Homologs in group_508

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01025 FBDBKF_01025 85.0 Morganella morganii S1 hemF oxygen-dependent coproporphyrinogen oxidase
EHELCC_00520 EHELCC_00520 85.0 Morganella morganii S2 hemF oxygen-dependent coproporphyrinogen oxidase
NLDBIP_02940 NLDBIP_02940 85.0 Morganella morganii S4 hemF oxygen-dependent coproporphyrinogen oxidase
LHKJJB_04455 LHKJJB_04455 85.0 Morganella morganii S3 hemF oxygen-dependent coproporphyrinogen oxidase
HKOGLL_02590 HKOGLL_02590 85.0 Morganella morganii S5 hemF oxygen-dependent coproporphyrinogen oxidase
PMI_RS09075 PMI_RS09075 71.5 Proteus mirabilis HI4320 hemF oxygen-dependent coproporphyrinogen oxidase

Distribution of the homologs in the orthogroup group_508

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_508

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q0T273 1.6e-174 487 76 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella flexneri serotype 5b (strain 8401)
Q3YZA7 4.44e-174 486 76 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella sonnei (strain Ss046)
Q31Y44 4.44e-174 486 76 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella boydii serotype 4 (strain Sb227)
B7M6U5 4.44e-174 486 76 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O8 (strain IAI1)
A7ZPN6 4.44e-174 486 76 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32DB7 9.66e-174 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella dysenteriae serotype 1 (strain Sd197)
Q83QN1 1.11e-173 485 76 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella flexneri
Q8FFA3 1.23e-173 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TF33 1.23e-173 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADV0 1.23e-173 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O1:K1 / APEC
B7MY86 1.23e-173 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O81 (strain ED1a)
B7MHT7 1.23e-173 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGD5 1.23e-173 485 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N626 1.42e-173 484 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LCI0 2.99e-173 484 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain 55989 / EAEC)
B2TX24 5.05e-173 483 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LMN0 8.09e-173 483 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain SMS-3-5 / SECEC)
A8GHH2 9.25e-173 483 75 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Serratia proteamaculans (strain 568)
B7NPX2 1.27e-172 482 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LKJ9 1.33e-172 482 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7N6Z9 4.23e-172 481 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P36553 9.42e-172 480 75 2 299 1 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12)
B1IWM6 9.42e-172 480 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2T4 9.42e-172 480 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O9:H4 (strain HS)
B1XAA7 9.42e-172 480 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12 / DH10B)
C4ZX09 9.42e-172 480 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12 / MC4100 / BW2952)
C6D9M5 1.15e-170 478 75 0 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7P012 3.66e-170 476 75 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6D8U8 5.45e-170 476 74 0 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5YZY1 1.57e-169 474 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBI4 1.57e-169 474 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O157:H7
B4TR28 5.48e-169 473 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella schwarzengrund (strain CVM19633)
B5RCS3 1.73e-168 472 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FQE4 1.73e-168 472 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella dublin (strain CT_02021853)
B5BB50 2.29e-168 472 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi A (strain AKU_12601)
Q5PI28 2.29e-168 472 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B6I512 2.81e-168 471 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain SE11)
B4T0I0 3.73e-168 471 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella newport (strain SL254)
B5F0I0 3.73e-168 471 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella agona (strain SL483)
A6TC68 4.8e-168 471 76 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8Z4U8 5.24e-168 471 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella typhi
B5R4G0 1.3e-167 469 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella enteritidis PT4 (strain P125109)
A9MID0 1.52e-167 469 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MKX5 2.12e-167 469 75 1 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Cronobacter sakazakii (strain ATCC BAA-894)
C0PZ88 2.2e-167 469 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi C (strain RKS4594)
Q57LQ6 2.2e-167 469 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella choleraesuis (strain SC-B67)
B4EZS7 3.84e-167 468 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Proteus mirabilis (strain HI4320)
A9N336 4.29e-167 468 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B1JSJ6 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668I6 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMK2 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis (strain Pestoides F)
Q1CJZ7 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZK6 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCF9 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis
B2K962 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5T7 5.58e-167 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Antiqua)
P33771 7.26e-167 468 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TCI1 7.26e-167 468 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella heidelberg (strain SL476)
A7FG82 1.04e-166 468 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5XVR1 1.53e-166 467 75 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Klebsiella pneumoniae (strain 342)
Q2NS88 1.7e-166 467 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Sodalis glossinidius (strain morsitans)
A8ADF0 4.89e-166 466 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A1JL37 1.95e-164 462 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4WD41 2.05e-164 461 71 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Enterobacter sp. (strain 638)
B2VI13 7.05e-164 460 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8GYI0 4.05e-163 458 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1KCX1 6.18e-163 458 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella woodyi (strain ATCC 51908 / MS32)
B0TLD7 2.72e-161 454 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella halifaxensis (strain HAW-EB4)
B8CHB9 9.47e-161 452 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella piezotolerans (strain WP3 / JCM 13877)
A6WHB7 2.19e-160 451 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS185)
A3CYL1 2.19e-160 451 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E3K7 4.31e-160 451 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS223)
Q0I0R6 8.89e-160 450 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain MR-7)
Q0HPA0 8.89e-160 450 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain MR-4)
A0KR67 1.07e-159 449 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain ANA-3)
A1RDY8 2.13e-159 449 67 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain W3-18-1)
A4Y1D3 2.13e-159 449 67 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q6LLK0 1.71e-158 446 69 0 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Photobacterium profundum (strain SS9)
Q8EKQ2 3.93e-158 446 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B8GTF9 5.68e-158 445 71 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A8FP82 5.71e-158 446 66 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sediminis (strain HAW-EB3)
Q21PU0 2.35e-157 444 66 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9KVT4 2.55e-157 444 69 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4C4 2.55e-157 444 69 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VMW3 3.01e-157 444 67 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio atlanticus (strain LGP32)
Q12T99 3.47e-157 443 67 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4ST50 4.72e-157 443 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aeromonas salmonicida (strain A449)
Q0VTD7 6.01e-157 442 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C3LPC8 7.95e-156 440 69 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain M66-2)
A7N128 1.02e-155 440 66 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio campbellii (strain ATCC BAA-1116)
Q87KE3 2.7e-154 436 67 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MGL4 4.81e-153 433 66 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio vulnificus (strain YJ016)
A1S1K6 6.59e-153 432 66 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8DDD5 1.44e-152 432 66 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio vulnificus (strain CMCP6)
A4VFI3 1.51e-152 432 70 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stutzerimonas stutzeri (strain A1501)
A4XNB8 1.63e-152 431 69 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas mendocina (strain ymp)
P43898 3.52e-151 428 69 0 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02V57 3.52e-151 428 69 0 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0Q9 4.38e-151 428 69 0 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain LESB58)
A6UX86 1.59e-150 426 68 0 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain PA7)
Q1QTJ9 5.76e-150 425 66 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q603L4 2.56e-149 423 65 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1I2G6 2.88e-149 423 67 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas entomophila (strain L48)
B0KF35 1.05e-148 422 67 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain GB-1)
Q88RQ6 2.55e-148 421 67 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A0KEX7 2.93e-148 421 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q48QH6 4.27e-148 420 66 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A5VWK4 5.48e-148 420 67 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1J4A2 7.95e-148 420 66 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain W619)
Q3KKE0 1e-147 419 65 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain Pf0-1)
Q3BMT4 1.79e-147 419 66 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q4KKQ4 1.84e-147 419 66 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8PF76 2.92e-147 418 66 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas axonopodis pv. citri (strain 306)
Q5GUY0 3.19e-147 418 66 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SK75 3.19e-147 418 66 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NY70 3.19e-147 418 66 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5WX75 3.7e-147 418 64 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Lens)
Q5ZW72 4.33e-147 418 64 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBB3 4.33e-147 418 64 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Corby)
Q500S4 5.71e-147 417 65 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas syringae pv. syringae (strain B728a)
Q5X5U7 7.01e-147 417 64 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Paris)
Q88B49 8.95e-147 417 65 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8P3Q0 2.14e-145 413 65 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UP76 2.14e-145 413 65 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain 8004)
C3K4I0 2.24e-145 414 65 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain SBW25)
B0RYP5 9.06e-145 412 65 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain B100)
Q82TL0 2.69e-144 410 66 1 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AEP6 1.77e-143 409 64 1 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B4SNL7 1.87e-143 408 65 2 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stenotrophomonas maltophilia (strain R551-3)
B2FND0 2.66e-143 408 65 2 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stenotrophomonas maltophilia (strain K279a)
Q9PHC7 6.64e-143 407 64 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain 9a5c)
Q5QXJ4 5.18e-142 405 63 0 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1H4H0 4.75e-141 402 63 1 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q87FB2 7.26e-141 402 63 2 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B0U1G5 8.37e-141 402 63 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain M12)
Q7W7U0 1.33e-138 396 65 3 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WL80 1.33e-138 396 65 3 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q479T3 3.85e-138 395 63 1 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Dechloromonas aromatica (strain RCB)
Q7VWE7 1.6e-137 394 65 3 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8XXC3 1e-134 386 61 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2U8Z4 1.92e-133 383 61 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Ralstonia pickettii (strain 12J)
A9ITM7 3.18e-133 383 61 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q8D1X2 7.31e-133 382 57 1 291 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Wigglesworthia glossinidia brevipalpis
A1VN15 7.62e-133 382 60 3 308 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Polaromonas naphthalenivorans (strain CJ2)
Q39E99 1.78e-131 378 60 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q142L8 3.5e-131 377 59 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Paraburkholderia xenovorans (strain LB400)
P84155 4.26e-131 377 61 0 295 1 LMAJ006828 Oxygen-dependent coproporphyrinogen-III oxidase Leishmania major
B2T2A3 2.45e-130 375 59 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
C5CLQ3 9.07e-130 374 59 2 306 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Variovorax paradoxus (strain S110)
B1JW43 1.02e-129 374 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia orbicola (strain MC0-3)
Q0BD83 1.32e-128 371 60 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q63VT1 1.49e-128 371 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain K96243)
A3N7F7 1.49e-128 371 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain 668)
A3NT46 1.49e-128 371 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain 1106a)
A9AJJ8 3.04e-128 370 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia multivorans (strain ATCC 17616 / 249)
B1YU52 3.39e-128 370 59 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia ambifaria (strain MC40-6)
A1V2G0 6.76e-128 369 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain SAVP1)
Q62II8 6.76e-128 369 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain ATCC 23344)
A2S4B5 6.76e-128 369 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain NCTC 10229)
A3MI45 6.76e-128 369 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain NCTC 10247)
B4E5R8 7.54e-128 369 59 2 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A9KC01 1.16e-127 369 58 0 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain Dugway 5J108-111)
Q83AZ6 1.32e-127 369 58 0 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NA93 2.39e-127 368 58 0 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q12C42 9.43e-127 366 58 3 309 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5P7I0 1.52e-125 363 59 4 312 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8DL15 2.52e-122 356 56 2 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P72848 1.33e-121 355 55 3 320 1 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7NEK3 1.01e-119 348 58 2 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8YZ37 2.72e-119 348 56 3 313 3 hemF1 Coproporphyrinogen-III oxidase, aerobic 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A0Q6H6 4.37e-117 342 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. novicida (strain U112)
Q8YX58 1.46e-116 342 54 3 318 3 hemF2 Coproporphyrinogen-III oxidase, aerobic 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q0BLZ2 1.93e-116 340 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain OSU18)
B2SGG9 2.8e-116 340 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5NFZ8 8.81e-116 338 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HF0 8.81e-116 338 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain FSC 198)
A4IY09 9.83e-116 338 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q2A3H9 1.08e-115 338 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain LVS)
B0U151 5.34e-115 337 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q5N3S5 1.25e-114 337 53 3 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A7NC51 1.47e-114 335 52 3 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A2C524 1.05e-112 332 50 4 328 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain NATL1A)
Q46IN4 5.8e-112 330 50 4 328 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain NATL2A)
Q7V568 2.1e-111 329 51 2 318 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9313)
A3PF71 2.17e-111 328 49 4 333 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9301)
A2BYW5 1.4e-110 327 49 4 327 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9515)
Q7U4M7 3.54e-110 326 52 3 316 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Parasynechococcus marenigrum (strain WH8102)
Q7V9T7 4.69e-110 325 48 4 329 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q318G0 1.03e-109 324 48 3 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9312)
A2BTG1 1.98e-109 324 48 3 329 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain AS9601)
Q3AWA8 2.25e-108 322 50 3 325 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain CC9902)
A8G786 9.49e-108 319 48 3 327 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9215)
Q7UZS3 1.64e-107 319 48 4 327 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q3AMK3 1.73e-107 320 50 4 330 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain CC9605)
Q42946 2.84e-97 295 49 2 296 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Nicotiana tabacum
P35055 2.81e-96 292 49 2 295 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Glycine max
Q9LR75 3.03e-94 286 48 3 296 2 CPX1 Coproporphyrinogen-III oxidase 1, chloroplastic Arabidopsis thaliana
Q7XPL2 3.28e-93 284 47 4 305 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Oryza sativa subsp. japonica
Q9V3D2 2.86e-91 279 48 4 300 2 Coprox Oxygen-dependent coproporphyrinogen-III oxidase Drosophila melanogaster
Q3B7D0 1.11e-89 277 47 3 300 1 Cpox Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Rattus norvegicus
P36552 2.78e-89 276 47 3 300 1 Cpox Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Mus musculus
P36551 1.96e-88 274 47 3 300 1 CPOX Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Homo sapiens
Q42840 2.9e-87 269 46 5 305 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Hordeum vulgare
Q54IA7 4.55e-82 254 43 7 323 3 cpox Oxygen-dependent coproporphyrinogen-III oxidase Dictyostelium discoideum
P11353 1.32e-77 242 41 5 320 1 HEM13 Oxygen-dependent coproporphyrinogen-III oxidase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UTE2 1.65e-76 239 41 3 296 3 hem13 Probable oxygen-dependent coproporphyrinogen-III oxidase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A8GU63 1.15e-75 235 43 6 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia rickettsii (strain Sheila Smith)
B0BVQ3 1.15e-75 235 43 6 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia rickettsii (strain Iowa)
Q92FV8 1.62e-75 235 43 6 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C4K2Y8 1.75e-75 235 43 6 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia peacockii (strain Rustic)
C3PM25 4.22e-75 234 42 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia africae (strain ESF-5)
A8GQB7 3.51e-74 232 42 6 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia akari (strain Hartford)
Q68VN1 4.13e-74 231 40 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZC86 5.65e-74 231 41 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia prowazekii (strain Madrid E)
Q4UJP2 8.35e-74 231 42 6 287 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RGQ3 2.53e-70 222 41 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia bellii (strain RML369-C)
A8GY81 2.82e-70 222 41 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia bellii (strain OSU 85-389)
B5ZY73 1.46e-65 210 44 8 282 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A6U9R1 6.76e-65 209 44 9 280 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Sinorhizobium medicae (strain WSM419)
B3PV29 8.13e-65 209 44 8 282 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium etli (strain CIAT 652)
Q1MDJ5 1.25e-64 208 43 8 282 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q89SC2 5.8e-64 207 44 8 276 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B0T8D1 1.2e-63 205 40 4 280 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter sp. (strain K31)
B9J7B2 1.5e-63 205 45 8 276 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B8GZX1 2.88e-62 201 41 4 280 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AAT8 2.88e-62 201 41 4 280 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2K5S3 1.31e-61 200 44 8 282 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A6WZC8 4.29e-60 196 41 9 280 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P63851 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella suis biovar 1 (strain 1330)
P63850 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REI6 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella melitensis biotype 2 (strain ATCC 23457)
A9M6L4 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57BW7 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus biovar 1 (strain 9-941)
Q2YS10 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus (strain 2308)
B2S710 6.41e-60 196 40 8 279 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus (strain S19)
Q8UD80 4.18e-59 194 41 8 285 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92PD8 4.71e-59 194 42 8 285 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium meliloti (strain 1021)
Q11GB4 5.34e-59 194 39 9 291 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chelativorans sp. (strain BNC1)
B9JZ61 4.46e-57 189 42 9 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q93Z96 1.54e-27 110 42 4 145 2 CPX2 Coproporphyrinogen-III oxidase 2, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07100
Feature type CDS
Gene hemF
Product oxygen-dependent coproporphyrinogen oxidase
Location 1473359 - 1474267 (strand: 1)
Length 909 (nucleotides) / 302 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_508
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01218 Coproporphyrinogen III oxidase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0408 Coenzyme transport and metabolism (H) H Coproporphyrinogen-III oxidase HemH, oxygen-dependent

Kegg Ortholog Annotation(s)

Protein Sequence

MNTPDSNSVNDFFLNLQDSLCRQLAECDGGAVFTEDAWQRENGGGGRSRVLKSGALFEQAGVNFSHVCGENLPPSASAHRPELAGRHWQAMGVSLVLHPHNPYVPAAHANVRFFMAEKEGCEPVWWFGGGFDLTPFYPFEEDAVHWHTVAKELCRPLGEEGYPRYKKWCDDYFYLKHRNEARGIGGLFFDDLNEPDFAHSFAFTRAVGNGFTQAYLPIVQKRRDTPYGERERQFQLYRRGRYVEFNLVWDRGTLFGLQSGGRTESILMSMPPLVRWEYDYQPEENSPEAALTRDFLIARDWV

Flanking regions ( +/- flanking 50bp)

AAACAAAATGATATACTAAAGTTTATGCGTAGCTCAATGGGCATTATGTTATGAATACCCCCGATAGTAACAGTGTTAATGATTTTTTCCTTAATTTGCAGGATTCTCTCTGCCGTCAGTTAGCCGAATGTGACGGCGGTGCTGTATTTACCGAAGACGCGTGGCAACGGGAAAACGGCGGCGGCGGTCGCAGCCGTGTACTGAAATCCGGCGCATTATTTGAACAGGCAGGTGTTAATTTTTCACATGTCTGTGGTGAGAATCTGCCACCTTCCGCCAGCGCACACCGCCCGGAACTGGCAGGCCGTCACTGGCAGGCGATGGGGGTATCTCTGGTGTTGCATCCGCATAATCCTTATGTACCTGCGGCTCATGCCAATGTGCGCTTTTTTATGGCAGAGAAAGAGGGTTGTGAACCTGTCTGGTGGTTTGGCGGCGGGTTTGACCTCACACCGTTCTATCCGTTTGAAGAAGATGCGGTTCACTGGCACACCGTCGCAAAAGAGCTGTGCCGTCCGCTGGGTGAAGAGGGTTATCCACGTTATAAAAAATGGTGTGATGACTATTTTTATCTGAAACACCGCAATGAAGCGCGCGGCATCGGCGGTCTGTTTTTTGATGACCTTAATGAACCGGATTTCGCACACAGTTTTGCATTCACCCGCGCCGTAGGTAACGGCTTTACACAGGCTTACCTGCCGATTGTACAAAAGCGGCGGGATACGCCGTACGGCGAGCGTGAGCGGCAGTTTCAGTTATACCGGCGCGGGCGCTATGTCGAGTTCAATCTGGTGTGGGATCGCGGAACATTATTCGGATTACAGAGCGGCGGGCGGACAGAGTCCATTCTGATGTCAATGCCGCCACTGGTACGCTGGGAGTATGATTATCAGCCGGAAGAAAACTCGCCGGAAGCGGCATTAACACGGGATTTTCTGATTGCCCGTGACTGGGTCTGACCTGACAGACAAGCGCAGTACACTGAGTAAAAAGCAGACTGATAGTCTGC