Homologs in group_2086

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15600 FBDBKF_15600 93.0 Morganella morganii S1 yidC membrane protein insertase YidC
EHELCC_15960 EHELCC_15960 93.0 Morganella morganii S2 yidC membrane protein insertase YidC
NLDBIP_16410 NLDBIP_16410 93.0 Morganella morganii S4 yidC membrane protein insertase YidC
LHKJJB_16395 LHKJJB_16395 93.0 Morganella morganii S3 yidC membrane protein insertase YidC
HKOGLL_16165 HKOGLL_16165 93.0 Morganella morganii S5 yidC membrane protein insertase YidC
PMI_RS15485 PMI_RS15485 75.2 Proteus mirabilis HI4320 yidC membrane protein insertase YidC

Distribution of the homologs in the orthogroup group_2086

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2086

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DK98 0.0 820 72 6 547 3 yidC Membrane protein insertase YidC Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6CYR0 0.0 816 72 6 547 3 yidC Membrane protein insertase YidC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C5BF61 0.0 808 71 4 543 3 yidC Membrane protein insertase YidC Edwardsiella ictaluri (strain 93-146)
Q8Z9U3 0.0 803 71 4 547 3 yidC Membrane protein insertase YidC Yersinia pestis
A8G7P8 0.0 803 70 7 551 3 yidC Membrane protein insertase YidC Serratia proteamaculans (strain 568)
B2VCE6 0.0 802 71 6 552 3 yidC Membrane protein insertase YidC Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WGH2 0.0 790 71 6 552 3 yidC Membrane protein insertase YidC Enterobacter sp. (strain 638)
A7MN02 0.0 784 70 4 548 3 yidC Membrane protein insertase YidC Cronobacter sakazakii (strain ATCC BAA-894)
A8ACL7 0.0 781 69 6 552 3 yidC Membrane protein insertase YidC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3YWA8 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Shigella sonnei (strain Ss046)
Q1R4M9 0.0 778 70 5 548 1 yidC Membrane protein insertase YidC Escherichia coli (strain UTI89 / UPEC)
B1LL32 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain SMS-3-5 / SECEC)
B6I3T8 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain SE11)
B7NF23 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P25714 0.0 778 70 5 548 1 yidC Membrane protein insertase YidC Escherichia coli (strain K12)
B1IX33 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P65624 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TB02 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHN9 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O1:K1 / APEC
A8A6G7 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O9:H4 (strain HS)
B1X9T4 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain K12 / DH10B)
C4ZYY3 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain K12 / MC4100 / BW2952)
B7M558 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O8 (strain IAI1)
B7N210 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O81 (strain ED1a)
B7NR08 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXA9 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O157:H7 (strain EC4115 / EHEC)
P65625 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O157:H7
B7L849 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli (strain 55989 / EAEC)
B7MGC7 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMH2 0.0 778 70 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
C0Q2L3 0.0 777 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi C (strain RKS4594)
B5RFY3 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QUQ4 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella enteritidis PT4 (strain P125109)
B7LK48 0.0 776 70 5 548 3 yidC Membrane protein insertase YidC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P59783 0.0 776 69 5 548 3 yidC Membrane protein insertase YidC Shigella flexneri
Q31UV9 0.0 776 69 5 548 3 yidC Membrane protein insertase YidC Shigella boydii serotype 4 (strain Sb227)
B2TUS3 0.0 776 69 5 548 3 yidC Membrane protein insertase YidC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5BIL8 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi A (strain AKU_12601)
A9MX83 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKU2 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5EYX5 0.0 776 69 6 552 3 yidC Membrane protein insertase YidC Salmonella agona (strain SL483)
Q329B2 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Shigella dysenteriae serotype 1 (strain Sd197)
A9MJT7 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TN10 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella schwarzengrund (strain CVM19633)
Q8ZKY4 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SYB1 0.0 775 69 6 552 3 yidC Membrane protein insertase YidC Salmonella newport (strain SL254)
A7ZTR1 0.0 775 69 5 548 3 yidC Membrane protein insertase YidC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q57HZ7 0.0 773 68 6 552 3 yidC Membrane protein insertase YidC Salmonella choleraesuis (strain SC-B67)
Q8Z2N7 0.0 773 69 5 548 3 yidC Membrane protein insertase YidC Salmonella typhi
B4TAV2 0.0 773 68 6 552 3 yidC Membrane protein insertase YidC Salmonella heidelberg (strain SL476)
B5FN13 0.0 772 68 6 552 3 yidC Membrane protein insertase YidC Salmonella dublin (strain CT_02021853)
A6TG08 0.0 759 68 6 548 3 yidC Membrane protein insertase YidC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZP5 0.0 757 68 6 548 3 yidC Membrane protein insertase YidC Klebsiella pneumoniae (strain 342)
Q6LW55 0.0 634 57 6 549 3 yidC Membrane protein insertase YidC Photobacterium profundum (strain SS9)
A5UD72 0.0 633 55 4 550 3 yidC Membrane protein insertase YidC Haemophilus influenzae (strain PittEE)
P44973 0.0 630 54 4 550 3 yidC Membrane protein insertase YidC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLR0 0.0 629 54 4 550 3 yidC Membrane protein insertase YidC Haemophilus influenzae (strain 86-028NP)
Q87TR5 0.0 628 57 6 550 3 yidC Membrane protein insertase YidC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N0X9 0.0 628 57 6 550 3 yidC Membrane protein insertase YidC Vibrio campbellii (strain ATCC BAA-1116)
A0KQZ7 0.0 624 54 4 551 3 yidC Membrane protein insertase YidC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B3H2D6 0.0 621 54 6 554 3 yidC Membrane protein insertase YidC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q65VC2 0.0 620 54 5 551 3 yidC Membrane protein insertase YidC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0BR23 0.0 619 54 6 554 3 yidC Membrane protein insertase YidC Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
C3LP77 0.0 616 54 7 555 3 yidC Membrane protein insertase YidC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVY4 0.0 616 54 7 555 3 yidC Membrane protein insertase YidC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F484 0.0 616 54 7 555 3 yidC Membrane protein insertase YidC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VR61 0.0 616 55 4 548 3 yidC Membrane protein insertase YidC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4LDZ4 0.0 615 55 7 556 3 yidC Membrane protein insertase YidC Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B6EP40 0.0 611 55 9 554 3 yidC Membrane protein insertase YidC Aliivibrio salmonicida (strain LFI1238)
A4STS5 0.0 610 53 6 551 3 yidC Membrane protein insertase YidC Aeromonas salmonicida (strain A449)
Q0I0Z1 0.0 609 53 3 550 3 yidC Membrane protein insertase YidC Histophilus somni (strain 129Pt)
B0URU3 0.0 608 53 3 550 3 yidC Membrane protein insertase YidC Histophilus somni (strain 2336)
B7VGH7 0.0 605 56 7 549 3 yidC Membrane protein insertase YidC Vibrio atlanticus (strain LGP32)
Q9CLQ2 0.0 602 53 3 550 3 yidC Membrane protein insertase YidC Pasteurella multocida (strain Pm70)
Q7VPM2 0.0 602 54 6 548 3 yidC Membrane protein insertase YidC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P29431 0.0 601 55 6 535 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B8F6M2 0.0 599 53 5 557 3 yidC Membrane protein insertase YidC Glaesserella parasuis serovar 5 (strain SH0165)
B8D6T3 0.0 598 56 6 534 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8H9 0.0 598 56 6 534 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57131 0.0 597 55 6 534 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q7MQK5 0.0 590 55 6 549 3 yidC Membrane protein insertase YidC Vibrio vulnificus (strain YJ016)
Q8DDI2 0.0 590 54 6 549 3 yidC Membrane protein insertase YidC Vibrio vulnificus (strain CMCP6)
Q8D3I8 0.0 578 51 7 541 3 yidC Membrane protein insertase YidC Wigglesworthia glossinidia brevipalpis
A1T0M9 0.0 551 53 7 510 3 yidC Membrane protein insertase YidC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1RQE9 0.0 542 49 7 549 3 yidC Membrane protein insertase YidC Shewanella sp. (strain W3-18-1)
A4YCM2 0.0 542 49 7 549 3 yidC Membrane protein insertase YidC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q07VS6 0.0 540 49 8 550 3 yidC Membrane protein insertase YidC Shewanella frigidimarina (strain NCIMB 400)
Q0HPE6 0.0 539 49 7 550 3 yidC Membrane protein insertase YidC Shewanella sp. (strain MR-7)
Q8EKT6 0.0 538 49 7 551 3 yidC Membrane protein insertase YidC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HD64 0.0 537 49 7 550 3 yidC Membrane protein insertase YidC Shewanella sp. (strain MR-4)
A0KR32 0.0 536 49 7 550 3 yidC Membrane protein insertase YidC Shewanella sp. (strain ANA-3)
A9KX20 0.0 536 48 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS195)
A6WUK4 0.0 535 48 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS185)
A3DAS8 0.0 535 48 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDW5 0.0 535 48 7 549 3 yidC Membrane protein insertase YidC Shewanella baltica (strain OS223)
A3QJT1 0.0 533 48 6 550 3 yidC Membrane protein insertase YidC Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0TQH1 0.0 532 48 7 553 3 yidC Membrane protein insertase YidC Shewanella halifaxensis (strain HAW-EB4)
A8HAI0 0.0 531 49 7 553 3 yidC Membrane protein insertase YidC Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q89B34 0.0 530 50 7 528 3 yidC Membrane protein insertase YidC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A8FP42 0.0 528 48 7 552 3 yidC Membrane protein insertase YidC Shewanella sediminis (strain HAW-EB3)
Q3IK55 0.0 528 49 8 555 3 yidC Membrane protein insertase YidC Pseudoalteromonas translucida (strain TAC 125)
B8CH68 0.0 526 49 8 551 3 yidC Membrane protein insertase YidC Shewanella piezotolerans (strain WP3 / JCM 13877)
B1KQ65 0.0 523 48 8 553 3 yidC Membrane protein insertase YidC Shewanella woodyi (strain ATCC 51908 / MS32)
A1S1G5 1.14e-180 522 49 8 550 3 yidC Membrane protein insertase YidC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q12HM8 1.13e-179 519 47 7 550 3 yidC Membrane protein insertase YidC Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q15MS7 1.04e-177 514 46 8 556 3 yidC Membrane protein insertase YidC Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7U351 7.05e-164 480 48 6 558 3 yidC Membrane protein insertase YidC Blochmanniella floridana
B1JFV4 9.57e-163 477 45 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain W619)
A4VS82 7.95e-162 474 43 7 559 3 yidC Membrane protein insertase YidC Stutzerimonas stutzeri (strain A1501)
P0A141 8.68e-162 474 45 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida
P0A140 8.68e-162 474 45 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBB7 9.16e-162 474 45 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KRC1 4.77e-161 473 45 8 560 3 yidC Membrane protein insertase YidC Pseudomonas putida (strain GB-1)
Q4K395 1.49e-160 471 44 9 565 3 yidC Membrane protein insertase YidC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C3K1G2 6.26e-160 470 45 8 559 3 yidC Membrane protein insertase YidC Pseudomonas fluorescens (strain SBW25)
Q1I2H4 2.09e-159 468 44 9 561 3 yidC Membrane protein insertase YidC Pseudomonas entomophila (strain L48)
C1DNF7 2.74e-158 465 43 6 559 3 yidC Membrane protein insertase YidC Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A6W3V1 1.6e-156 461 43 10 560 3 yidC Membrane protein insertase YidC Marinomonas sp. (strain MWYL1)
Q3K428 1.33e-155 459 43 8 559 3 yidC Membrane protein insertase YidC Pseudomonas fluorescens (strain Pf0-1)
A6VF45 1.83e-155 459 42 9 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain PA7)
Q9HT06 4.6e-155 458 42 8 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DE0 5.07e-155 458 42 8 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V7A5 5.07e-155 458 42 8 579 3 yidC Membrane protein insertase YidC Pseudomonas aeruginosa (strain LESB58)
Q4ZL11 9.15e-154 454 42 7 562 3 yidC Membrane protein insertase YidC Pseudomonas syringae pv. syringae (strain B728a)
Q48BF2 1.02e-153 454 42 7 562 3 yidC Membrane protein insertase YidC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87TS1 1.72e-153 453 42 7 560 3 yidC Membrane protein insertase YidC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4Y1A0 3.42e-152 451 42 9 585 3 yidC Membrane protein insertase YidC Pseudomonas mendocina (strain ymp)
A1U7J4 4.73e-152 450 42 9 567 3 yidC Membrane protein insertase YidC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B3PIU1 3.25e-151 447 42 8 556 3 yidC Membrane protein insertase YidC Cellvibrio japonicus (strain Ueda107)
Q2S6M5 1.22e-146 436 42 8 519 3 yidC Membrane protein insertase YidC Hahella chejuensis (strain KCTC 2396)
Q3J6L8 6.45e-142 423 40 10 560 3 yidC Membrane protein insertase YidC Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q21DG0 8.18e-139 416 38 10 568 3 yidC Membrane protein insertase YidC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C5BKL7 5.71e-138 414 38 9 567 3 yidC Membrane protein insertase YidC Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q0VKU7 5.64e-135 407 37 11 587 3 yidC Membrane protein insertase YidC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B8GRD1 2.56e-134 404 41 10 564 3 yidC Membrane protein insertase YidC Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q5X0M2 2.09e-133 402 41 12 551 3 yidC Membrane protein insertase YidC Legionella pneumophila (strain Paris)
Q0A4L5 4.45e-133 401 38 9 553 3 yidC Membrane protein insertase YidC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5ZR81 5.06e-133 400 41 12 551 3 yidC Membrane protein insertase YidC Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IIK4 8.23e-133 400 41 12 551 3 yidC Membrane protein insertase YidC Legionella pneumophila (strain Corby)
Q5WSE9 5.4e-132 398 40 12 551 3 yidC Membrane protein insertase YidC Legionella pneumophila (strain Lens)
B6J8U7 7.44e-129 390 38 10 567 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain CbuK_Q154)
A9KBT1 8.03e-129 390 38 10 567 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain Dugway 5J108-111)
B6J2B4 1.77e-126 384 37 9 567 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain CbuG_Q212)
P45650 1.87e-126 384 37 9 567 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBA5 1.87e-126 384 37 9 567 3 yidC Membrane protein insertase YidC Coxiella burnetii (strain RSA 331 / Henzerling II)
Q2Y5A8 2.48e-126 384 38 12 580 3 yidC Membrane protein insertase YidC Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5P4P4 8.29e-126 382 36 10 561 3 yidC Membrane protein insertase YidC Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1WWE3 2.1e-125 381 38 10 559 3 yidC Membrane protein insertase YidC Halorhodospira halophila (strain DSM 244 / SL1)
Q602M6 5.41e-125 380 39 11 552 3 yidC Membrane protein insertase YidC Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q477Q4 1.77e-124 379 35 8 560 3 yidC Membrane protein insertase YidC Dechloromonas aromatica (strain RCB)
Q7W2K1 1.31e-123 377 39 11 494 3 yidC Membrane protein insertase YidC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P65622 1.48e-123 377 39 11 494 3 yidC Membrane protein insertase YidC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P65623 1.48e-123 377 39 11 494 3 yidC Membrane protein insertase YidC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9IJB7 1.79e-123 376 40 11 488 3 yidC Membrane protein insertase YidC Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2KTI5 2.69e-121 371 39 9 505 3 yidC Membrane protein insertase YidC Bordetella avium (strain 197N)
Q1GXL6 1.07e-118 364 37 8 556 3 yidC Membrane protein insertase YidC Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B2JJR8 1.12e-118 363 35 13 574 3 yidC Membrane protein insertase YidC Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
O51829 1.22e-118 352 68 0 232 3 yidC Membrane protein insertase YidC (Fragment) Buchnera aphidicola subsp. Myzus persicae
B3R883 7.14e-118 362 40 10 485 3 yidC Membrane protein insertase YidC Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q2STM0 7.74e-118 362 39 9 485 3 yidC Membrane protein insertase YidC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0K5C1 9.24e-118 362 40 10 485 3 yidC Membrane protein insertase YidC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q63YW1 1.62e-117 361 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain K96243)
A3N477 1.62e-117 361 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain 668)
Q3JXI3 1.62e-117 361 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain 1710b)
A3NPX1 1.62e-117 361 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia pseudomallei (strain 1106a)
Q8Y3H6 2.2e-117 360 37 13 562 3 yidC Membrane protein insertase YidC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q13SH4 2.48e-117 360 35 13 563 3 yidC Membrane protein insertase YidC Paraburkholderia xenovorans (strain LB400)
A1V7D5 3.56e-117 360 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain SAVP1)
Q62EM4 3.56e-117 360 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain ATCC 23344)
A2S8D6 3.56e-117 360 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain NCTC 10229)
A3MS20 3.56e-117 360 39 8 484 3 yidC Membrane protein insertase YidC Burkholderia mallei (strain NCTC 10247)
B2T7U1 2.62e-116 358 35 13 565 3 yidC Membrane protein insertase YidC Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
P59810 5.47e-116 359 39 11 488 3 yidC Membrane protein insertase YidC Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B0TW73 9.06e-116 356 39 10 517 3 yidC Membrane protein insertase YidC Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2U820 3.92e-115 355 39 10 491 3 yidC Membrane protein insertase YidC Ralstonia pickettii (strain 12J)
A0Q419 1.76e-113 350 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. novicida (strain U112)
Q0BAQ2 1.99e-113 350 38 12 504 3 yidC Membrane protein insertase YidC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YQJ7 2.34e-113 350 38 12 504 3 yidC Membrane protein insertase YidC Burkholderia ambifaria (strain MC40-6)
A4J015 2.52e-113 350 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NI56 2.52e-113 350 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JK8 2.52e-113 350 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. tularensis (strain FSC 198)
B2SE60 3.87e-113 349 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. mediasiatica (strain FSC147)
Q1LH91 4.84e-113 349 40 9 485 3 yidC Membrane protein insertase YidC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0BNY1 1.07e-112 348 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5M8 1.07e-112 348 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. holarctica (strain LVS)
A7N9L6 1.07e-112 348 37 13 554 3 yidC Membrane protein insertase YidC Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
C1D6H8 1.38e-112 348 37 11 559 3 yidC Membrane protein insertase YidC Laribacter hongkongensis (strain HLHK9)
Q0AE56 7.31e-112 348 38 9 495 3 yidC Membrane protein insertase YidC Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q39BQ2 9.2e-112 346 38 10 489 3 yidC Membrane protein insertase YidC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BSF7 1.93e-111 345 38 10 490 3 yidC Membrane protein insertase YidC Burkholderia orbicola (strain AU 1054)
A0KBN3 1.93e-111 345 38 10 490 3 yidC Membrane protein insertase YidC Burkholderia cenocepacia (strain HI2424)
A9ACA0 5.39e-111 344 38 11 486 3 yidC Membrane protein insertase YidC Burkholderia multivorans (strain ATCC 17616 / 249)
B4E7D5 9.36e-111 343 38 11 486 3 yidC Membrane protein insertase YidC Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1K0Y4 9.63e-111 343 38 11 486 3 yidC Membrane protein insertase YidC Burkholderia orbicola (strain MC0-3)
Q3BLZ7 1.42e-110 343 40 11 480 3 yidC Membrane protein insertase YidC Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q46VL6 3.33e-110 342 40 10 485 3 yidC Membrane protein insertase YidC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8PEH7 6.66e-110 342 36 13 570 3 yidC Membrane protein insertase YidC Xanthomonas axonopodis pv. citri (strain 306)
A4T0N2 1.09e-109 341 35 7 513 3 yidC Membrane protein insertase YidC Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B4SPG0 1.71e-109 341 36 14 561 3 yidC Membrane protein insertase YidC Stenotrophomonas maltophilia (strain R551-3)
Q8P338 3.38e-109 340 36 15 571 3 yidC Membrane protein insertase YidC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UNK8 4.19e-109 340 36 15 571 3 yidC Membrane protein insertase YidC Xanthomonas campestris pv. campestris (strain 8004)
B2FPA5 2.04e-108 338 37 13 557 3 yidC Membrane protein insertase YidC Stenotrophomonas maltophilia (strain K279a)
A4JJ46 6.64e-108 336 38 12 486 3 yidC Membrane protein insertase YidC Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1AXT7 1.46e-107 335 35 15 563 3 yidC Membrane protein insertase YidC Ruthia magnifica subsp. Calyptogena magnifica
Q3SF38 2.25e-107 334 35 11 563 3 yidC Membrane protein insertase YidC Thiobacillus denitrificans (strain ATCC 25259)
A5CVI2 2.77e-107 334 36 13 562 3 yidC Membrane protein insertase YidC Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B1XSN7 4.99e-107 334 35 7 522 3 yidC Membrane protein insertase YidC Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q9P9U1 7.04e-107 334 36 13 557 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain 9a5c)
B0U6I1 1.68e-106 333 36 13 553 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain M12)
Q7NPT8 2.29e-106 332 36 12 556 3 yidC Membrane protein insertase YidC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B4RJJ2 1.67e-105 330 36 10 555 3 yidC Membrane protein insertase YidC Neisseria gonorrhoeae (strain NCCP11945)
A9M152 2.27e-105 329 36 9 555 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup C (strain 053442)
Q5F4W6 3.04e-105 329 36 10 555 3 yidC Membrane protein insertase YidC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A6T4D7 3.73e-105 329 34 9 513 3 yidC Membrane protein insertase YidC Janthinobacterium sp. (strain Marseille)
A1KRZ8 4.77e-105 328 35 9 553 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JXS4 4.77e-105 328 35 9 553 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW48 5.03e-105 328 36 9 555 3 yidC Membrane protein insertase YidC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q879S3 4.71e-104 327 35 12 557 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IAR7 4.71e-104 327 35 12 557 3 yidC Membrane protein insertase YidC Xylella fastidiosa (strain M23)
B0RMM6 3.16e-103 325 36 15 575 3 yidC Membrane protein insertase YidC Xanthomonas campestris pv. campestris (strain B100)
Q5GTT3 2.75e-101 320 35 12 571 3 yidC Membrane protein insertase YidC Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUW0 2.75e-101 320 35 12 571 3 yidC Membrane protein insertase YidC Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NX52 1.69e-99 315 39 9 473 3 yidC Membrane protein insertase YidC Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4GAN3 2.17e-98 312 33 8 502 3 yidC Membrane protein insertase YidC Herminiimonas arsenicoxydans
P22833 8.66e-89 276 59 3 241 3 yidC Membrane protein insertase YidC (Fragment) Proteus mirabilis
B1Z8E7 4.29e-84 276 32 15 537 3 yidC Membrane protein insertase YidC Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A6U5K9 2.52e-83 273 30 16 589 3 yidC Membrane protein insertase YidC Sinorhizobium medicae (strain WSM419)
A0LE49 2.81e-83 272 32 13 513 3 yidC Membrane protein insertase YidC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q92SF5 1.24e-80 266 31 20 588 3 yidC Membrane protein insertase YidC Rhizobium meliloti (strain 1021)
B7L2I5 2.71e-80 266 31 15 539 3 yidC Membrane protein insertase YidC Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A9W590 3.31e-80 266 31 15 539 3 yidC Membrane protein insertase YidC Methylorubrum extorquens (strain PA1)
C3MF49 6.93e-80 264 33 17 524 3 yidC Membrane protein insertase YidC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
C4XNJ6 1.11e-79 262 32 11 551 3 yidC Membrane protein insertase YidC Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q8FV29 9.79e-79 261 32 14 518 3 yidC Membrane protein insertase YidC Brucella suis biovar 1 (strain 1330)
Q8UIB3 1.96e-78 261 31 16 519 3 yidC Membrane protein insertase YidC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0ASI6 3.71e-78 259 31 20 589 3 yidC Membrane protein insertase YidC Maricaulis maris (strain MCS10)
Q30YQ5 4e-78 258 30 14 555 3 yidC Membrane protein insertase YidC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8YDA3 4.26e-78 260 32 15 519 3 yidC Membrane protein insertase YidC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A0LLH3 1.04e-77 257 34 8 423 3 yidC Membrane protein insertase YidC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B5EGX9 1.1e-77 257 34 12 485 3 yidC Membrane protein insertase YidC Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B9M7R9 1.75e-77 256 32 11 513 3 yidC Membrane protein insertase YidC Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B8DP11 3.64e-77 256 31 13 562 3 yidC Membrane protein insertase YidC Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
C6DYS1 7e-77 255 36 8 411 3 yidC Membrane protein insertase YidC Geobacter sp. (strain M21)
A8EXB6 3.71e-76 253 30 16 549 3 yidC Membrane protein insertase YidC Rickettsia canadensis (strain McKiel)
B1LTW1 6.76e-76 254 31 13 536 3 yidC Membrane protein insertase YidC Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B4RDV5 1.11e-75 253 32 17 513 3 yidC Membrane protein insertase YidC Phenylobacterium zucineum (strain HLK1)
Q89BQ0 3.57e-75 252 31 18 570 3 yidC Membrane protein insertase YidC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8IMM9 5.54e-75 251 31 13 539 3 yidC Membrane protein insertase YidC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q1MPF3 5.97e-75 249 30 16 560 3 yidC Membrane protein insertase YidC Lawsonia intracellularis (strain PHE/MN1-00)
Q98D88 8.85e-75 251 31 13 509 3 yidC Membrane protein insertase YidC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B0UHI1 1.26e-74 251 30 12 539 3 yidC Membrane protein insertase YidC Methylobacterium sp. (strain 4-46)
C6C0J6 2.01e-74 248 30 13 561 3 yidC Membrane protein insertase YidC Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B8EPG5 4.76e-74 249 29 17 549 3 yidC Membrane protein insertase YidC Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B3E3S0 5.84e-74 247 38 7 385 3 yidC Membrane protein insertase YidC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A1B0E4 7.4e-74 249 32 19 538 3 yidC Membrane protein insertase YidC Paracoccus denitrificans (strain Pd 1222)
Q1RKM2 1e-73 247 28 12 534 3 yidC Membrane protein insertase YidC Rickettsia bellii (strain RML369-C)
A8GUC7 1e-73 247 28 12 534 3 yidC Membrane protein insertase YidC Rickettsia bellii (strain OSU 85-389)
O25989 1.19e-73 246 37 5 333 3 yidC Membrane protein insertase YidC Helicobacter pylori (strain ATCC 700392 / 26695)
C3PM83 1.78e-73 246 30 16 543 3 yidC Membrane protein insertase YidC Rickettsia africae (strain ESF-5)
Q746Q2 5.17e-73 244 34 8 426 3 yidC Membrane protein insertase YidC Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A5G9V4 1.03e-72 244 35 6 380 3 yidC Membrane protein insertase YidC Geotalea uraniireducens (strain Rf4)
Q4UN76 1.35e-72 244 30 17 546 3 yidC Membrane protein insertase YidC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q39PQ8 1.41e-72 243 35 9 415 3 yidC Membrane protein insertase YidC Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q68XS4 1.44e-72 244 30 16 535 3 yidC Membrane protein insertase YidC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q92JJ3 1.5e-72 244 30 16 543 3 yidC Membrane protein insertase YidC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1QH68 1.67e-72 245 30 16 545 3 yidC Membrane protein insertase YidC Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A8GLY9 1.7e-72 244 29 15 538 3 yidC Membrane protein insertase YidC Rickettsia akari (strain Hartford)
A8GQK8 2.55e-72 243 30 15 543 3 yidC Membrane protein insertase YidC Rickettsia rickettsii (strain Sheila Smith)
Q4FNF1 2.68e-72 243 31 13 511 3 yidC Membrane protein insertase YidC Pelagibacter ubique (strain HTCC1062)
C4K168 3.15e-72 243 30 16 543 3 yidC Membrane protein insertase YidC Rickettsia peacockii (strain Rustic)
Q9ZJG8 3.64e-72 243 37 5 333 3 yidC Membrane protein insertase YidC Helicobacter pylori (strain J99 / ATCC 700824)
A1AV44 4.1e-72 242 32 9 499 3 yidC Membrane protein insertase YidC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B0BVZ4 5.61e-72 243 30 15 543 3 yidC Membrane protein insertase YidC Rickettsia rickettsii (strain Iowa)
B9JZK8 1.98e-71 243 29 16 557 3 yidC Membrane protein insertase YidC Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q9PNX7 3.03e-71 240 40 6 325 3 yidC Membrane protein insertase YidC Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P60037 4.07e-71 239 47 0 229 3 yidC Membrane protein insertase YidC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A8F0F4 4.91e-71 240 29 16 546 3 yidC Membrane protein insertase YidC Rickettsia massiliae (strain Mtu5)
B9KNZ6 6.17e-71 241 30 21 598 3 yidC Membrane protein insertase YidC Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q9ZE97 6.44e-71 239 31 24 570 3 yidC Membrane protein insertase YidC Rickettsia prowazekii (strain Madrid E)
A3PNB1 7.36e-71 241 30 21 598 3 yidC Membrane protein insertase YidC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3IYY6 7.44e-71 241 30 21 598 3 yidC Membrane protein insertase YidC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A1VER7 8.17e-71 239 38 7 337 3 yidC Membrane protein insertase YidC Nitratidesulfovibrio vulgaris (strain DP4)
Q72D53 8.17e-71 239 38 7 337 3 yidC Membrane protein insertase YidC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0BU78 1.31e-70 239 33 11 423 3 yidC Membrane protein insertase YidC Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q1MM58 9.43e-70 238 29 15 536 3 yidC Membrane protein insertase YidC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q16AA1 3.37e-69 236 31 17 549 3 yidC Membrane protein insertase YidC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2LSF9 3.91e-69 234 32 12 508 3 yidC Membrane protein insertase YidC Syntrophus aciditrophicus (strain SB)
B2IDV5 9.43e-69 235 29 13 535 3 yidC Membrane protein insertase YidC Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A5G0F8 1.65e-68 234 31 14 528 3 yidC Membrane protein insertase YidC Acidiphilium cryptum (strain JF-5)
Q1GJX6 8.38e-67 230 31 15 520 3 yidC Membrane protein insertase YidC Ruegeria sp. (strain TM1040)
B3Q040 9.78e-64 221 28 14 525 3 yidC Membrane protein insertase YidC Rhizobium etli (strain CIAT 652)
Q5LW11 1.07e-63 222 31 18 552 3 yidC Membrane protein insertase YidC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q28UQ8 1.52e-63 222 30 20 559 3 yidC Membrane protein insertase YidC Jannaschia sp. (strain CCS1)
Q7VJY0 2.44e-63 220 37 5 313 3 yidC Membrane protein insertase YidC Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B8H1E8 4.21e-61 215 28 19 608 3 yidC Membrane protein insertase YidC Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AA40 4.21e-61 215 28 19 608 3 yidC Membrane protein insertase YidC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9RNL5 7.56e-61 213 28 16 565 3 yidC Membrane protein insertase YidC Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B0T872 1.11e-59 211 28 14 548 3 yidC Membrane protein insertase YidC Caulobacter sp. (strain K31)
A7HIY8 3.07e-58 206 32 7 380 3 yidC Membrane protein insertase YidC Anaeromyxobacter sp. (strain Fw109-5)
Q2IHR0 4.3e-57 202 33 8 377 3 yidC Membrane protein insertase YidC Anaeromyxobacter dehalogenans (strain 2CP-C)
B4UKG1 8.3e-57 202 32 7 376 3 yidC Membrane protein insertase YidC Anaeromyxobacter sp. (strain K)
B8JDK5 2.54e-56 200 33 8 378 3 yidC Membrane protein insertase YidC Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B1GZ50 1.01e-53 193 33 4 323 3 yidC Membrane protein insertase YidC Endomicrobium trichonymphae
A8LMA0 1.19e-53 194 29 18 542 3 yidC Membrane protein insertase YidC Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B4S6X1 1.04e-49 183 28 21 577 3 yidC Membrane protein insertase YidC Prosthecochloris aestuarii (strain DSM 271 / SK 413)
O66561 2.23e-49 181 37 5 258 3 yidC Membrane protein insertase YidC Aquifex aeolicus (strain VF5)
B3QYV6 8.47e-49 181 26 19 552 3 yidC Membrane protein insertase YidC Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A4SH20 1.09e-47 177 37 9 299 3 yidC Membrane protein insertase YidC Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q3B110 1.37e-47 177 36 10 302 3 yidC Membrane protein insertase YidC Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B3EIM7 3.17e-46 174 34 7 299 3 yidC Membrane protein insertase YidC Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A1BJZ7 7.65e-46 172 32 11 340 3 yidC Membrane protein insertase YidC Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8KGG2 1.1e-45 172 27 14 511 3 yidC Membrane protein insertase YidC Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3QLY4 2.56e-45 171 29 21 513 3 yidC Membrane protein insertase YidC Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B3EQF7 3.42e-44 168 33 7 301 3 yidC Membrane protein insertase YidC Chlorobium phaeobacteroides (strain BS1)
B4SHH0 9.47e-44 167 32 11 330 3 yidC Membrane protein insertase YidC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3ANZ7 1.07e-43 166 33 7 299 3 yidC Membrane protein insertase YidC Chlorobium chlorochromatii (strain CaD3)
A1QZM8 8.23e-41 158 38 4 230 3 yidC Membrane protein insertase YidC Borrelia turicatae (strain 91E135)
B2S0E5 8.9e-41 158 37 4 230 3 yidC Membrane protein insertase YidC Borrelia hermsii (strain HS1 / DAH)
Q9PKE3 4.47e-40 158 32 5 277 3 yidC Membrane protein insertase YidC Chlamydia muridarum (strain MoPn / Nigg)
B5RLZ9 1.35e-39 154 36 4 230 3 yidC Membrane protein insertase YidC Borrelia duttonii (strain Ly)
B5RRP5 1.96e-39 154 36 4 230 3 yidC Membrane protein insertase YidC Borrelia recurrentis (strain A1)
O51398 2.58e-37 148 37 5 230 3 yidC Membrane protein insertase YidC Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B7J208 2.68e-37 148 37 5 230 3 yidC Membrane protein insertase YidC Borreliella burgdorferi (strain ZS7)
Q661H9 3.96e-37 147 38 6 224 3 yidC Membrane protein insertase YidC Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
O66103 4.64e-37 148 25 19 591 3 yidC Membrane protein insertase YidC Treponema pallidum (strain Nichols)
Q0SN67 9.32e-37 146 38 6 224 3 yidC Membrane protein insertase YidC Borreliella afzelii (strain PKo)
P59809 2.03e-36 147 35 4 246 3 yidC Membrane protein insertase YidC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A6L9D2 1.76e-35 144 28 22 536 3 yidC Membrane protein insertase YidC Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q7VQ46 2.8e-35 144 34 4 246 3 yidC Membrane protein insertase YidC Chlamydia pneumoniae
Q81JH1 3.23e-35 135 36 6 215 3 yidC2 Membrane protein insertase YidC 2 Bacillus anthracis
O84253 5.92e-35 143 34 4 252 3 yidC Membrane protein insertase YidC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q814F4 1.09e-34 134 35 6 215 3 yidC2 Membrane protein insertase YidC 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81XH4 1.94e-34 134 34 6 222 3 yidC1 Membrane protein insertase YidC 1 Bacillus anthracis
Q7UFZ2 5.73e-34 140 25 13 449 3 yidC Membrane protein insertase YidC Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q815V9 9.81e-34 132 34 6 222 3 yidC1 Membrane protein insertase YidC 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q72VY8 2.49e-33 137 38 5 205 3 yidC Membrane protein insertase YidC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P97041 2.76e-33 137 38 5 205 3 yidC Membrane protein insertase YidC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q04XE2 1.05e-32 135 37 5 205 3 yidC Membrane protein insertase YidC Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04W30 1.05e-32 135 37 5 205 3 yidC Membrane protein insertase YidC Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B3ER28 1.27e-32 135 25 6 326 3 yidC Membrane protein insertase YidC Amoebophilus asiaticus (strain 5a2)
O87567 5.15e-31 124 38 4 183 3 yidC Membrane protein insertase YidC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q73JM1 8.64e-31 129 25 19 552 3 yidC Membrane protein insertase YidC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q926Q5 1.07e-30 124 38 5 194 3 yidC2 Membrane protein insertase YidC 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8R6K6 1.93e-30 121 35 4 202 3 yidC Membrane protein insertase YidC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9RCA5 4.29e-30 121 39 5 194 3 yidC1 Membrane protein insertase YidC 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8Y3I2 8.61e-30 121 36 6 209 3 yidC2 Membrane protein insertase YidC 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71VQ8 8.61e-30 121 36 6 209 3 yidC1 Membrane protein insertase YidC 1 Listeria monocytogenes serotype 4b (strain F2365)
Q97CW0 5.06e-29 118 38 4 177 3 yidC Membrane protein insertase YidC Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q01625 1.45e-28 117 36 7 215 1 misCA Membrane protein insertase MisCA Bacillus subtilis (strain 168)
A6L5L6 1.72e-28 123 25 12 382 3 yidC Membrane protein insertase YidC Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q5LC41 2.12e-28 122 23 20 561 3 yidC Membrane protein insertase YidC Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64T26 2.5e-28 122 23 20 561 3 yidC Membrane protein insertase YidC Bacteroides fragilis (strain YCH46)
Q9KDP2 2.75e-28 117 32 8 222 1 yidC2 Membrane protein insertase YidC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q11S04 2.93e-28 122 29 20 437 3 yidC Membrane protein insertase YidC Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q8RHA4 5.61e-28 114 36 3 199 3 yidC Membrane protein insertase YidC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8AA76 1.53e-27 120 25 13 427 3 yidC Membrane protein insertase YidC Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8LBP4 7.31e-27 117 30 7 243 1 ALB3 Inner membrane protein ALBINO3, chloroplastic Arabidopsis thaliana
Q8EKU1 9.25e-27 112 32 5 197 3 yidC Membrane protein insertase YidC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9FY06 2.71e-26 115 30 7 243 2 PPF-1 Inner membrane protein PPF-1, chloroplastic Pisum sativum
Q8CX16 1.25e-25 109 37 5 190 3 yidC1 Membrane protein insertase YidC 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E6W4 2.21e-25 108 37 5 190 3 yidC1 Membrane protein insertase YidC 1 Streptococcus agalactiae serotype III (strain NEM316)
P59811 5.62e-24 107 30 7 247 3 yidC Membrane protein insertase YidC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9CJ72 5.91e-24 104 32 7 198 3 yidC1 Membrane protein insertase YidC 1 Lactococcus lactis subsp. lactis (strain IL1403)
O54569 9.7e-24 107 31 6 219 3 yidC Membrane protein insertase YidC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8XH28 2.6e-23 102 37 3 164 3 yidC Membrane protein insertase YidC Clostridium perfringens (strain 13 / Type A)
Q8LKI3 6.81e-23 104 30 5 210 2 ALB3.2 Inner membrane ALBINO3-like protein 2, chloroplastic Chlamydomonas reinhardtii
Q03D58 5.38e-22 99 36 4 190 3 yidC Membrane protein insertase YidC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q9X1H2 1.54e-21 100 32 7 223 1 yidC Membrane protein insertase YidC Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q82YV1 2.59e-21 97 35 6 184 3 yidC Membrane protein insertase YidC Enterococcus faecalis (strain ATCC 700802 / V583)
Q8YRM9 2.38e-20 96 33 5 168 3 yidC Membrane protein insertase YidC Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P60036 3.55e-20 97 24 11 347 3 yidC Membrane protein insertase YidC Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8S339 5.84e-20 96 26 7 246 3 ALB3.1 Inner membrane ALBINO3-like protein 1, chloroplastic Chlamydomonas reinhardtii
B2RKS0 7.64e-20 96 24 10 345 3 yidC Membrane protein insertase YidC Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q899S4 2.4e-19 90 31 7 209 3 yidC Membrane protein insertase YidC Clostridium tetani (strain Massachusetts / E88)
Q8P2P8 3.48e-19 91 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDY9 3.54e-19 91 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DC87 4.71e-19 90 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC86 4.71e-19 90 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P65631 4.71e-19 90 34 7 187 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pyogenes serotype M1
B6YQF9 4.73e-19 94 23 24 542 3 yidC Membrane protein insertase YidC Azobacteroides pseudotrichonymphae genomovar. CFP2
Q9RSH5 7.89e-19 92 30 5 193 3 yidC Membrane protein insertase YidC Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q88RX1 1e-18 89 33 7 215 3 yidC2 Membrane protein insertase YidC 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8DVX3 1.81e-18 89 35 5 174 3 yidC1 Membrane protein insertase YidC 1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9FYL3 2.07e-18 91 27 5 213 1 ALB4 ALBINO3-like protein 1, chloroplastic Arabidopsis thaliana
P74155 2.39e-18 90 38 2 120 1 yidC Membrane protein insertase YidC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q88WR8 6.77e-18 88 30 9 236 3 yidC1 Membrane protein insertase YidC 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q97NI6 6.95e-18 87 30 5 192 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DN93 7.75e-18 87 30 5 192 1 yidC2 Membrane protein insertase YidC 2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P54544 2.62e-17 85 29 13 278 1 misCB Membrane protein insertase MisCB Bacillus subtilis (strain 168)
Q8CMK4 1.12e-16 84 31 8 214 3 yidC2 Membrane protein insertase YidC 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLG6 1.12e-16 84 31 8 214 3 yidC1 Membrane protein insertase YidC 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q42191 2.22e-16 85 26 8 285 2 OXA1 Mitochondrial inner membrane protein OXA1 Arabidopsis thaliana
A4W485 3.76e-16 82 34 6 174 3 yidC Membrane protein insertase YidC Streptococcus suis (strain 98HAH33)
Q83MN6 4.84e-16 82 24 10 258 3 yidC Membrane protein insertase YidC Tropheryma whipplei (strain Twist)
Q83N53 9.82e-16 81 24 10 258 3 yidC Membrane protein insertase YidC Tropheryma whipplei (strain TW08/27)
Q50205 1.12e-15 82 25 11 271 3 yidC Membrane protein insertase YidC Mycobacterium leprae (strain TN)
Q92BX6 1.6e-15 80 31 9 203 3 yidC1 Membrane protein insertase YidC 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q71ZU1 1.73e-15 80 31 9 203 3 yidC2 Membrane protein insertase YidC 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y7A9 1.73e-15 80 31 9 203 3 yidC1 Membrane protein insertase YidC 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9L7M1 2.79e-15 80 35 4 110 3 yidC Membrane protein insertase YidC Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q5HMD1 3.14e-15 79 29 10 224 3 yidC2 Membrane protein insertase YidC 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CMK8 3.17e-15 79 29 10 224 3 yidC1 Membrane protein insertase YidC 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P9WIT5 4.17e-15 80 35 4 110 1 yidC Membrane protein insertase YidC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIT4 4.17e-15 80 35 4 110 3 yidC Membrane protein insertase YidC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65627 4.17e-15 80 35 4 110 3 yidC Membrane protein insertase YidC Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4L7X2 4.98e-15 79 29 10 214 3 yidC Membrane protein insertase YidC Staphylococcus haemolyticus (strain JCSC1435)
Q8G6J6 1.35e-14 78 36 4 112 3 yidC Membrane protein insertase YidC Bifidobacterium longum (strain NCC 2705)
Q7V610 4.03e-14 77 34 2 108 3 yidC Membrane protein insertase YidC Prochlorococcus marinus (strain MIT 9313)
Q8DL96 4.61e-14 77 29 2 120 3 yidC Membrane protein insertase YidC Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9A1C3 1.44e-13 75 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M1
P0DC89 1.45e-13 75 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC88 1.45e-13 75 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8DSP8 1.85e-13 74 28 7 216 3 yidC2 Membrane protein insertase YidC 2 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8P2D8 1.88e-13 74 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDQ5 1.88e-13 74 30 10 233 3 yidC2 Membrane protein insertase YidC 2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q7U522 5.13e-13 74 34 2 110 3 yidC Membrane protein insertase YidC Parasynechococcus marenigrum (strain WH8102)
Q7V0R8 5.53e-13 74 33 3 118 3 yidC Membrane protein insertase YidC Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7VB00 1.11e-11 70 31 2 108 3 yidC Membrane protein insertase YidC Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
O43092 1.93e-11 69 26 4 191 2 oxa102 Mitochondrial inner membrane protein oxa1-2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9RGS4 2.42e-11 68 34 3 104 3 yidC Membrane protein insertase YidC Staphylococcus carnosus (strain TM300)
Q8BGA9 6.72e-11 68 23 9 230 1 Oxa1l Mitochondrial inner membrane protein OXA1L Mus musculus
Q9SKD3 7.96e-11 67 28 7 207 2 OXA1L Mitochondrial inner membrane protein OXA1-like Arabidopsis thaliana
O14300 1.13e-10 67 25 5 195 2 oxa101 Mitochondrial inner membrane protein oxa1-1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q15070 1.01e-09 64 27 10 231 1 OXA1L Mitochondrial inner membrane protein OXA1L Homo sapiens
Q49Z38 1.26e-09 63 28 8 164 3 yidC Membrane protein insertase YidC Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P65630 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain MW2)
Q6G7M0 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain MSSA476)
P65629 4.61e-09 61 29 8 174 1 yidC Membrane protein insertase YidC Staphylococcus aureus (strain N315)
P65628 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIT4 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain Newman)
Q5HEA9 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain COL)
Q2YUI9 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUN6 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain JH9)
Q2FWG4 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF36 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain USA300)
A6U3H6 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain JH1)
A7X4S6 4.61e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GEY5 4.69e-09 61 29 8 174 3 yidC Membrane protein insertase YidC Staphylococcus aureus (strain MRSA252)
Q8DY84 9.41e-09 60 26 4 159 3 yidC2 Membrane protein insertase YidC 2 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9CHZ9 9.9e-09 60 28 8 201 3 yidC2 Membrane protein insertase YidC 2 Lactococcus lactis subsp. lactis (strain IL1403)
Q8DNE1 1.32e-08 60 26 4 157 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8E3U9 1.89e-08 59 26 4 159 3 yidC2 Membrane protein insertase YidC 2 Streptococcus agalactiae serotype III (strain NEM316)
C1CTN0 2.13e-08 59 26 4 157 3 yidC Membrane protein insertase YidC Streptococcus pneumoniae (strain Taiwan19F-14)
Q97NP5 2.13e-08 59 26 4 157 3 yidC1 Membrane protein insertase YidC 1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3SYV3 5.59e-08 58 26 9 208 2 OXA1L Mitochondrial inner membrane protein OXA1L Bos taurus
P39952 2.4e-07 56 22 7 214 1 OXA1 Mitochondrial inner membrane protein OXA1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8NLK2 9.51e-07 55 29 3 117 3 yidC Membrane protein insertase YidC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FLS3 1.44e-06 54 34 2 93 3 yidC Membrane protein insertase YidC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8VC74 1.56e-06 53 24 7 220 1 Cox18 Cytochrome c oxidase assembly protein COX18, mitochondrial Mus musculus
Q5R7D0 2.6e-06 53 25 9 236 2 COX18 Cytochrome c oxidase assembly protein COX18, mitochondrial Pongo abelii
Q8N8Q8 3.38e-05 49 23 8 235 1 COX18 Cytochrome c oxidase assembly protein COX18, mitochondrial Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17555
Feature type CDS
Gene yidC
Product membrane protein insertase YidC
Location 146425 - 148047 (strand: -1)
Length 1623 (nucleotides) / 540 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2086
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02096 60Kd inner membrane protein
PF14849 YidC periplasmic domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0706 Cell wall/membrane/envelope biogenesis (M) M Membrane protein insertase Oxa1/YidC/SpoIIIJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03217 YidC/Oxa1 family membrane protein insertase Quorum sensing
Protein export
Bacterial secretion system		 -

Protein Sequence

MDSQRNLLFIALLLVSFFAWQTWESDKTQTLNAATQATQQTTTPSGESSGQNKYITVKTDVLLLNINLRGGDIDEADLLAYPATLKSEDPFRLLETTPEFAYQAISGLTGTHGPDNPNNGKERPLYTAAGDTFVLAEGQDELRVPLTYTQDGVTYVKTYTLKRKNYALGVDYTIKNDTANPLEMAFFGQLKQSVSLPERLNSGSSNFALHTYRGAAYSSEETNYKKYSFGDIEEKSLNINTNTGWVAMLQQYFATAWIPEKDSTNNFYTLYNAKSGDAFIGYKSDAIRVAANGEAKYNATLWVGPELQNEMEAVASHLDLTVDYGWLWFISQPLFKLLKFIHSFIGNWGFSIIVITFIVRGIMYPLTRAQYTSMAKMRMLQPKLKAMRERIGDDKSRMSQEMMALYKAEKVNPLGGCLPLVIQMPIFLALYYMLMGSVELRHAPFIGWIHDLSAQDPYYILPILMGITMFVIQKLSPTAVTDPLQQKIFTFMPVIFTVFFLWFPSGLVLYYIVSNLVTILQQQIIYRGLEKRGLHSRDKK

Flanking regions ( +/- flanking 50bp)

GGTGATGATCCTGTCCCACCTAAAAATGATGATAACAGAGAACATTAACGATGGATTCGCAACGTAATCTTCTATTCATCGCTTTGCTACTCGTATCCTTCTTTGCATGGCAGACGTGGGAAAGTGATAAAACACAAACACTCAACGCGGCTACTCAGGCAACGCAGCAGACGACAACGCCAAGTGGTGAAAGCAGCGGGCAGAATAAATATATCACGGTCAAAACTGATGTGCTGTTACTGAACATCAATCTGCGCGGTGGTGATATTGATGAAGCCGACCTTCTGGCTTACCCGGCAACATTAAAGTCCGAAGACCCGTTCCGTTTACTGGAAACGACGCCTGAATTCGCATATCAGGCGATCAGTGGTCTTACCGGTACACATGGTCCGGATAACCCGAATAACGGCAAAGAGCGTCCATTGTATACCGCAGCGGGTGACACATTTGTGTTAGCTGAGGGACAGGATGAGCTGCGCGTTCCGCTGACGTATACTCAGGATGGTGTCACTTATGTGAAAACCTATACCCTGAAACGTAAAAATTACGCACTCGGCGTTGATTACACCATCAAAAATGACACCGCGAATCCGCTGGAAATGGCATTTTTTGGTCAGTTAAAACAGTCTGTCAGTTTACCGGAACGCTTAAACAGCGGCAGCAGCAACTTTGCTCTGCACACGTATCGCGGTGCGGCGTATTCGTCTGAAGAGACAAATTATAAAAAATACAGTTTTGGTGATATTGAAGAAAAATCACTGAATATCAACACGAACACCGGTTGGGTGGCGATGTTGCAACAGTATTTTGCCACTGCGTGGATCCCTGAAAAAGACTCAACCAATAACTTCTACACCTTGTATAACGCTAAGTCCGGTGATGCATTTATCGGCTATAAGAGTGATGCAATCCGTGTTGCTGCTAATGGTGAAGCGAAATATAACGCCACACTGTGGGTGGGTCCTGAGTTACAGAATGAAATGGAAGCAGTTGCTTCTCACCTGGACTTAACAGTAGATTACGGCTGGTTATGGTTTATTTCACAACCGCTGTTTAAGTTACTGAAATTTATCCACAGCTTTATCGGTAACTGGGGTTTCTCCATTATCGTGATCACCTTTATTGTCCGCGGTATCATGTATCCGCTGACCCGTGCGCAATACACCTCTATGGCAAAAATGCGTATGCTTCAGCCTAAGCTGAAAGCAATGCGTGAGCGTATTGGTGATGATAAATCGCGTATGAGCCAGGAAATGATGGCGTTGTACAAAGCAGAGAAAGTGAATCCGCTGGGTGGTTGCTTACCACTTGTCATCCAGATGCCAATCTTCCTTGCATTGTATTATATGCTGATGGGCTCGGTTGAACTGCGTCATGCACCATTCATCGGCTGGATTCATGACTTATCAGCGCAGGATCCGTACTACATTCTGCCTATTCTGATGGGTATCACGATGTTCGTGATTCAGAAACTGTCTCCGACGGCAGTGACGGATCCGTTACAGCAGAAGATTTTCACCTTTATGCCGGTGATCTTTACTGTCTTCTTCCTGTGGTTCCCGTCTGGTCTGGTTCTGTACTATATCGTCAGTAACTTAGTGACCATTCTCCAGCAGCAGATTATTTATCGCGGGCTGGAAAAACGCGGGCTTCACAGTCGCGACAAAAAATAAGTGACTGACCGGCAGGGAATACCTGCCGGTCTTATAGTAATATTTAAGGG