Homologs in group_508

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01025 FBDBKF_01025 100.0 Morganella morganii S1 hemF oxygen-dependent coproporphyrinogen oxidase
NLDBIP_02940 NLDBIP_02940 100.0 Morganella morganii S4 hemF oxygen-dependent coproporphyrinogen oxidase
LHKJJB_04455 LHKJJB_04455 100.0 Morganella morganii S3 hemF oxygen-dependent coproporphyrinogen oxidase
HKOGLL_02590 HKOGLL_02590 100.0 Morganella morganii S5 hemF oxygen-dependent coproporphyrinogen oxidase
F4V73_RS07100 F4V73_RS07100 85.0 Morganella psychrotolerans hemF oxygen-dependent coproporphyrinogen oxidase
PMI_RS09075 PMI_RS09075 70.7 Proteus mirabilis HI4320 hemF oxygen-dependent coproporphyrinogen oxidase

Distribution of the homologs in the orthogroup group_508

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_508

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q0T273 3.22e-173 484 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella flexneri serotype 5b (strain 8401)
P36553 3.47e-173 484 75 2 298 1 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12)
B1IWM6 3.47e-173 484 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2T4 3.47e-173 484 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O9:H4 (strain HS)
B1XAA7 3.47e-173 484 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12 / DH10B)
C4ZX09 3.47e-173 484 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12 / MC4100 / BW2952)
Q3YZA7 4.28e-173 483 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella sonnei (strain Ss046)
Q31Y44 4.28e-173 483 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella boydii serotype 4 (strain Sb227)
B7M6U5 4.28e-173 483 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O8 (strain IAI1)
A7ZPN6 4.28e-173 483 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32DB7 6.63e-173 483 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella dysenteriae serotype 1 (strain Sd197)
Q8FFA3 1.1e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TF33 1.1e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADV0 1.1e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O1:K1 / APEC
B7MY86 1.1e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O81 (strain ED1a)
B7MHT7 1.1e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGD5 1.1e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NPX2 1.13e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LKJ9 1.32e-172 482 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q83QN1 1.84e-172 482 75 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella flexneri
B7LCI0 2.94e-172 481 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain 55989 / EAEC)
B7N626 3.51e-172 481 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TX24 5.62e-172 481 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LMN0 2.31e-171 479 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain SMS-3-5 / SECEC)
B4TR28 4.86e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella schwarzengrund (strain CVM19633)
B5RCS3 5.55e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FQE4 5.55e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella dublin (strain CT_02021853)
B5BB50 7.11e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi A (strain AKU_12601)
Q5PI28 7.11e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0PZ88 8.51e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi C (strain RKS4594)
Q57LQ6 8.51e-171 478 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella choleraesuis (strain SC-B67)
B4T0I0 1.29e-170 477 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella newport (strain SL254)
B5F0I0 1.29e-170 477 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella agona (strain SL483)
A9N336 1.7e-170 477 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8Z4U8 1.81e-170 477 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella typhi
P33771 2.87e-170 476 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TCI1 2.87e-170 476 74 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella heidelberg (strain SL476)
B5R4G0 1.48e-169 474 73 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella enteritidis PT4 (strain P125109)
B5YZY1 2.02e-169 474 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBI4 2.02e-169 474 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O157:H7
A9MID0 2.99e-169 474 73 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B6I512 7.04e-169 473 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain SE11)
A6TC68 3.89e-168 471 76 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XVR1 8.1e-168 470 75 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Klebsiella pneumoniae (strain 342)
A8ADF0 1.34e-166 467 73 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7N6Z9 9.17e-165 462 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7P012 6.45e-164 460 73 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A7MKX5 1.84e-163 459 74 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Cronobacter sakazakii (strain ATCC BAA-894)
A4WD41 7.6e-163 457 71 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Enterobacter sp. (strain 638)
A8GHH2 1.45e-162 457 72 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Serratia proteamaculans (strain 568)
C6D9M5 1.55e-162 457 71 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4EZS7 7.73e-162 455 70 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Proteus mirabilis (strain HI4320)
A7FG82 6.19e-161 453 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q9KVT4 1.02e-160 452 68 1 303 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4C4 1.02e-160 452 68 1 303 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6D8U8 1.49e-160 452 70 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JSJ6 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668I6 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMK2 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis (strain Pestoides F)
Q1CJZ7 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZK6 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCF9 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis
B2K962 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5T7 3.27e-160 451 71 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Antiqua)
A1JL37 1.2e-159 450 69 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GYI0 3.04e-159 448 69 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A6WHB7 7.27e-159 447 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS185)
A3CYL1 7.27e-159 447 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B2VI13 1.15e-158 447 70 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B8CHB9 2.6e-158 446 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella piezotolerans (strain WP3 / JCM 13877)
A1RDY8 4.28e-158 446 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain W3-18-1)
A4Y1D3 4.28e-158 446 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8E3K7 4.48e-158 446 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS223)
Q0I0R6 8.09e-158 445 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain MR-7)
Q0HPA0 8.09e-158 445 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain MR-4)
A0KR67 8.54e-158 445 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain ANA-3)
Q12T99 4.41e-157 443 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C3LPC8 7.21e-157 442 67 1 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain M66-2)
B1KCX1 7.39e-157 442 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella woodyi (strain ATCC 51908 / MS32)
B0TLD7 1.43e-156 442 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella halifaxensis (strain HAW-EB4)
Q2NS88 5.64e-156 440 69 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Sodalis glossinidius (strain morsitans)
A4ST50 5.12e-155 437 68 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aeromonas salmonicida (strain A449)
B7VMW3 1.2e-154 437 67 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio atlanticus (strain LGP32)
Q8EKQ2 3.26e-154 436 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q6LLK0 1.33e-152 432 67 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Photobacterium profundum (strain SS9)
A1S1K6 1.46e-151 429 65 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A7N128 2.92e-151 428 65 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio campbellii (strain ATCC BAA-1116)
A8FP82 8e-151 427 64 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sediminis (strain HAW-EB3)
Q7MGL4 5.36e-150 425 64 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio vulnificus (strain YJ016)
Q21PU0 1.4e-149 424 64 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q87KE3 1.57e-149 424 65 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DDD5 1.83e-149 424 64 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio vulnificus (strain CMCP6)
B8GTF9 2.17e-149 424 67 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A0KEX7 4.45e-149 422 67 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q603L4 6.14e-149 422 64 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QTJ9 2.13e-145 414 65 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6UX86 1.44e-144 411 66 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain PA7)
A4VFI3 2.31e-144 411 65 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stutzerimonas stutzeri (strain A1501)
B7V0Q9 1.19e-143 409 65 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain LESB58)
P43898 1.2e-143 409 65 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02V57 1.2e-143 409 65 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0VTD7 5.35e-143 407 64 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4XNB8 1.66e-142 406 64 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas mendocina (strain ymp)
B1J4A2 5.49e-141 402 63 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain W619)
Q8P3Q0 8.15e-141 402 64 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UP76 8.15e-141 402 64 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain 8004)
B0RYP5 9.61e-141 401 64 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain B100)
Q5GUY0 1.75e-140 401 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SK75 1.75e-140 401 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NY70 1.75e-140 401 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q1I2G6 2.16e-140 400 63 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas entomophila (strain L48)
Q8PF76 2.31e-140 400 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas axonopodis pv. citri (strain 306)
Q88RQ6 3.16e-140 400 63 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3BMT4 3.42e-140 400 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
C3K4I0 9.81e-140 399 62 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain SBW25)
B0KF35 1.08e-139 399 63 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain GB-1)
B2FND0 1.84e-139 398 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stenotrophomonas maltophilia (strain K279a)
Q5WX75 2.35e-139 398 60 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Lens)
Q5QXJ4 2.92e-139 398 62 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5ZW72 3.78e-139 398 60 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBB3 3.78e-139 398 60 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Corby)
Q48QH6 3.93e-139 397 62 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A5VWK4 6.7e-139 397 63 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q5X5U7 1.3e-138 397 60 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Paris)
Q88B49 1.48e-138 396 62 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B4SNL7 1.57e-138 396 63 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stenotrophomonas maltophilia (strain R551-3)
Q4KKQ4 2.29e-138 395 62 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9PHC7 3.87e-138 395 62 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain 9a5c)
Q3KKE0 5.99e-138 394 62 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain Pf0-1)
Q479T3 7.19e-138 394 62 3 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Dechloromonas aromatica (strain RCB)
Q500S4 7.37e-138 394 62 2 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas syringae pv. syringae (strain B728a)
Q7W7U0 1.55e-137 394 64 4 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WL80 1.55e-137 394 64 4 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q82TL0 2.78e-137 393 64 3 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B0U1G5 2.7e-136 390 61 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain M12)
Q7VWE7 3.82e-136 390 64 4 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q1H4H0 6.44e-136 389 62 3 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0AEP6 7.32e-136 389 62 3 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q87FB2 1.41e-135 389 61 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B1YU52 4.75e-133 382 59 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia ambifaria (strain MC40-6)
Q0BD83 5.19e-133 382 59 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8XXC3 1.87e-132 380 60 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q142L8 1.93e-132 381 60 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Paraburkholderia xenovorans (strain LB400)
B2U8Z4 1.38e-131 378 60 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Ralstonia pickettii (strain 12J)
B2T2A3 5.42e-131 377 59 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q39E99 1.79e-130 376 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9ITM7 4.3e-130 375 61 5 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
P84155 1.81e-129 373 59 2 296 1 LMAJ006828 Oxygen-dependent coproporphyrinogen-III oxidase Leishmania major
A9AJJ8 2.54e-129 373 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia multivorans (strain ATCC 17616 / 249)
B1JW43 4.12e-129 372 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia orbicola (strain MC0-3)
C5CLQ3 1.07e-128 371 59 3 306 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Variovorax paradoxus (strain S110)
B4E5R8 1.48e-128 371 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8D1X2 2.35e-128 370 54 1 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Wigglesworthia glossinidia brevipalpis
Q12C42 5.12e-127 367 57 4 309 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1VN15 1.02e-126 366 58 4 308 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Polaromonas naphthalenivorans (strain CJ2)
Q63VT1 2.58e-126 365 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain K96243)
A3N7F7 2.58e-126 365 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain 668)
A3NT46 2.58e-126 365 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain 1106a)
A1V2G0 4.91e-126 364 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain SAVP1)
Q62II8 4.91e-126 364 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain ATCC 23344)
A2S4B5 4.91e-126 364 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain NCTC 10229)
A3MI45 4.91e-126 364 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain NCTC 10247)
B2SGG9 9.89e-123 356 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. mediasiatica (strain FSC147)
B0U151 1.89e-122 355 54 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q0BLZ2 2.79e-122 355 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain OSU18)
Q5NFZ8 4.77e-122 354 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HF0 4.77e-122 354 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain FSC 198)
A4IY09 5.38e-122 354 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q2A3H9 8.15e-122 354 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain LVS)
A7NC51 4.48e-121 352 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q5P7I0 1.42e-120 351 58 6 312 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A0Q6H6 1.76e-120 350 53 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. novicida (strain U112)
Q83AZ6 3.44e-119 347 57 2 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NA93 3.48e-119 347 57 2 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KC01 3.48e-119 347 57 2 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain Dugway 5J108-111)
Q8DL15 1.12e-118 347 55 4 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P72848 2.38e-117 343 53 6 330 1 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7NEK3 4.22e-117 341 57 4 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8YX58 2.21e-115 339 52 4 318 3 hemF2 Coproporphyrinogen-III oxidase, aerobic 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YZ37 4.3e-115 337 54 4 313 3 hemF1 Coproporphyrinogen-III oxidase, aerobic 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5N3S5 2.96e-114 336 54 6 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q7U4M7 2.32e-110 327 50 6 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Parasynechococcus marenigrum (strain WH8102)
A2C524 4.85e-109 323 49 5 328 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain NATL1A)
Q46IN4 4.07e-108 320 48 5 328 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain NATL2A)
Q7V568 5e-108 320 51 4 318 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9313)
Q3AWA8 5.57e-108 321 49 5 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain CC9902)
Q3AMK3 2.08e-107 319 50 5 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain CC9605)
A2BTG1 2.48e-106 316 50 5 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain AS9601)
A3PF71 3.96e-106 315 48 4 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9301)
A2BYW5 5.98e-106 315 49 5 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9515)
A8G786 1.09e-105 314 48 4 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9215)
Q318G0 1.88e-105 313 48 4 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9312)
Q7V9T7 1.13e-104 311 48 4 319 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7UZS3 3.08e-103 308 47 4 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P35055 5.83e-93 283 47 7 313 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Glycine max
Q42946 3.57e-90 276 48 4 296 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Nicotiana tabacum
Q9LR75 2.24e-89 274 47 5 296 2 CPX1 Coproporphyrinogen-III oxidase 1, chloroplastic Arabidopsis thaliana
Q9V3D2 4.68e-88 271 46 6 300 2 Coprox Oxygen-dependent coproporphyrinogen-III oxidase Drosophila melanogaster
Q7XPL2 1.91e-87 270 45 7 319 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Oryza sativa subsp. japonica
P36552 5.33e-86 267 46 4 299 1 Cpox Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Mus musculus
Q3B7D0 5.45e-86 267 46 4 299 1 Cpox Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Rattus norvegicus
P36551 1.19e-85 267 46 4 299 1 CPOX Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Homo sapiens
Q54IA7 3.99e-85 261 43 7 323 3 cpox Oxygen-dependent coproporphyrinogen-III oxidase Dictyostelium discoideum
Q42840 3.21e-82 256 45 9 320 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Hordeum vulgare
P11353 1.35e-76 239 40 6 320 1 HEM13 Oxygen-dependent coproporphyrinogen-III oxidase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UTE2 2.38e-76 238 40 4 305 3 hem13 Probable oxygen-dependent coproporphyrinogen-III oxidase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A8GU63 4.49e-74 231 41 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia rickettsii (strain Sheila Smith)
B0BVQ3 4.49e-74 231 41 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia rickettsii (strain Iowa)
C4K2Y8 1.12e-73 230 41 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia peacockii (strain Rustic)
Q92FV8 1.4e-73 230 41 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PM25 1.48e-73 230 40 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia africae (strain ESF-5)
A8GQB7 1.62e-71 225 40 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia akari (strain Hartford)
Q4UJP2 3.08e-71 224 40 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZC86 3.55e-69 219 38 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia prowazekii (strain Madrid E)
Q68VN1 4.32e-69 219 38 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RGQ3 8.87e-68 215 38 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia bellii (strain RML369-C)
A8GY81 9.26e-68 215 38 4 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia bellii (strain OSU 85-389)
A6U9R1 1.64e-63 205 42 7 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Sinorhizobium medicae (strain WSM419)
Q89SC2 1.72e-61 200 42 7 281 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B5ZY73 9.94e-61 198 41 7 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B0T8D1 1.25e-60 197 40 3 274 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter sp. (strain K31)
Q1MDJ5 1.23e-59 195 41 7 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B9J7B2 2.39e-59 194 42 7 278 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B3PV29 2.93e-59 194 41 7 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium etli (strain CIAT 652)
P63851 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella suis biovar 1 (strain 1330)
P63850 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REI6 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella melitensis biotype 2 (strain ATCC 23457)
A9M6L4 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57BW7 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus biovar 1 (strain 9-941)
Q2YS10 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus (strain 2308)
B2S710 9.59e-59 193 40 8 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus (strain S19)
A6WZC8 1.39e-58 192 40 8 285 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8UD80 1.44e-58 192 40 7 284 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Agrobacterium fabrum (strain C58 / ATCC 33970)
B8GZX1 3.63e-58 191 38 3 283 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AAT8 3.63e-58 191 38 3 283 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q92PD8 6.39e-58 191 41 8 285 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium meliloti (strain 1021)
Q11GB4 1.27e-57 190 37 8 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chelativorans sp. (strain BNC1)
Q2K5S3 7.27e-57 188 41 5 280 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B9JZ61 1.74e-53 179 40 8 285 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q93Z96 4.19e-25 103 42 5 145 2 CPX2 Coproporphyrinogen-III oxidase 2, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_00520
Feature type CDS
Gene hemF
Product oxygen-dependent coproporphyrinogen oxidase
Location 123028 - 123930 (strand: -1)
Length 903 (nucleotides) / 300 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_508
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01218 Coproporphyrinogen III oxidase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0408 Coenzyme transport and metabolism (H) H Coproporphyrinogen-III oxidase HemH, oxygen-dependent

Kegg Ortholog Annotation(s)

Protein Sequence

MNIPDSDSVKDFFLRLQDSLCGQLATCDAGAEFTEDKWQRESGGGCSRVLKSGALFEQAGVNFSHVSGDNLPPSATAHRPELAGCHYQAMGVSLVLHPHNPYVPAAHANVRFFIAEKAGSDPVWWFGGGFDLTPFYPFTEDAVHWHSVARDICTPLGEDAWPRYKKWCDDYFYLKHRSEARGIGGLFFDDLNKPGFEECFAFTRAVGNGFTRAYLPIAEKRRSIPYGERERQFQLYRRGRYVEFNLVWDRGTLFGLQSGGRTESILMSMPPLVRWEYDYQPQAGSPEAALSDFLIPRDWV

Flanking regions ( +/- flanking 50bp)

AAACAAAATGATATACTAAAGTTTATCAGCAGCTCAATGGTCGTGATGTAATGAATATCCCTGATAGTGACAGTGTTAAAGATTTTTTTCTCAGATTACAGGATTCCCTCTGCGGACAACTCGCCACCTGTGACGCCGGTGCTGAGTTTACCGAAGATAAGTGGCAGCGGGAGTCCGGCGGCGGATGCAGCCGGGTACTGAAATCCGGCGCACTGTTTGAACAGGCCGGTGTCAATTTTTCACATGTCAGCGGGGACAACCTGCCGCCGTCTGCCACGGCACACCGCCCGGAGCTGGCCGGGTGTCACTATCAGGCCATGGGCGTTTCTCTGGTACTTCATCCGCATAATCCGTATGTCCCGGCCGCACACGCCAACGTGCGCTTTTTTATTGCCGAAAAAGCCGGCAGTGACCCGGTCTGGTGGTTCGGCGGCGGTTTTGACCTGACTCCTTTCTATCCTTTCACAGAAGATGCCGTACACTGGCACAGTGTCGCCCGGGATATCTGCACGCCGCTGGGCGAAGATGCCTGGCCGCGTTATAAAAAATGGTGCGACGACTATTTTTATCTGAAACACCGCAGCGAAGCGCGTGGTATCGGCGGCCTGTTCTTTGATGATCTGAATAAACCCGGTTTTGAGGAATGCTTTGCCTTCACACGGGCTGTCGGCAACGGCTTTACCCGGGCTTATCTGCCGATCGCGGAAAAACGCCGTTCCATTCCTTATGGTGAGCGCGAACGGCAGTTTCAGCTCTACCGGCGCGGCCGTTATGTGGAGTTTAATCTGGTGTGGGATCGCGGCACACTTTTCGGTTTACAGAGCGGCGGGCGGACCGAATCCATCCTTATGTCGATGCCGCCGCTGGTGCGCTGGGAATATGACTACCAACCGCAGGCCGGTTCTCCGGAAGCCGCACTGAGTGATTTTCTTATCCCCCGCGACTGGGTCTGATAACCCTTCACAGTGTGCTGACTGAAAAGCAGGCTGATAGTCTGCTGCGG