Homologs in group_1950

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14640 FBDBKF_14640 100.0 Morganella morganii S1 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
NLDBIP_15975 NLDBIP_15975 100.0 Morganella morganii S4 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
LHKJJB_15865 LHKJJB_15865 100.0 Morganella morganii S3 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
HKOGLL_14985 HKOGLL_14985 100.0 Morganella morganii S5 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
F4V73_RS07435 F4V73_RS07435 84.1 Morganella psychrotolerans - aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
PMI_RS07080 PMI_RS07080 65.7 Proteus mirabilis HI4320 - aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme

Distribution of the homologs in the orthogroup group_1950

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1950

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2RL44 8.66e-55 188 32 4 342 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8Y0Y8 2.38e-46 166 34 6 354 3 hisC2 Histidinol-phosphate aminotransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
C0ZCE7 2.83e-45 162 32 6 334 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q9KCA8 3.49e-44 160 30 5 340 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0BVW4 7.04e-44 159 31 8 343 3 hisC Histidinol-phosphate aminotransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A4XMY1 9.44e-44 158 29 7 364 3 hisC Histidinol-phosphate aminotransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
O07131 5.4e-42 154 31 5 331 3 hisC Histidinol-phosphate aminotransferase Methylobacillus flagellatus
Q3JEN8 7.17e-42 154 33 7 341 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5QZ49 1.08e-40 150 30 8 339 3 hisC1 Histidinol-phosphate aminotransferase 1 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1HTD4 2.51e-40 149 31 7 319 3 hisC Histidinol-phosphate aminotransferase Lysinibacillus sphaericus (strain C3-41)
A8MEH2 8.21e-40 148 31 7 338 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
Q311Z4 3.05e-39 147 29 4 336 3 hisC Histidinol-phosphate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q3AAT6 3.8e-39 146 30 7 332 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7HCR6 8.99e-39 145 29 7 337 3 hisC Histidinol-phosphate aminotransferase Anaeromyxobacter sp. (strain Fw109-5)
A1VEW4 1.13e-38 145 29 5 335 3 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q47GP2 1.48e-38 144 29 8 355 3 hisC1 Histidinol-phosphate aminotransferase 1 Dechloromonas aromatica (strain RCB)
B3DXN2 2.16e-38 144 32 9 327 3 hisC Histidinol-phosphate aminotransferase Methylacidiphilum infernorum (isolate V4)
A1TGS6 4.8e-38 143 32 10 342 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P60998 5.38e-38 143 31 8 346 3 hisC Histidinol-phosphate aminotransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q72DA0 6.74e-38 143 29 5 335 1 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q31GD4 7.96e-38 143 30 8 335 3 hisC2 Histidinol-phosphate aminotransferase 2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3K8U2 8.13e-38 143 31 8 342 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain Pf0-1)
Q82XE0 1.15e-37 142 27 6 361 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A7Z614 1.27e-37 142 29 5 334 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q46Y48 2.77e-37 141 29 6 355 3 hisC1 Histidinol-phosphate aminotransferase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9CMI7 2.99e-37 141 30 11 353 3 hisC2 Histidinol-phosphate aminotransferase 2 Pasteurella multocida (strain Pm70)
Q2Y6Y6 3.22e-37 142 27 7 354 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q930J0 3.45e-37 141 31 5 341 3 hisC3 Histidinol-phosphate aminotransferase 3 Rhizobium meliloti (strain 1021)
Q89GX0 5.46e-37 140 32 13 362 3 hisC1 Histidinol-phosphate aminotransferase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A6UTL8 8.28e-37 140 26 8 353 3 hisC Histidinol-phosphate aminotransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q03VY3 1.63e-36 139 30 11 332 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q58365 2.31e-36 139 26 11 356 3 hisC Histidinol-phosphate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q73AX7 3.33e-36 138 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4K8N0 3.54e-36 138 30 8 337 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5HR08 4.35e-36 137 30 8 336 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CTG8 4.44e-36 137 30 8 336 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P17731 9.59e-36 137 28 5 332 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis (strain 168)
Q81SV5 1.03e-35 137 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
Q8NXN3 1.59e-35 136 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 1.59e-35 136 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
Q67KI2 1.62e-35 136 30 7 337 3 hisC Histidinol-phosphate aminotransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q62FC0 2.17e-35 136 31 12 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia mallei (strain ATCC 23344)
Q63DL4 2.3e-35 136 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
Q8KZ92 3.13e-35 135 28 5 332 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis subsp. natto
Q5FRR4 3.24e-35 136 28 7 345 3 hisC1 Histidinol-phosphate aminotransferase 1 Gluconobacter oxydans (strain 621H)
P34037 3.29e-35 135 30 8 343 1 hisC Histidinol-phosphate aminotransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A7GN55 3.72e-35 135 28 8 331 3 hisC Histidinol-phosphate aminotransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6HL37 3.8e-35 135 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63XM1 5.14e-35 135 31 12 349 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain K96243)
Q3JW89 5.14e-35 135 31 12 349 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain 1710b)
A8YZZ5 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 6.21e-35 134 30 10 357 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 6.21e-35 134 30 10 357 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YSI3 7.09e-35 134 30 11 359 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B2UPR9 7.32e-35 135 29 5 351 3 hisC Histidinol-phosphate aminotransferase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q6AQK2 9.21e-35 135 31 8 333 3 hisC Histidinol-phosphate aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5WGR9 1.09e-34 134 30 6 338 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
A0R5X8 2.07e-34 133 32 11 343 1 pat Putative phenylalanine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q88UE6 2.66e-34 133 28 6 337 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9HZ68 5.57e-34 132 29 7 336 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4QLD1 1.02e-33 132 28 9 341 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain 86-028NP)
Q49VS0 1.04e-33 131 29 7 331 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2W047 1.44e-33 131 30 8 348 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A4FWW1 1.47e-33 131 26 10 354 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q6GIR8 1.64e-33 130 30 11 358 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
P61003 1.82e-33 131 26 9 354 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q57004 1.85e-33 131 27 9 352 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7I6C5 1.99e-33 130 32 14 351 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB0057)
B7GZI3 1.99e-33 130 32 14 351 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB307-0294)
C1KWM5 2.18e-33 130 29 9 340 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
B6IYQ0 2.29e-33 130 29 7 341 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q4FP52 2.34e-33 130 26 7 351 3 hisC Histidinol-phosphate aminotransferase Pelagibacter ubique (strain HTCC1062)
A9AA96 2.52e-33 130 27 9 354 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q4L4E7 2.77e-33 130 30 9 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
B0VV21 3.49e-33 130 32 14 351 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain SDF)
P61005 4.15e-33 130 32 10 327 3 pat Putative phenylalanine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A3Q7J9 4.71e-33 130 30 10 336 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain JLS)
Q1B1Z8 4.76e-33 130 30 10 336 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain MCS)
A1UN51 4.76e-33 130 30 10 336 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain KMS)
B7GHJ8 6.91e-33 129 29 3 287 3 hisC Histidinol-phosphate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A4WUN9 7.35e-33 129 27 8 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q5P791 9.87e-33 129 30 14 355 3 hisC Histidinol-phosphate aminotransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B1MFC0 1.15e-32 128 31 10 338 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q71Y90 1.32e-32 129 29 9 340 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
P45358 2.02e-32 128 29 11 341 3 hisC Histidinol-phosphate aminotransferase Acetobacter pasteurianus
A0Q9F3 2.31e-32 128 31 9 327 3 pat Putative phenylalanine aminotransferase Mycobacterium avium (strain 104)
Q39CT7 2.45e-32 127 31 13 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2NEQ0 2.52e-32 128 27 12 366 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q6ABU3 2.81e-32 127 29 9 355 3 pat Putative phenylalanine aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A6VGF6 2.87e-32 128 26 11 355 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q5ZU10 2.89e-32 128 27 8 337 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2JTG5 3.05e-32 127 32 13 322 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-3-3Ab)
A5FVN2 3.3e-32 127 27 7 344 3 hisC Histidinol-phosphate aminotransferase Acidiphilium cryptum (strain JF-5)
A5VZ57 3.73e-32 127 32 14 341 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q2JPM4 4.63e-32 127 31 13 321 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
B8DC01 4.86e-32 127 29 9 340 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q5WV43 5.88e-32 127 27 8 337 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Lens)
Q1IE97 6.03e-32 126 31 14 341 3 hisC Histidinol-phosphate aminotransferase Pseudomonas entomophila (strain L48)
P9WML5 6.96e-32 126 29 10 348 1 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML4 6.96e-32 126 29 10 348 3 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9A1 6.96e-32 126 29 10 348 3 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q3SI68 8.13e-32 126 30 13 363 3 hisC2 Histidinol-phosphate aminotransferase 2 Thiobacillus denitrificans (strain ATCC 25259)
C1AIM6 1.06e-31 126 29 10 348 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KQA5 1.06e-31 126 29 10 348 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TVQ0 1.06e-31 126 29 10 348 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3M2I8 1.13e-31 126 32 14 351 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A0AK37 1.15e-31 126 28 7 339 3 hisC Histidinol-phosphate aminotransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5KXV3 1.26e-31 126 29 7 337 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
B0V7Q2 1.42e-31 125 31 13 351 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AYE)
B2HTW5 1.42e-31 125 31 13 351 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ACICU)
P0DI07 1.54e-31 127 29 11 345 1 HISN6B Histidinol-phosphate aminotransferase 2, chloroplastic Arabidopsis thaliana
B9DHD3 1.54e-31 127 29 11 345 1 HISN6A Histidinol-phosphate aminotransferase 1, chloroplastic Arabidopsis thaliana
Q92L21 2.04e-31 125 31 11 340 3 hisC2 Histidinol-phosphate aminotransferase 2 Rhizobium meliloti (strain 1021)
Q3J445 2.32e-31 125 27 8 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q63A05 2.39e-31 125 28 8 331 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q88P86 2.46e-31 125 31 13 341 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q736A5 2.75e-31 125 28 7 330 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B9DK21 2.92e-31 125 28 7 333 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
Q82FJ1 3.2e-31 125 28 10 360 3 pat Putative phenylalanine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q0AM22 3.58e-31 125 28 6 354 3 hisC Histidinol-phosphate aminotransferase Maricaulis maris (strain MCS10)
Q4ZNW0 3.91e-31 124 31 13 339 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
Q5X3Q5 4.43e-31 124 27 8 337 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Paris)
Q6HHF6 4.9e-31 124 28 8 331 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q7VWL5 5.74e-31 124 29 11 361 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A3PIA4 6.09e-31 124 27 8 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B9KPH4 6.47e-31 124 27 8 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q608S3 7.54e-31 124 27 7 341 3 hisC2 Histidinol-phosphate aminotransferase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q97ES6 7.78e-31 124 29 12 341 3 hisC Histidinol-phosphate aminotransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Y5X8 8.19e-31 124 28 8 339 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q81C43 1.18e-30 123 27 6 330 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9A671 1.39e-30 123 29 7 351 3 hisC1 Histidinol-phosphate aminotransferase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q81P62 1.45e-30 123 28 8 331 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
P17736 1.53e-30 123 26 9 352 3 hisC Histidinol-phosphate aminotransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q2RP86 2.2e-30 122 28 8 343 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A4IQ80 2.27e-30 122 29 7 337 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
Q8PX17 2.32e-30 122 29 12 347 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TUE9 2.76e-30 122 30 12 338 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
C5D3D2 2.78e-30 122 29 6 335 3 hisC Histidinol-phosphate aminotransferase Geobacillus sp. (strain WCH70)
Q87WV6 2.98e-30 122 30 13 339 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4FSH2 3.09e-30 122 27 5 337 3 hisC1 Histidinol-phosphate aminotransferase 1 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B0KQJ6 3.29e-30 122 30 13 341 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain GB-1)
Q5LNM6 4.71e-30 122 27 7 347 3 hisC Histidinol-phosphate aminotransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1AY33 4.84e-30 121 31 8 285 3 hisC Histidinol-phosphate aminotransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B2HLJ8 5.01e-30 121 31 9 335 3 pat Putative phenylalanine aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q8EQB9 6.38e-30 121 25 5 336 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q65S79 7.02e-30 121 28 11 373 3 hisC1 Histidinol-phosphate aminotransferase 1 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2N7G6 7.66e-30 121 29 10 343 3 hisC Histidinol-phosphate aminotransferase Erythrobacter litoralis (strain HTCC2594)
Q47KH1 8.87e-30 120 28 11 366 3 pat Putative phenylalanine aminotransferase Thermobifida fusca (strain YX)
C5A7A4 1.33e-29 120 26 8 335 3 hisC Histidinol-phosphate aminotransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q7W6Q1 1.4e-29 120 30 11 361 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN5 1.4e-29 120 30 11 361 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2LST8 1.54e-29 120 28 10 343 3 hisC Histidinol-phosphate aminotransferase Syntrophus aciditrophicus (strain SB)
B2GBR8 1.63e-29 120 29 9 335 3 hisC Histidinol-phosphate aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A8FEJ6 1.73e-29 120 27 4 334 3 hisC Histidinol-phosphate aminotransferase Bacillus pumilus (strain SAFR-032)
O27624 1.8e-29 120 25 9 363 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
C0R1Z0 1.98e-29 120 28 14 360 3 hisC Histidinol-phosphate aminotransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A6UPL6 2.22e-29 120 25 10 354 3 hisC Histidinol-phosphate aminotransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q47AL9 2.8e-29 119 30 14 348 3 hisC2 Histidinol-phosphate aminotransferase 2 Dechloromonas aromatica (strain RCB)
Q65I37 3.15e-29 119 28 4 329 3 hisC Histidinol-phosphate aminotransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q51687 3.17e-29 119 29 10 347 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
Q9RI00 3.32e-29 119 29 10 341 3 hisC Histidinol-phosphate aminotransferase Stutzerimonas stutzeri
A0PVN0 4.39e-29 119 30 9 335 3 pat Putative phenylalanine aminotransferase Mycobacterium ulcerans (strain Agy99)
Q48ED0 4.54e-29 119 30 13 339 3 hisC Histidinol-phosphate aminotransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4QAL4 6.56e-29 118 32 7 333 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
Q4FQF9 9.38e-29 118 30 12 347 3 hisC2 Histidinol-phosphate aminotransferase 2 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9ZBY8 9.89e-29 118 27 7 350 3 pat Putative phenylalanine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2GAI1 1.07e-28 118 29 9 343 3 hisC Histidinol-phosphate aminotransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q81FQ1 1.15e-28 118 29 7 336 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q3KHZ1 1.25e-28 117 30 12 342 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain Pf0-1)
Q31I36 1.29e-28 117 29 15 363 3 hisC1 Histidinol-phosphate aminotransferase 1 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1GP30 1.54e-28 117 29 12 352 3 hisC Histidinol-phosphate aminotransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q92A83 1.7e-28 117 26 8 365 1 hisC Histidinol-phosphate aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q28TL1 1.82e-28 117 28 8 340 3 hisC Histidinol-phosphate aminotransferase Jannaschia sp. (strain CCS1)
Q8R5Q4 1.84e-28 117 28 10 310 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q11DR9 2.6e-28 117 28 9 360 3 hisC Histidinol-phosphate aminotransferase Chelativorans sp. (strain BNC1)
Q6FEC7 2.79e-28 117 30 13 352 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8TH25 3.1e-28 116 27 8 339 3 hisC Histidinol-phosphate aminotransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5V4K3 4.63e-28 116 24 9 371 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q8NTT4 5.58e-28 115 32 7 329 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B5E9W9 6.12e-28 115 27 11 347 3 hisC Histidinol-phosphate aminotransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q5FQA6 6.71e-28 115 30 12 342 3 hisC2 Histidinol-phosphate aminotransferase 2 Gluconobacter oxydans (strain 621H)
Q8FU28 6.94e-28 115 30 10 335 3 pat Putative phenylalanine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B8I5V1 7.64e-28 115 29 9 331 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q609W4 8.56e-28 115 29 14 349 3 hisC1 Histidinol-phosphate aminotransferase 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4KI72 1.01e-27 115 30 13 344 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B3PCJ2 1.3e-27 115 29 13 345 3 hisC Histidinol-phosphate aminotransferase Cellvibrio japonicus (strain Ueda107)
A5CZ78 1.4e-27 115 28 11 340 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A1R558 1.67e-27 115 31 14 346 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q8DTQ4 1.76e-27 114 29 15 351 3 hisC Histidinol-phosphate aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8YMG7 1.99e-27 115 28 12 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q0S962 2.28e-27 114 37 5 218 3 pat Putative phenylalanine aminotransferase Rhodococcus jostii (strain RHA1)
B1JBC0 2.3e-27 114 30 13 341 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain W619)
Q24QJ1 2.87e-27 114 27 9 341 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
A6LUF3 3.11e-27 114 29 13 341 3 hisC Histidinol-phosphate aminotransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q82AA5 3.54e-27 114 28 9 353 3 hisC Histidinol-phosphate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O82030 3.65e-27 114 30 12 346 2 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana tabacum
P16246 4.92e-27 113 26 8 353 3 hisC Histidinol-phosphate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q46E46 5.35e-27 113 28 7 305 3 hisC Histidinol-phosphate aminotransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q7VIJ3 5.92e-27 113 27 2 288 3 hisC Histidinol-phosphate aminotransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q4JW58 6.12e-27 113 30 11 343 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
Q9FEW2 6.16e-27 114 30 12 346 1 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana plumbaginifolia
Q3A7R3 6.88e-27 112 25 9 344 3 hisC Histidinol-phosphate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3MAX6 6.92e-27 113 28 13 350 3 hisC2 Histidinol-phosphate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A9H311 8.35e-27 112 30 11 343 3 hisC Histidinol-phosphate aminotransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3SK85 9.57e-27 113 28 8 356 3 hisC1 Histidinol-phosphate aminotransferase 1 Thiobacillus denitrificans (strain ATCC 25259)
Q2IS68 9.88e-27 112 26 7 362 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain HaA2)
Q8ESS3 1.06e-26 112 27 10 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P61000 1.34e-26 112 26 11 340 3 hisC Histidinol-phosphate aminotransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q98G10 1.78e-26 112 26 6 354 3 hisC2 Histidinol-phosphate aminotransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B9EAC1 1.89e-26 111 30 13 338 3 hisC Histidinol-phosphate aminotransferase Macrococcus caseolyticus (strain JCSC5402)
B1ILA9 1.91e-26 111 26 15 369 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Okra / Type B1)
Q03K75 2.62e-26 111 26 11 363 3 hisC Histidinol-phosphate aminotransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
C1FN41 2.63e-26 111 28 15 349 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Kyoto / Type A2)
Q8TVG3 3.01e-26 112 27 11 354 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B2IDA4 3.23e-26 111 28 4 282 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q83KJ6 3.31e-26 111 26 12 357 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 3.31e-26 111 26 12 357 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
Q3IRT1 3.39e-26 111 26 8 355 3 hisC Histidinol-phosphate aminotransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B1N009 4e-26 110 27 10 341 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
Q11VM5 4.36e-26 110 28 13 344 3 hisC Histidinol-phosphate aminotransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B0K625 4.48e-26 110 26 7 310 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
B9KDN6 5.16e-26 110 28 10 335 3 hisC Histidinol-phosphate aminotransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q5LAZ9 5.28e-26 110 28 7 313 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B1VP97 5.42e-26 110 27 10 360 3 pat Putative phenylalanine aminotransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A8LK96 6.05e-26 110 28 7 335 3 hisC Histidinol-phosphate aminotransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B1IZ53 6.08e-26 110 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q64RE8 6.44e-26 110 28 6 312 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain YCH46)
A6VUD3 6.48e-26 110 31 14 345 3 hisC Histidinol-phosphate aminotransferase Marinomonas sp. (strain MWYL1)
B8FP20 6.99e-26 110 26 11 347 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B7MWU0 7.13e-26 110 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
A7ZNJ3 7.8e-26 110 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MDH5 9.51e-26 109 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
C6E916 9.98e-26 109 26 10 347 3 hisC Histidinol-phosphate aminotransferase Geobacter sp. (strain M21)
Q987C8 1.05e-25 110 27 7 338 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A7H084 1.24e-25 109 25 7 350 3 hisC Histidinol-phosphate aminotransferase Campylobacter curvus (strain 525.92)
Q4JSJ5 1.37e-25 109 28 9 343 3 pat Putative phenylalanine aminotransferase Corynebacterium jeikeium (strain K411)
Q1GET3 1.39e-25 109 26 8 346 3 hisC Histidinol-phosphate aminotransferase Ruegeria sp. (strain TM1040)
A5I245 1.4e-25 109 26 15 349 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FU81 1.4e-25 109 26 15 349 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B0K735 1.68e-25 108 27 9 311 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q32EF0 1.76e-25 108 26 12 357 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
P55683 1.98e-25 109 26 7 337 3 hisC Histidinol-phosphate aminotransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9HVX0 1.99e-25 108 30 12 339 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q163G3 2.08e-25 108 26 9 345 3 hisC Histidinol-phosphate aminotransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q39YP6 2.19e-25 108 26 11 340 1 hisC Histidinol-phosphate aminotransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A8AY31 2.19e-25 108 29 15 348 3 hisC Histidinol-phosphate aminotransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8YV89 2.27e-25 108 26 12 341 3 hisC1 Histidinol-phosphate aminotransferase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B5YU77 2.49e-25 108 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 2.49e-25 108 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
C3KVX5 3.01e-25 108 27 13 345 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain 657 / Type Ba4)
Q3Z0G4 3.5e-25 108 26 12 357 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
Q8FNZ1 3.53e-25 108 29 12 313 3 hisC Histidinol-phosphate aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9A5B6 3.87e-25 108 27 7 348 3 hisC2 Histidinol-phosphate aminotransferase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q323J1 4.06e-25 108 26 12 357 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
Q492K2 4.35e-25 108 25 10 362 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
B7L9P8 4.71e-25 107 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
Q20YH9 5.05e-25 108 27 5 292 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
B6I848 5.57e-25 107 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 5.57e-25 107 26 12 357 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 5.57e-25 107 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 5.57e-25 107 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 5.57e-25 107 26 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
A8HZS2 5.91e-25 108 28 9 356 3 hisC Histidinol-phosphate aminotransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A5UKY0 7.17e-25 107 25 11 351 3 hisC Histidinol-phosphate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q18F03 7.22e-25 107 26 9 338 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
O28255 7.95e-25 107 26 13 347 3 hisC2 Histidinol-phosphate aminotransferase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A8A1P5 8.2e-25 107 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
Q9HQS0 1.32e-24 107 27 11 342 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 1.32e-24 107 27 11 342 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A3CNT7 1.35e-24 106 28 14 347 3 hisC Histidinol-phosphate aminotransferase Streptococcus sanguinis (strain SK36)
A4WC70 1.51e-24 106 26 11 356 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
B2TYF9 1.62e-24 106 25 12 357 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q92MG0 1.77e-24 106 28 7 345 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
Q07IG8 1.81e-24 106 25 6 339 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
B7NC61 2.12e-24 106 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1ACN3 2.29e-24 105 26 13 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O1:K1 / APEC
Q1QQD5 2.4e-24 106 25 7 358 3 hisC Histidinol-phosphate aminotransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q98B00 2.61e-24 106 26 7 332 3 hisC3 Histidinol-phosphate aminotransferase 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B7NQG9 3.21e-24 105 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A4TKK4 3.28e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 3.28e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 3.28e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 3.28e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 3.28e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
Q5N4R3 3.49e-24 105 28 11 349 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PF9 3.49e-24 105 28 11 349 3 hisC Histidinol-phosphate aminotransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7VQW9 3.69e-24 105 24 10 368 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
Q66C50 3.95e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 3.95e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JPW1 4.4e-24 105 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q1R089 4.44e-24 105 28 15 351 3 hisC Histidinol-phosphate aminotransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B5XPE6 5.51e-24 104 26 11 319 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
Q1RA52 5.63e-24 105 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 5.63e-24 105 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 5.63e-24 105 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7GDQ6 6.17e-24 104 27 15 337 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B7UT58 6.28e-24 104 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P61004 7.11e-24 104 28 8 307 3 pat Putative phenylalanine aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A1JTV9 7.31e-24 104 25 11 362 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LUF2 1.06e-23 104 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7FJH1 1.06e-23 104 26 11 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1LP20 1.1e-23 103 25 12 357 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
C0ZM44 1.13e-23 103 30 8 332 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A6Q1Z5 1.21e-23 104 25 9 349 3 hisC Histidinol-phosphate aminotransferase Nitratiruptor sp. (strain SB155-2)
A5G9G1 1.22e-23 103 26 10 337 3 hisC Histidinol-phosphate aminotransferase Geotalea uraniireducens (strain Rf4)
Q3ZXL8 1.27e-23 103 26 11 355 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
B4T9N5 1.67e-23 103 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
C6DF75 1.86e-23 103 26 10 315 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MJP4 1.92e-23 103 26 13 358 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
A0RMN9 1.92e-23 103 25 8 339 3 hisC Histidinol-phosphate aminotransferase Campylobacter fetus subsp. fetus (strain 82-40)
A5FR29 2.37e-23 103 26 11 355 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B5FM42 2.73e-23 103 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
Q3M504 3.3e-23 102 26 12 342 3 hisC1 Histidinol-phosphate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A3CWS8 3.33e-23 102 27 12 377 3 hisC Histidinol-phosphate aminotransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
P73807 3.56e-23 102 26 13 368 3 hisC Histidinol-phosphate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6TBC4 5.25e-23 102 25 13 374 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8AEK3 5.36e-23 102 25 12 357 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B9LNJ8 5.5e-23 102 25 8 352 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
P10369 5.63e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7N6I1 6.29e-23 104 26 11 354 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4TMR6 6.65e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 6.65e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 6.65e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 6.65e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
Q3SV41 6.78e-23 102 26 4 299 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A9MSC2 6.99e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 6.99e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
C0Q1K1 7.27e-23 102 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
Q8Z5J9 7.63e-23 101 26 12 355 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
Q57MS2 7.63e-23 101 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
Q12U08 8.2e-23 101 28 11 336 3 hisC Histidinol-phosphate aminotransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q5Z3C0 8.56e-23 101 27 6 347 3 pat Putative phenylalanine aminotransferase Nocardia farcinica (strain IFM 10152)
A2RKS5 8.84e-23 101 25 11 360 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain MG1363)
B3Q8Z5 1.15e-22 101 28 6 285 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain TIE-1)
P61002 1.15e-22 101 28 6 285 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B8HW95 1.18e-22 101 30 13 320 3 hisC Histidinol-phosphate aminotransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q131B9 1.23e-22 101 25 6 339 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB5)
Q6D410 1.87e-22 100 26 14 373 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0C348 2.18e-22 100 26 9 343 3 hisC Histidinol-phosphate aminotransferase Hyphomonas neptunium (strain ATCC 15444)
A2SE05 2.45e-22 100 29 15 333 3 hisC Histidinol-phosphate aminotransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q89UL9 2.49e-22 100 25 7 356 3 hisC2 Histidinol-phosphate aminotransferase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B5BFB9 2.57e-22 100 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 2.57e-22 100 25 12 356 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q2J8K9 2.78e-22 100 29 13 353 3 hisC Histidinol-phosphate aminotransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
C1B997 2.88e-22 100 28 9 342 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
Q2NTX2 3.7e-22 99 25 12 362 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
Q2YAU6 3.7e-22 100 30 14 348 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q02YW3 4.9e-22 99 25 11 364 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q8U9W3 5e-22 99 27 8 344 3 hisC Histidinol-phosphate aminotransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
A9ML15 5.55e-22 99 25 11 355 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3AD52 8.44e-22 98 27 8 307 3 hisC1 Histidinol-phosphate aminotransferase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3Z879 1.06e-21 98 26 11 343 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q30TC9 1.46e-21 98 24 7 337 3 hisC Histidinol-phosphate aminotransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B1WY56 1.66e-21 97 26 11 348 3 hisC Histidinol-phosphate aminotransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q5HWF4 1.74e-21 98 26 8 332 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni (strain RM1221)
Q3ARM7 1.89e-21 97 28 13 344 3 hisC Histidinol-phosphate aminotransferase Chlorobium chlorochromatii (strain CaD3)
A6LAM2 1.98e-21 97 25 6 312 3 hisC Histidinol-phosphate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q46WL3 2.12e-21 97 27 10 311 1 hisC2 Histidinol-phosphate aminotransferase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A7ZCF3 2.44e-21 97 25 4 294 3 hisC Histidinol-phosphate aminotransferase Campylobacter concisus (strain 13826)
Q8ABA8 2.59e-21 97 27 8 315 3 hisC Histidinol-phosphate aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q3J7H2 3.53e-21 97 30 14 346 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A0KKB7 4.21e-21 96 29 3 191 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1VY36 4.28e-21 97 25 8 332 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q5JFU6 4.49e-21 96 26 8 310 3 hisC Histidinol-phosphate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A5V022 4.54e-21 97 28 12 357 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
Q3JMZ7 4.87e-21 96 29 11 305 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain 1710b)
Q63Q87 5.47e-21 96 29 11 305 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain K96243)
Q62GE0 5.47e-21 96 29 11 305 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia mallei (strain ATCC 23344)
Q15RU8 5.68e-21 96 27 13 343 3 hisC Histidinol-phosphate aminotransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7UNC3 5.93e-21 96 25 9 340 3 hisC Histidinol-phosphate aminotransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9X7B8 6e-21 96 27 14 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain TN)
B8ZRB0 6e-21 96 27 14 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain Br4923)
A4SMP7 6.07e-21 96 30 3 187 3 hisC Histidinol-phosphate aminotransferase Aeromonas salmonicida (strain A449)
Q89AX7 7.59e-21 96 26 10 316 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7M7Y6 8.07e-21 96 24 8 344 3 hisC Histidinol-phosphate aminotransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B9MDV4 9.52e-21 95 28 15 354 3 hisC Histidinol-phosphate aminotransferase Acidovorax ebreus (strain TPSY)
Q65RB2 1.16e-20 95 25 10 319 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q02135 1.18e-20 95 27 12 320 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. lactis (strain IL1403)
A8FKA6 1.29e-20 95 25 10 335 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q0P8H7 1.31e-20 95 24 11 370 1 Cj1437c Dihydroxyacetone phosphate transaminase Cj1437c Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5YYP9 2.15e-20 95 27 10 346 3 hisC Histidinol-phosphate aminotransferase Nocardia farcinica (strain IFM 10152)
A4QFG6 2.33e-20 94 27 11 318 3 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain R)
Q9KJU4 2.93e-20 94 27 11 318 1 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FY98 3.08e-20 94 27 5 339 3 hisC Histidinol-phosphate aminotransferase Brucella suis biovar 1 (strain 1330)
A5VSV7 3.08e-20 94 27 5 339 3 hisC Histidinol-phosphate aminotransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AR7 3.08e-20 94 27 5 339 3 hisC Histidinol-phosphate aminotransferase Brucella abortus biovar 1 (strain 9-941)
Q2YR81 3.08e-20 94 27 5 339 3 hisC Histidinol-phosphate aminotransferase Brucella abortus (strain 2308)
A0QHI1 3.11e-20 94 26 13 364 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
O28277 3.17e-20 93 27 11 336 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A8EWM9 3.46e-20 94 22 8 353 3 hisC Histidinol-phosphate aminotransferase Aliarcobacter butzleri (strain RM4018)
P61001 3.72e-20 94 26 13 364 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WML7 3.74e-20 94 28 12 353 1 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML6 3.74e-20 94 28 12 353 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U2V6 3.74e-20 94 28 12 353 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1ANM2 3.74e-20 94 28 12 353 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJ16 3.74e-20 94 28 12 353 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A679 3.74e-20 94 28 12 353 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A6QBY8 4.26e-20 94 26 7 287 3 hisC Histidinol-phosphate aminotransferase Sulfurovum sp. (strain NBC37-1)
A5N7Q7 4.77e-20 93 28 12 306 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E168 4.77e-20 93 28 12 306 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain NBRC 12016)
Q39K90 4.92e-20 94 29 12 305 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9PII2 5.32e-20 94 24 6 329 1 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
C1ATZ5 6.39e-20 93 27 10 343 3 hisC Histidinol-phosphate aminotransferase Rhodococcus opacus (strain B4)
Q9KSX2 7.58e-20 93 28 7 241 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6ABX6 9.08e-20 93 26 8 352 3 pat Putative phenylalanine aminotransferase Leifsonia xyli subsp. xyli (strain CTCB07)
B9LZ53 1.02e-19 92 26 12 337 3 hisC Histidinol-phosphate aminotransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q9CLM3 1.29e-19 92 31 5 187 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
A1KV06 1.4e-19 92 29 13 317 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTH8 1.4e-19 92 29 13 317 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M185 1.4e-19 92 29 13 317 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C (strain 053442)
Q845V2 1.44e-19 92 29 12 305 3 hisC Histidinol-phosphate aminotransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q2SBJ7 1.67e-19 92 29 11 312 3 hisC Histidinol-phosphate aminotransferase Hahella chejuensis (strain KCTC 2396)
B5FDA0 1.72e-19 92 29 7 241 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain MJ11)
A8GC78 1.75e-19 92 26 11 312 3 hisC Histidinol-phosphate aminotransferase Serratia proteamaculans (strain 568)
Q7P0F4 1.75e-19 92 29 10 315 3 hisC Histidinol-phosphate aminotransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8YJK3 1.77e-19 92 26 5 339 3 hisC Histidinol-phosphate aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B4SGL8 1.87e-19 92 28 14 322 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q7W2Y3 1.93e-19 92 27 11 318 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q10VS0 2.03e-19 92 27 13 336 3 hisC Histidinol-phosphate aminotransferase Trichodesmium erythraeum (strain IMS101)
Q7WDY3 2.12e-19 92 27 11 318 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B0TY45 2.18e-19 92 23 11 370 3 hisC Histidinol-phosphate aminotransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B0UN04 2.34e-19 92 26 7 342 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
B2HQA3 2.48e-19 92 25 12 351 3 hisC Histidinol-phosphate aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q87QL0 2.48e-19 91 27 6 241 3 hisC Histidinol-phosphate aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8KD01 2.54e-19 91 25 11 345 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A1TKZ0 3.03e-19 91 26 15 382 3 hisC Histidinol-phosphate aminotransferase Paracidovorax citrulli (strain AAC00-1)
C3LU31 3.07e-19 91 28 7 241 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F2A2 3.07e-19 91 28 7 241 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B9K9R9 3.27e-19 91 27 17 362 3 hisC Histidinol-phosphate aminotransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A0M287 3.47e-19 91 25 9 321 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A0PP15 6.31e-19 90 25 12 351 3 hisC Histidinol-phosphate aminotransferase Mycobacterium ulcerans (strain Agy99)
A1W431 6.63e-19 90 29 12 298 3 hisC Histidinol-phosphate aminotransferase Acidovorax sp. (strain JS42)
A6L2V8 7.36e-19 90 27 8 314 3 hisC Histidinol-phosphate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B0JJJ7 7.89e-19 90 24 9 338 3 hisC Histidinol-phosphate aminotransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A1VK38 8.73e-19 90 29 13 331 3 hisC Histidinol-phosphate aminotransferase Polaromonas naphthalenivorans (strain CJ2)
Q04Z75 9.17e-19 90 27 12 344 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QW8 9.17e-19 90 27 12 344 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q9X0D0 9.34e-19 89 27 12 304 1 hisC Histidinol-phosphate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1LT68 9.96e-19 90 25 10 308 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q9ZHE5 1.13e-18 89 25 13 362 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q39M27 1.21e-18 90 28 10 346 3 hisC3 Histidinol-phosphate aminotransferase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8Z8H8 1.29e-18 89 26 12 333 3 cobD Threonine-phosphate decarboxylase Salmonella typhi
B7JUI4 1.3e-18 89 24 10 342 3 hisC Histidinol-phosphate aminotransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9JYH7 1.37e-18 89 28 13 317 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57202 1.43e-18 89 25 9 347 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P60999 1.45e-18 89 24 12 360 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q7VSZ0 1.55e-18 89 27 11 318 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A6GY79 1.58e-18 89 27 13 327 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q8DM42 1.82e-18 89 29 14 319 3 hisC Histidinol-phosphate aminotransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q47QS8 1.89e-18 89 28 8 338 3 hisC Histidinol-phosphate aminotransferase Thermobifida fusca (strain YX)
Q0SHX9 2.38e-18 89 27 10 343 3 hisC Histidinol-phosphate aminotransferase Rhodococcus jostii (strain RHA1)
B8D707 2.51e-18 89 25 9 347 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 2.51e-18 89 25 9 347 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B1L869 2.66e-18 88 27 12 304 3 hisC Histidinol-phosphate aminotransferase Thermotoga sp. (strain RQ2)
Q84I51 2.79e-18 88 29 5 185 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
Q8XV80 2.81e-18 89 27 10 311 3 hisC1 Histidinol-phosphate aminotransferase 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1S6Z2 2.93e-18 88 27 7 243 3 hisC Histidinol-phosphate aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0W253 3.01e-18 88 25 12 372 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q84I53 3.16e-18 88 24 12 377 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Diuraphis noxia
A2SSJ1 3.39e-18 88 25 12 360 3 hisC Histidinol-phosphate aminotransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q5E637 3.61e-18 88 30 6 198 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8R5U4 3.61e-18 88 25 7 280 3 cobD Putative threonine-phosphate decarboxylase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7NL03 3.63e-18 88 28 13 312 3 hisC Histidinol-phosphate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A7ICA9 6.89e-18 87 26 8 357 3 hisC Histidinol-phosphate aminotransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q8D8Q1 8.6e-18 87 27 7 241 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain CMCP6)
A7MX17 9.37e-18 87 26 6 241 3 hisC Histidinol-phosphate aminotransferase Vibrio campbellii (strain ATCC BAA-1116)
A5FFY0 1.01e-17 87 26 8 317 3 hisC Histidinol-phosphate aminotransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A7H556 1.08e-17 87 23 6 329 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B4RJ05 1.08e-17 87 28 14 318 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7D7 1.08e-17 87 28 14 318 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5CVR5 1.31e-17 86 27 10 312 3 hisC Histidinol-phosphate aminotransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q7MLS5 1.58e-17 86 30 6 198 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain YJ016)
A5INE2 2.38e-17 85 27 9 259 3 hisC Histidinol-phosphate aminotransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B4S8L6 2.78e-17 85 27 5 223 3 hisC Histidinol-phosphate aminotransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B3QP11 3.2e-17 85 26 11 343 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q1B7G5 3.34e-17 85 27 13 340 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain MCS)
A1UHK7 3.34e-17 85 27 13 340 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain KMS)
A3Q130 3.56e-17 85 27 13 340 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain JLS)
A0QX82 4.8e-17 85 26 10 343 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1T8W2 5.22e-17 85 27 11 347 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0PXP5 7.16e-17 84 24 12 343 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
B8GIB0 7.73e-17 84 26 12 317 3 hisC Histidinol-phosphate aminotransferase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
P97084 1.1e-16 84 26 12 334 1 cobD Threonine-phosphate decarboxylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87C30 1.28e-16 84 27 11 322 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y0 1.28e-16 84 27 11 322 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M23)
Q3BUF6 1.37e-16 84 27 13 328 3 hisC Histidinol-phosphate aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0U3B2 1.38e-16 84 27 11 322 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M12)
Q8EXQ7 1.68e-16 85 22 8 357 3 cobDQ Adenosylcobalamin biosynthesis bifunctional protein CobDQ Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q4UU41 1.95e-16 83 26 11 321 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
B0RSL5 3.56e-16 82 26 11 321 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
B6EJ89 4.35e-16 82 27 5 187 3 hisC Histidinol-phosphate aminotransferase Aliivibrio salmonicida (strain LFI1238)
B3ECG2 5.03e-16 82 25 10 321 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q84I52 5.35e-16 82 28 4 184 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Melaphis rhois

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_15445
Feature type CDS
Gene hisC
Product Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
Location 57368 - 58537 (strand: 1)
Length 1170 (nucleotides) / 389 (amino acids)

Contig

Accession ZDB_226
Length 116685 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1950
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0079 Amino acid transport and metabolism (E) E Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase

Kegg Ortholog Annotation(s)

Protein Sequence

MDRRSFLKSTGIALGGLTAASLVTTGQAATGTVSPAAKAAPLSAENPLLLNFNENSLGMSPKARQAIIDALPGAFRYPDAAREALIEQIAAHFSLTPEHISLGNGSSETIQAAVQMLVADAQKKQQPVQLIVPDPTFNYAELYAEPLGVNIVKVPLKADLSFDLAAMQAIADNFAGHSVIYICNPNNPTAMITPASQLAQWVNQAPPQQNFIIDEAYAEFVSDPQFKSAVEWVAAGKSNIIVTRTFSKIFALAGLRVGYGISVPAVTEQVNIFNSIDNTNIAGAVSALASLNDKPFIDYSRHSTDVSREIVVAALKELNLPYAPSQANFIFHKVTGDVKTYQQRMKENHIMVGREFPPVTGWSRLTLGTPEEMQQFVAVLKQFRQKGWV

Flanking regions ( +/- flanking 50bp)

AGTTCGGTTAGTATTTACCAAAATATAATGACAACAACAGGGTAAATACTATGGATCGTCGTTCGTTTCTGAAATCAACAGGGATCGCGCTCGGCGGATTAACCGCCGCCTCTCTGGTCACCACCGGTCAGGCCGCCACCGGTACTGTCTCACCCGCTGCCAAAGCAGCGCCGCTCAGCGCGGAAAATCCGCTGCTGCTGAACTTCAATGAAAACTCACTGGGGATGTCTCCGAAAGCCCGTCAGGCGATTATTGACGCCCTTCCCGGCGCATTCCGCTATCCGGATGCTGCCCGCGAAGCGCTGATTGAGCAGATTGCCGCGCATTTCTCACTGACACCGGAACACATCAGCCTCGGAAATGGTTCCTCAGAAACCATTCAGGCGGCTGTGCAGATGCTGGTGGCGGATGCACAGAAAAAACAGCAGCCGGTGCAACTGATTGTGCCGGATCCGACATTCAATTATGCCGAACTGTATGCTGAGCCGCTGGGCGTGAATATTGTCAAAGTGCCGCTGAAAGCCGATCTCTCTTTTGACCTCGCGGCAATGCAGGCGATCGCCGATAACTTTGCCGGTCATTCCGTTATCTATATCTGTAACCCGAATAACCCGACCGCTATGATCACCCCGGCATCACAACTCGCACAGTGGGTAAACCAGGCACCGCCGCAGCAGAATTTTATTATTGATGAGGCATATGCGGAATTTGTGTCTGATCCGCAATTTAAAAGTGCGGTTGAATGGGTGGCTGCCGGAAAATCCAATATTATCGTGACACGCACTTTCTCGAAAATATTTGCCCTGGCCGGGCTTCGTGTCGGTTACGGTATTTCCGTACCGGCAGTAACAGAACAGGTAAATATTTTCAATTCTATCGATAATACTAATATAGCAGGTGCAGTTTCCGCACTGGCATCCCTGAATGATAAACCGTTTATTGATTACAGCCGCCATTCAACGGATGTTTCACGGGAAATTGTGGTTGCCGCACTGAAAGAATTAAATCTGCCTTATGCGCCCTCACAGGCTAATTTCATCTTCCATAAGGTGACCGGAGATGTAAAAACCTATCAGCAGCGGATGAAAGAAAACCATATAATGGTCGGCCGTGAATTTCCGCCGGTGACCGGCTGGAGCCGCCTGACATTAGGCACGCCGGAAGAGATGCAGCAATTTGTGGCGGTATTAAAGCAGTTTCGTCAGAAGGGCTGGGTTTAATTTCCGGTTACATTAAATAAAAAACGTGGTGAATACCGGTTTATGACATA