK9)
Q0AE56 3.06e-113 352 39 11 499 3 yidC Membrane protein insertase YidC Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A9ACA0 1.04e-112 348 38 8 482 3 yidC Membrane protein insertase YidC Burkholderia multivorans (strain ATCC 17616 / 249)
B1K0Y4 2.15e-112 348 35 9 560 3 yidC Membrane protein insertase YidC Burkholderia orbicola (strain MC0-3)
A4T0N2 1.7e-111 345 35 7 514 3 yidC Membrane protein insertase YidC Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B4SPG0 2.27e-111 345 36 12 559 3 yidC Membrane protein insertase YidC Stenotrophomonas maltophilia (strain R551-3)
Q46VL6 2.42e-111 345 39 8 485 3 yidC Membrane protein insertase YidC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4JJ46 9.1e-111 343 38 9 482 3 yidC Membrane protein insertase YidC Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2FPA5 2.4e-110 343 37 11 555 3 yidC Membrane protein insertase YidC Stenotrophomonas maltophilia (strain K279a)
Q3SF38 3e-109 339 35 9 564 3 yidC Membrane protein insertase YidC Thiobacillus denitrificans (strain ATCC 25259)
A1AXT7 5.79e-108 336 36 15 558 3 yidC Membrane protein insertase YidC Ruthia magnifica subsp. Calyptogena magnifica
B1XSN7 1.08e-107 335 36 8 525 3 yidC Membrane protein insertase YidC Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q8P338 5.45e-107 334 36 14 571 3 yidC Membrane protein insertase YidC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UNK8 6.9e-107 334 36 13 570 3 yidC Membrane protein insertase YidC Xanthomonas campestris pv. campestris (strain 8004)
A5CVI2 7.21e-107 333 36 14 562 3 yidC Membrane protein insertase YidC Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q3BLZ7 8.33e-107 334 39 10 480 3 yidC Membrane protein insertase YidC Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A6T4D7 2.59e-106 332 34 8 513 3 yidC Membrane protein insertase YidC Janthinobacterium sp. (strain Marseille)
Q8PEH7 8.61e-106 331 36 13 570 3 yidC Membrane protein insertase YidC Xanthomonas axonopodis pv. citri (strain 306)
A9M152 1.05e-105 330 36 11 559 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup C (strain 053442)
B4RJJ2 1.16e-105 330 36 12 559 3 yidC Membrane protein insertase YidC Neisseria gonorrhoeae (strain NCCP11945)
Q9JW48 1.53e-105 330 36 11 559 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F4W6 2.07e-105 329 36 12 559 3 yidC Membrane protein insertase YidC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KRZ8 3.77e-105 328 36 9 552 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JXS4 3.77e-105 328 36 9 552 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7NPT8 1.02e-104 327 35 11 554 3 yidC Membrane protein insertase YidC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9P9U1 1.01e-103 325 35 14 558 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain 9a5c)
B0U6I1 3.38e-103 324 36 14 554 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain M12)
Q879S3 1.03e-101 320 35 13 558 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IAR7 1.03e-101 320 35 13 558 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain M23)
B0RMM6 3.32e-101 319 36 14 573 3 yidC Membrane protein insertase YidC Xanthomonas campestris pv. campestris (strain B100)
A4GAN3 6.15e-99 313 33 8 502 3 yidC Membrane protein insertase YidC Herminiimonas arsenicoxydans
Q5GTT3 2.65e-97 309 35 15 573 3 yidC Membrane protein insertase YidC Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUW0 2.65e-97 309 35 15 573 3 yidC Membrane protein insertase YidC Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NX52 2.52e-95 304 38 12 479 3 yidC Membrane protein insertase YidC Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P22833 1.11e-86 270 58 3 241 3 yidC Membrane protein insertase YidC (Fragment) Proteus mirabilis
A0LE49 2.92e-86 280 32 9 508 3 yidC Membrane protein insertase YidC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A6U5K9 1.02e-84 277 31 18 597 3 yidC Membrane protein insertase YidC Sinorhizobium medicae (strain WSM419)
Q92SF5 3.77e-83 273 31 20 595 3 yidC Membrane protein insertase YidC Rhizobium meliloti (strain 1021)
Q30YQ5 5.9e-83 271 31 14 556 3 yidC Membrane protein insertase YidC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8UIB3 8.24e-82 270 31 16 520 3 yidC Membrane protein insertase YidC Agrobacterium fabrum (strain C58 / ATCC 33970)
B8DP11 5.09e-80 263 31 12 560 3 yidC Membrane protein insertase YidC Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
C4XNJ6 1.5e-79 261 33 14 547 3 yidC Membrane protein insertase YidC Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
C3MF49 6.67e-79 261 32 18 529 3 yidC Membrane protein insertase YidC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B9M7R9 1.87e-78 259 37 7 382 3 yidC Membrane protein insertase YidC Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
C6DYS1 4.49e-78 258 32 9 494 3 yidC Membrane protein insertase YidC Geobacter sp. (strain M21)
B1Z8E7 6.4e-78 259 30 17 565 3 yidC Membrane protein insertase YidC Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B5EGX9 1.47e-76 254 33 10 490 3 yidC Membrane protein insertase YidC Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q746Q2 3.11e-76 253 30 14 559 3 yidC Membrane protein insertase YidC Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
O25989 3.49e-76 253 38 5 332 3 yidC Membrane protein insertase YidC Helicobacter pylori (strain ATCC 700392 / 26695)
A8EXB6 1.3e-75 252 30 16 568 3 yidC Membrane protein insertase YidC Rickettsia canadensis (strain McKiel)
Q0ASI6 1.36e-75 253 29 19 588 3 yidC Membrane protein insertase YidC Maricaulis maris (strain MCS10)
A1AV44 1.54e-75 251 30 11 555 3 yidC Membrane protein insertase YidC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q8FV29 1.55e-75 253 32 15 515 3 yidC Membrane protein insertase YidC Brucella suis biovar 1 (strain 1330)
B1LTW1 2.1e-75 253 31 15 540 3 yidC Membrane protein insertase YidC Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A5G9V4 2.16e-75 251 32 12 524 3 yidC Membrane protein insertase YidC Geotalea uraniireducens (strain Rf4)
Q8YDA3 3e-75 253 32 15 515 3 yidC Membrane protein insertase YidC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B3E3S0 5.17e-75 249 36 8 412 3 yidC Membrane protein insertase YidC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
C3PM83 8.98e-75 250 30 15 546 3 yidC Membrane protein insertase YidC Rickettsia africae (strain ESF-5)
Q9ZJG8 1.05e-74 249 37 5 343 3 yidC Membrane protein insertase YidC Helicobacter pylori (strain J99 / ATCC 700824)
A9W590 1.29e-74 251 30 17 567 3 yidC Membrane protein insertase YidC Methylorubrum extorquens (strain PA1)
B7L2I5 1.38e-74 251 30 17 567 3 yidC Membrane protein insertase YidC Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q1RKM2 3.66e-74 248 29 13 537 3 yidC Membrane protein insertase YidC Rickettsia bellii (strain RML369-C)
A8GUC7 3.66e-74 248 29 13 537 3 yidC Membrane protein insertase YidC Rickettsia bellii (strain OSU 85-389)
P60037 4.11e-74 248 48 0 229 3 yidC Membrane protein insertase YidC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A3PNB1 4.66e-74 249 31 20 601 3 yidC Membrane protein insertase YidC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q92JJ3 5.83e-74 248 30 16 548 3 yidC Membrane protein insertase YidC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UN76 6.08e-74 248 31 17 548 3 yidC Membrane protein insertase YidC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
C6C0J6 7.81e-74 247 30 12 560 3 yidC Membrane protein insertase YidC Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B9KNZ6 8.11e-74 249 31 17 564 3 yidC Membrane protein insertase YidC Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3IYY6 9.09e-74 249 31 20 601 3 yidC Membrane protein insertase YidC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B8IMM9 9.56e-74 248 30 13 540 3 yidC Membrane protein insertase YidC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q68XS4 9.82e-74 247 30 16 540 3 yidC Membrane protein insertase YidC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9PNX7 1e-73 246 47 0 244 3 yidC Membrane protein insertase YidC Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B0BVZ4 1.79e-73 246 30 16 548 3 yidC Membrane protein insertase YidC Rickettsia rickettsii (strain Iowa)
A0LLH3 1.86e-73 246 34 7 421 3 yidC Membrane protein insertase YidC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
C4K168 1.95e-73 246 30 16 548 3 yidC Membrane protein insertase YidC Rickettsia peacockii (strain Rustic)
A1VER7 2e-73 246 32 13 515 3 yidC Membrane protein insertase YidC Nitratidesulfovibrio vulgaris (strain DP4)
Q72D53 2e-73 246 32 13 515 3 yidC Membrane protein insertase YidC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A8GQK8 2.1e-73 246 30 16 548 3 yidC Membrane protein insertase YidC Rickettsia rickettsii (strain Sheila Smith)
B4RDV5 3.86e-73 246 32 15 513 3 yidC Membrane protein insertase YidC Phenylobacterium zucineum (strain HLK1)
Q1MPF3 5.24e-73 244 30 17 563 3 yidC Membrane protein insertase YidC Lawsonia intracellularis (strain PHE/MN1-00)
B9JZK8 5.25e-73 247 29 15 555 3 yidC Membrane protein insertase YidC Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B8EPG5 6e-73 246 30 19 555 3 yidC Membrane protein insertase YidC Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A8GLY9 1.15e-72 244 30 15 543 3 yidC Membrane protein insertase YidC Rickettsia akari (strain Hartford)
B0UHI1 1.49e-72 246 30 13 540 3 yidC Membrane protein insertase YidC Methylobacterium sp. (strain 4-46)
A1B0E4 1.56e-72 246 31 15 531 3 yidC Membrane protein insertase YidC Paracoccus denitrificans (strain Pd 1222)
Q4FNF1 1.59e-72 244 31 12 514 3 yidC Membrane protein insertase YidC Pelagibacter ubique (strain HTCC1062)
A8F0F4 1.92e-72 244 30 16 548 3 yidC Membrane protein insertase YidC Rickettsia massiliae (strain Mtu5)
Q89BQ0 1.93e-72 245 30 16 569 3 yidC Membrane protein insertase YidC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q39PQ8 3.07e-72 243 32 12 484 3 yidC Membrane protein insertase YidC Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1QH68 3.5e-72 244 30 16 545 3 yidC Membrane protein insertase YidC Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q98D88 5.13e-72 244 31 14 522 3 yidC Membrane protein insertase YidC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9ZE97 1.01e-71 242 30 19 569 3 yidC Membrane protein insertase YidC Rickettsia prowazekii (strain Madrid E)
Q2LSF9 1.81e-71 241 33 13 510 3 yidC Membrane protein insertase YidC Syntrophus aciditrophicus (strain SB)
Q0BU78 2.61e-71 241 30 16 539 3 yidC Membrane protein insertase YidC Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q1MM58 2.74e-71 242 28 14 542 3 yidC Membrane protein insertase YidC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1GJX6 2.82e-70 239 31 15 521 3 yidC Membrane protein insertase YidC Ruegeria sp. (strain TM1040)
Q16AA1 8.79e-70 238 30 16 551 3 yidC Membrane protein insertase YidC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q28UQ8 1.2e-69 238 30 18 565 3 yidC Membrane protein insertase YidC Jannaschia sp. (strain CCS1)
A5G0F8 1e-67 232 30 13 524 3 yidC Membrane protein insertase YidC Acidiphilium cryptum (strain JF-5)
B2IDV5 2.07e-66 229 30 16 538 3 yidC Membrane protein insertase YidC Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B3Q040 6.85e-66 227 28 12 522 3 yidC Membrane protein insertase YidC Rhizobium etli (strain CIAT 652)
Q5LW11 1.25e-65 227 29 18 601 3 yidC Membrane protein insertase YidC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B0T872 1.27e-63 222 29 15 552 3 yidC Membrane protein insertase YidC Caulobacter sp. (strain K31)
Q7VJY0 1.06e-62 219 43 1 233 3 yidC Membrane protein insertase YidC Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9RNL5 5.38e-61 214 28 18 571 3 yidC Membrane protein insertase YidC Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B8H1E8 8.7e-60 211 29 22 609 3 yidC Membrane protein insertase YidC Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AA40 8.7e-60 211 29 22 609 3 yidC Membrane protein insertase YidC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A7HIY8 3.05e-57 203 31 7 381 3 yidC Membrane protein insertase YidC Anaeromyxobacter sp. (strain Fw109-5)
Q2IHR0 6.9e-57 202 35 4 299 3 yidC Membrane protein insertase YidC Anaeromyxobacter dehalogenans (strain 2CP-C)
A8LMA0 7.19e-57 203 29 17 544 3 yidC Membrane protein insertase YidC Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B8JDK5 1.13e-56 201 31 8 376 3 yidC Membrane protein insertase YidC Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B4UKG1 2.05e-56 201 35 4 299 3 yidC Membrane protein insertase YidC Anaeromyxobacter sp. (strain K)
B1GZ50 2.84e-52 189 34 3 291 3 yidC Membrane protein insertase YidC Endomicrobium trichonymphae
O66561 3.75e-49 180 37 4 264 3 yidC Membrane protein insertase YidC Aquifex aeolicus (strain VF5)
B4S6X1 6.13e-49 181 29 19 572 3 yidC Membrane protein insertase YidC Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A4SH20 2.09e-48 179 36 9 301 3 yidC Membrane protein insertase YidC Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q8KGG2 1.39e-47 177 26 12 500 3 yidC Membrane protein insertase YidC Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3QYV6 2.49e-47 177 25 21 591 3 yidC Membrane protein insertase YidC Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A1BJZ7 8.08e-47 175 29 19 504 3 yidC Membrane protein insertase YidC Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B3EQF7 2.95e-46 174 34 8 302 3 yidC Membrane protein insertase YidC Chlorobium phaeobacteroides (strain BS1)
B3QLY4 3.13e-46 174 28 15 502 3 yidC Membrane protein insertase YidC Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B3EIM7 7.94e-46 172 33 7 300 3 yidC Membrane protein insertase YidC Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q3B110 8.94e-46 172 35 10 302 3 yidC Membrane protein insertase YidC Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B4SHH0 7.39e-45 170 29 14 407 3 yidC Membrane protein insertase YidC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3ANZ7 5.4e-44 167 30 8 340 3 yidC Membrane protein insertase YidC Chlorobium chlorochromatii (strain CaD3)
A1QZM8 1.08e-41 160 31 13 406 3 yidC Membrane protein insertase YidC Borrelia turicatae (strain 91E135)
B2S0E5 2e-41 159 37 4 230 3 yidC Membrane protein insertase YidC Borrelia hermsii (strain HS1 / DAH)
B5RLZ9 5.51e-40 155 36 4 230 3 yidC Membrane protein insertase YidC Borrelia duttonii (strain Ly)
B5RRP5 9.11e-40 155 36 4 230 3 yidC Membrane protein insertase YidC Borrelia recurrentis (strain A1)
Q9PKE3 3.08e-39 156 35 4 244 3 yidC Membrane protein insertase YidC Chlamydia muridarum (strain MoPn / Nigg)
O51398 2.87e-38 150 38 5 230 3 yidC Membrane protein insertase YidC Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B7J208 3.16e-38 150 38 5 230 3 yidC Membrane protein insertase YidC Borreliella burgdorferi (strain ZS7)
Q661H9 4.63e-38 150 39 6 224 3 yidC Membrane protein insertase YidC Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q0SN67 1.48e-37 149 39 6 224 3 yidC Membrane protein insertase YidC Borreliella afzelii (strain PKo)
A6L9D2 4.71e-37 148 27 20 533 3 yidC Membrane protein insertase YidC Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
O66103 2.07e-36 146 25 16 583 3 yidC Membrane protein insertase YidC Treponema pallidum (strain Nichols)
P59809 8.79e-36 145 34 4 246 3 yidC Membrane protein insertase YidC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q81JH1 1.11e-35 137 36 6 215 3 yidC2 Membrane protein insertase YidC 2 Bacillus anthracis
Q7UFZ2 2.44e-35 144 26 11 442 3 yidC Membrane protein insertase YidC Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q814F4 4.63e-35 135 35 6 215 3 yidC2 Membrane protein insertase YidC 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B3ER28 1.08e-34 141 26 7 321 3 yidC Membrane protein insertase YidC Amoebophilus asiaticus (strain 5a2)
Q7VQ46 1.12e-34 142 34 4 246 3 yidC Membrane protein insertase YidC Chlamydia pneumoniae
Q81XH4 1.14e-34 134 36 7 222 3 yidC1 Membrane protein insertase YidC 1 Bacillus anthracis
O84253 1.2e-34 142 35 4 244 3 yidC Membrane protein insertase YidC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q815V9 4.21e-34 132 36 7 222 3 yidC1 Membrane protein insertase YidC 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q72VY8 6.17e-34 139 38 5 205 3 yidC Membrane protein insertase YidC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P97041 6.53e-34 139 38 5 205 3 yidC Membrane protein insertase YidC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q04XE2 2.45e-33 137 36 5 205 3 yidC Membrane protein insertase YidC Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04W30 2.45e-33 137 36 5 205 3 yidC Membrane protein insertase YidC Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q926Q5 4.6e-32 128 39 5 194 3 yidC2 Membrane protein insertase YidC 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q97CW0 6.37e-32 126 40 4 177 3 yidC Membrane protein insertase YidC Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8R6K6 8.31e-32 125 36 4 202 3 yidC Membrane protein insertase YidC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O87567 9.81e-32 126 38 4 183 3 yidC Membrane protein insertase YidC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8Y3I2 4.11e-31 125 37 6 209 3 yidC2 Membrane protein insertase YidC 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71VQ8 4.11e-31 125 37 6 209 3 yidC1 Membrane protein insertase YidC 1 Listeria monocytogenes serotype 4b (strain F2365)
Q73JM1 6.7e-31 130 25 22 572 3 yidC Membrane protein insertase YidC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q11S04 1.02e-30 129 29 18 438 3 yidC Membrane protein insertase YidC Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q8RHA4 1.6e-30 121 38 3 199 3 yidC Membrane protein insertase YidC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9RCA5 1.65e-30 122 40 5 190 3 yidC1 Membrane protein insertase YidC 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5LC41 1.25e-29 126 23 21 563 3 yidC Membrane protein insertase YidC Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64T26 1.35e-29 126 22 19 560 3 yidC Membrane protein insertase YidC Bacteroides fragilis (strain YCH46)
Q01625 2.81e-29 119 36 6 211 1 misCA Membrane protein insertase MisCA Bacillus subtilis (strain 168)
Q8LBP4 2.27e-28 121 30 7 243 1 ALB3 Inner membrane protein ALBINO3, chloroplastic Arabidopsis thaliana
Q9KDP2 3.81e-28 117 31 8 222 1 yidC2 Membrane protein insertase YidC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8EKU1 1.23e-27 114 33 5 197 3 yidC Membrane protein insertase YidC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8AA76 7.38e-27 118 23 16 508 3 yidC Membrane protein insertase YidC Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q9FY06 1.03e-26 116 30 7 243 2 PPF-1 Inner membrane protein PPF-1, chloroplastic Pisum sativum
A6L5L6 1.41e-26 117 26 13 360 3 yidC Membrane protein insertase YidC Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
P59811 3.18e-26 114 31 7 250 3 yidC Membrane protein insertase YidC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O54569 4.41e-26 114 32 6 219 3 yidC Membrane protein insertase YidC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8XH28 2.35e-25 107 38 3 164 3 yidC Membrane protein insertase YidC Clostridium perfringens (strain 13 / Type A)
Q8LKI3 8.29e-25 110 31 5 210 2 ALB3.2 Inner membrane ALBINO3-like protein 2, chloroplastic Chlamydomonas reinhardtii
Q8CX16 1.06e-24 107 37 5 190 3 yidC1 Membrane protein insertase YidC 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E6W4 1.8e-24 106 37 5 190 3 yidC1 Membrane protein insertase YidC 1 Streptococcus agalactiae serotype III (strain NEM316)
Q9CJ72 3.71e-24 105 31 6 198 3 yidC1 Membrane protein insertase YidC 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q03D58 2.19e-23 103 37 4 190 3 yidC Membrane protein insertase YidC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q9X1H2 5.55e-23 105 33 7 223 1 yidC Membrane protein insertase YidC Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q82YV1 1.56e-22 100 37 7 184 3 yidC Membrane protein insertase YidC Enterococcus faecalis (strain ATCC 700802 / V583)
B6YQF9 3.53e-22 103 23 23 539 3 yidC Membrane protein insertase YidC Azobacteroides pseudotrichonymphae genomovar. CFP2
Q899S4 6.29e-22 97 33 7 209 3 yidC Membrane protein insertase YidC Clostridium tetani (strain Massachusetts / E88)
P60036 1.73e-21 102 22 22 591 3 yidC Membrane protein insertase YidC Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8YRM9 3.27e-21 99 36 3 138 3 yidC Membrane protein insertase YidC Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8S339 6.42e-21 99 26 7 243 3 ALB3.1 Inner membrane ALBINO3-like protein 1, chloroplastic Chlamydomonas reinhardtii
B2RKS0 7.75e-21 99 21 22 591 3 yidC Membrane protein insertase YidC Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q9RSH5 1.53e-19 94 31 6 196 3 yidC Membrane protein insertase YidC Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P0DC87 1.64e-19 92 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC86 1.64e-19 92 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P65631 1.64e-19 92 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M1
Q8P2P8 1.87e-19 92 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDY9 2e-19 92 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q88RX1 3.09e-19 91 33 7 215 3 yidC2 Membrane protein insertase YidC 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9FYL3 5.57e-19 93 27 5 213 1 ALB4 ALBINO3-like protein 1, chloroplastic Arabidopsis thaliana
P54544 1.51e-18 89 30 12 239 1 misCB Membrane protein insertase MisCB Bacillus subtilis (strain 168)
Q8DVX3 2.27e-18 88 35 5 174 3 yidC1 Membrane protein insertase YidC 1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P74155 3e-18 90 38 2 120 1 yidC Membrane protein insertase YidC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q97NI6 3.23e-18 88 31 5 192 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DN93 3.34e-18 88 31 5 192 1 yidC2 Membrane protein insertase YidC 2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q88WR8 1.06e-17 87 30 9 236 3 yidC1 Membrane protein insertase YidC 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A4W485 1.51e-17 86 35 6 174 3 yidC Membrane protein insertase YidC Streptococcus suis (strain 98HAH33)
Q8CMK4 4.37e-17 85 30 9 223 3 yidC2 Membrane protein insertase YidC 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLG6 4.37e-17 85 30 9 223 3 yidC1 Membrane protein insertase YidC 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9L7M1 5.51e-17 85 37 4 110 3 yidC Membrane protein insertase YidC Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WIT5 7.84e-17 85 37 4 110 1 yidC Membrane protein insertase YidC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIT4 7.84e-17 85 37 4 110 3 yidC Membrane protein insertase YidC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65627 7.84e-17 85 37 4 110 3 yidC Membrane protein insertase YidC Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q50205 1.36e-16 85 26 11 271 3 yidC Membrane protein insertase YidC Mycobacterium leprae (strain TN)
Q42191 1.6e-16 85 26 8 290 2 OXA1 Mitochondrial inner membrane protein OXA1 Arabidopsis thaliana
Q83MN6 7.57e-16 82 23 9 258 3 yidC Membrane protein insertase YidC Tropheryma whipplei (strain Twist)
Q8CMK8 9.15e-16 81 29 9 224 3 yidC1 Membrane protein insertase YidC 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMD1 9.59e-16 81 29 9 224 3 yidC2 Membrane protein insertase YidC 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q83N53 1.52e-15 81 23 9 258 3 yidC Membrane protein insertase YidC Tropheryma whipplei (strain TW08/27)
Q92BX6 3.3e-15 79 31 9 203 3 yidC1 Membrane protein insertase YidC 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q71ZU1 3.45e-15 79 31 9 203 3 yidC2 Membrane protein insertase YidC 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y7A9 3.45e-15 79 31 9 203 3 yidC1 Membrane protein insertase YidC 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7V610 3.7e-15 80 35 2 108 3 yidC Membrane protein insertase YidC Prochlorococcus marinus (strain MIT 9313)
Q4L7X2 4.21e-15 79 29 10 214 3 yidC Membrane protein insertase YidC Staphylococcus haemolyticus (strain JCSC1435)
Q8G6J6 1.01e-14 79 33 3 112 3 yidC Membrane protein insertase YidC Bifidobacterium longum (strain NCC 2705)
Q7U522 4.59e-14 77 33 2 108 3 yidC Membrane protein insertase YidC Parasynechococcus marenigrum (strain WH8102)
Q8DL96 4.96e-14 77 29 2 120 3 yidC Membrane protein insertase YidC Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9A1C3 6.61e-14 76 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M1
P0DC89 7.05e-14 76 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC88 7.05e-14 76 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8P2D8 7.59e-14 75 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDQ5 7.59e-14 75 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q7V0R8 4.33e-13 74 31 3 116 3 yidC Membrane protein insertase YidC Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8DSP8 6.55e-13 73 28 8 216 3 yidC2 Membrane protein insertase YidC 2 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q7VB00 5.9e-12 70 31 2 108 3 yidC Membrane protein insertase YidC Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9SKD3 8.52e-12 70 28 7 207 2 OXA1L Mitochondrial inner membrane protein OXA1-like Arabidopsis thaliana
Q9RGS4 9.7e-12 69 34 3 104 3 yidC Membrane protein insertase YidC Staphylococcus carnosus (strain TM300)
O14300 1.26e-11 70 25 5 195 2 oxa101 Mitochondrial inner membrane protein oxa1-1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8BGA9 1.68e-11 70 26 8 205 1 Oxa1l Mitochondrial inner membrane protein OXA1L Mus musculus
Q15070 1.68e-10 67 28 9 206 1 OXA1L Mitochondrial inner membrane protein OXA1L Homo sapiens
O43092 2.07e-10 66 25 4 191 2 oxa102 Mitochondrial inner membrane protein oxa1-2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q49Z38 1.46e-09 62 27 6 163 3 yidC Membrane protein insertase YidC Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DNE1 3.64e-09 62 27 4 155 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P65630 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain MW2)
Q6G7M0 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain MSSA476)
Q6GEY5 4.02e-09 61 28 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain MRSA252)
P65629 4.02e-09 61 29 8 174 1 yidC Membrane protein insertase YidC Staphylococcus aureus (strain N315)
P65628 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIT4 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain Newman)
Q5HEA9 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain COL)
Q2YUI9 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUN6 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain JH9)
Q2FWG4 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF36 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain USA300)
A6U3H6 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain JH1)
A7X4S6 4.02e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain Mu3 / ATCC 700698)
C1CTN0 5.19e-09 61 27 4 155 3 yidC Membrane protein insertase YidC Streptococcus pneumoniae (strain Taiwan19F-14)
Q97NP5 5.19e-09 61 27 4 155 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9CHZ9 7.28e-09 60 28 8 202 3 yidC2 Membrane protein insertase YidC 2 Lactococcus lactis subsp. lactis (strain IL1403)
Q3SYV3 9.72e-09 61 24 6 205 2 OXA1L Mitochondrial inner membrane protein OXA1L Bos taurus
Q8DY84 1.51e-08 60 26 5 172 3 yidC2 Membrane protein insertase YidC 2 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3U9 2.41e-08 59 26 5 172 3 yidC2 Membrane protein insertase YidC 2 Streptococcus agalactiae serotype III (strain NEM316)
P39952 2.99e-08 59 22 7 214 1 OXA1 Mitochondrial inner membrane protein OXA1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8FLS3 2.34e-07 57 33 1 93 3 yidC Membrane protein insertase YidC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8NLK2 2.81e-07 56 29 3 117 3 yidC Membrane protein insertase YidC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O13375 1.17e-06 54 21 7 202 3 OXA1 Mitochondrial inner membrane protein OXA1 Monosporozyma servazzii
Q8VC74 1.57e-06 53 24 7 220 1 Cox18 Cytochrome c oxidase assembly protein COX18, mitochondrial Mus musculus
Q5R7D0 2.3e-06 53 25 9 236 2 COX18 Cytochrome c oxidase assembly protein COX18, mitochondrial Pongo abelii
Q8N8Q8 3.32e-05 49 23 8 235 1 COX18 Cytochrome c oxidase assembly protein COX18, mitochondrial Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_15960
Feature type CDS
Gene yidC
Product membrane protein insertase YidC
Location 49259 - 50881 (strand: 1)
Length 1623 (nucleotides) / 540 (amino acids)

Contig

Accession ZDB_227
Length 79950 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2086
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02096 60Kd inner membrane protein
PF14849 YidC periplasmic domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0706 Cell wall/membrane/envelope biogenesis (M) M Membrane protein insertase Oxa1/YidC/SpoIIIJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03217 YidC/Oxa1 family membrane protein insertase Quorum sensing
Protein export
Bacterial secretion system
-

Protein Sequence

MDSQRNLLFIALLLVSFFAWQTWESDKTQALNAATQATQQTTTPSGESSGQNKYITVKTDVLSLNINLRGGDIDEADLLAYPATLKSADPFRLLETTPEFAYQAISGLTGVNGPDNPNNYKDRPLYTTESDTFVLAEGQDELRVPLTFVLDGVTYVKTYTLKRKDYAISVDYTIKNDTSAPLEMAFFGQLKQSVNLPERLNNGSSNFALHTYRGAAYSSEDTNYKKYSFSDIEDKPLNINTNVGWVAMLQQYFATAWVPEKGTTNNFYTLYSAKTGDAFIGYKSDAIRIGANSEAKYNATLWVGPELQNEMEAVAPHLDLTVDYGWLWFISQPLFKLLKFIHSFIGNWGFSIIVITFIVRGIMYPLTRAQYTSMAKMRMLQPKLKAMRERIGDDKQRMSQEMMALYKEEKVNPLGGCLPLIIQMPIFLALYYMLMGSVELRHAPFIGWIHDLSAQDPYYILPILMGATMFVIQKLSPTAVTDPLQQKIFTFMPVIFTVFFLWFPSGLVLYYIVSNLVTILQQQIIYRGLEKRGLHSRDKK

Flanking regions ( +/- flanking 50bp)

GGTGATGATCCTGTCCCACCTAAAAATGATGATAACAGAGAACATTAACGATGGATTCGCAACGTAATCTTCTATTCATCGCTTTGCTACTCGTATCCTTCTTTGCATGGCAGACGTGGGAAAGTGATAAGACACAAGCACTTAACGCGGCTACTCAGGCAACGCAGCAGACGACAACGCCAAGTGGTGAAAGCAGCGGGCAGAACAAATATATTACGGTCAAAACAGATGTGCTGTCACTGAACATCAATCTGCGCGGCGGTGATATTGATGAAGCTGACCTTTTGGCTTACCCGGCAACCTTAAAATCCGCAGATCCGTTCCGTTTACTGGAAACAACACCTGAATTTGCCTACCAGGCAATCAGTGGTTTAACCGGTGTGAATGGTCCGGATAACCCGAATAATTACAAAGATCGCCCGCTGTATACCACTGAAAGCGATACATTTGTGCTGGCGGAAGGCCAGGATGAACTGCGTGTTCCTCTGACTTTCGTTCTGGATGGTGTCACGTATGTGAAAACCTATACCCTGAAGCGCAAAGACTATGCCATCAGTGTTGATTACACCATCAAAAACGACACCTCAGCTCCGCTGGAAATGGCGTTTTTCGGTCAGTTAAAACAATCTGTGAATTTACCGGAACGTCTTAACAACGGCAGCAGCAACTTTGCGCTGCATACCTACCGTGGTGCGGCGTACTCGTCTGAAGACACTAACTACAAAAAATACAGCTTCAGTGATATCGAAGATAAGCCACTGAACATCAACACCAATGTTGGCTGGGTGGCGATGTTACAGCAGTATTTTGCGACAGCGTGGGTTCCTGAGAAAGGCACCACCAATAACTTCTATACGCTGTACAGTGCCAAAACCGGCGATGCATTCATCGGTTATAAGAGTGATGCAATCCGTATCGGGGCAAACAGCGAAGCGAAATATAACGCAACACTGTGGGTCGGACCGGAACTGCAGAACGAAATGGAAGCCGTGGCACCGCATCTGGACTTAACCGTTGATTACGGCTGGTTATGGTTCATTTCTCAGCCGCTGTTCAAGTTACTGAAGTTTATCCACAGCTTCATCGGTAACTGGGGCTTCTCCATCATCGTTATCACCTTTATCGTCCGCGGTATCATGTATCCGCTGACCCGTGCGCAATACACCTCTATGGCGAAAATGCGTATGCTTCAGCCGAAGCTGAAAGCAATGCGTGAGCGCATCGGTGATGATAAACAGCGCATGAGTCAGGAAATGATGGCGCTGTACAAAGAAGAGAAAGTGAACCCGCTGGGTGGCTGCTTACCGCTGATTATCCAGATGCCTATCTTCCTGGCACTGTATTACATGCTGATGGGCTCAGTGGAACTGCGTCACGCGCCGTTTATCGGCTGGATCCATGACTTATCCGCACAGGATCCGTACTACATCCTGCCGATTCTGATGGGTGCAACGATGTTTGTGATCCAGAAACTGTCTCCGACAGCGGTCACCGACCCGTTACAGCAGAAGATTTTCACCTTTATGCCGGTTATCTTCACAGTCTTCTTCCTGTGGTTCCCGTCAGGTCTGGTGCTGTACTATATCGTCAGTAACCTGGTGACTATCCTCCAGCAGCAGATTATCTATCGCGGCCTGGAAAAACGCGGTCTTCACAGCCGCGACAAAAAATAAGCCCGTGACCGGCGGGGAATCTCTGCCGGTCTTATAGTATTATTTAAAGG