Homologs in group_584

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01025 FBDBKF_01025 70.7 Morganella morganii S1 hemF oxygen-dependent coproporphyrinogen oxidase
EHELCC_00520 EHELCC_00520 70.7 Morganella morganii S2 hemF oxygen-dependent coproporphyrinogen oxidase
NLDBIP_02940 NLDBIP_02940 70.7 Morganella morganii S4 hemF oxygen-dependent coproporphyrinogen oxidase
LHKJJB_04455 LHKJJB_04455 70.7 Morganella morganii S3 hemF oxygen-dependent coproporphyrinogen oxidase
HKOGLL_02590 HKOGLL_02590 70.7 Morganella morganii S5 hemF oxygen-dependent coproporphyrinogen oxidase
F4V73_RS07100 F4V73_RS07100 71.5 Morganella psychrotolerans hemF oxygen-dependent coproporphyrinogen oxidase

Distribution of the homologs in the orthogroup group_584

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_584

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZS7 0.0 632 100 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Proteus mirabilis (strain HI4320)
Q7N6Z9 3.91e-178 496 74 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0T273 4.38e-172 481 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella flexneri serotype 5b (strain 8401)
B5BB50 4.51e-172 481 74 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi A (strain AKU_12601)
Q5PI28 4.51e-172 481 74 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0I0 7.99e-172 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella newport (strain SL254)
B5F0I0 7.99e-172 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella agona (strain SL483)
P33771 1.14e-171 480 74 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TCI1 1.14e-171 480 74 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella heidelberg (strain SL476)
Q3YZA7 1.2e-171 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella sonnei (strain Ss046)
Q31Y44 1.2e-171 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella boydii serotype 4 (strain Sb227)
B7M6U5 1.2e-171 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O8 (strain IAI1)
A7ZPN6 1.2e-171 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8Z4U8 1.24e-171 480 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella typhi
A8GHH2 1.25e-171 480 72 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Serratia proteamaculans (strain 568)
B5RCS3 1.51e-171 479 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FQE4 1.51e-171 479 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella dublin (strain CT_02021853)
A9N336 1.7e-171 479 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
C0PZ88 2.1e-171 479 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella paratyphi C (strain RKS4594)
Q57LQ6 2.1e-171 479 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella choleraesuis (strain SC-B67)
Q83QN1 2.64e-171 479 73 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella flexneri
B7N626 3.51e-171 479 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TR28 3.92e-171 478 74 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella schwarzengrund (strain CVM19633)
Q8FFA3 3.96e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TF33 3.96e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADV0 3.96e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O1:K1 / APEC
B7MY86 3.96e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O81 (strain ED1a)
B7MHT7 3.96e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGD5 3.96e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A1JL37 8.13e-171 478 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LKJ9 8.34e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7LCI0 9.62e-171 478 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain 55989 / EAEC)
P36553 1.41e-170 477 73 2 299 1 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12)
B1IWM6 1.41e-170 477 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2T4 1.41e-170 477 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O9:H4 (strain HS)
B1XAA7 1.41e-170 477 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12 / DH10B)
C4ZX09 1.41e-170 477 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain K12 / MC4100 / BW2952)
B2TX24 1.46e-170 477 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A7MKX5 1.6e-170 477 74 1 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Cronobacter sakazakii (strain ATCC BAA-894)
B7NPX2 2e-170 477 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q32DB7 2.03e-170 477 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shigella dysenteriae serotype 1 (strain Sd197)
A8ADF0 2.34e-170 476 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5R4G0 2.47e-170 476 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella enteritidis PT4 (strain P125109)
B1JSJ6 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668I6 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMK2 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis (strain Pestoides F)
Q1CJZ7 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZK6 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCF9 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis
B2K962 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5T7 2e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pestis bv. Antiqua (strain Antiqua)
B1LMN0 2.9e-169 474 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain SMS-3-5 / SECEC)
A7FG82 2.93e-169 474 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7P012 3.9e-169 473 73 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A9MID0 6.18e-169 473 72 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6TC68 6.04e-168 470 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XVR1 1.06e-167 470 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Klebsiella pneumoniae (strain 342)
B6I512 2.57e-167 469 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli (strain SE11)
B5YZY1 1.01e-166 467 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBI4 1.01e-166 467 73 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Escherichia coli O157:H7
Q2NS88 1.62e-166 467 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Sodalis glossinidius (strain morsitans)
B2VI13 2.09e-164 461 71 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WD41 2.54e-163 459 68 2 299 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Enterobacter sp. (strain 638)
Q0I0R6 6.1e-163 458 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain MR-7)
Q0HPA0 6.1e-163 458 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain MR-4)
C6D9M5 7.37e-163 458 69 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1KCX1 7.44e-163 458 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella woodyi (strain ATCC 51908 / MS32)
A0KR67 8.76e-163 457 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain ANA-3)
Q6D8U8 3.38e-162 456 69 0 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1RDY8 8.55e-162 455 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sp. (strain W3-18-1)
A4Y1D3 8.55e-162 455 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8E3K7 5.38e-161 453 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS223)
B8GTF9 1.15e-160 452 70 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A6WHB7 1.18e-160 452 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS185)
A3CYL1 1.18e-160 452 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A4ST50 1.4e-160 452 70 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aeromonas salmonicida (strain A449)
A8FP82 2.82e-160 451 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella sediminis (strain HAW-EB3)
B8CHB9 4.95e-160 451 67 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0VTD7 5.25e-160 450 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8EKQ2 6.19e-160 450 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8GYI0 7.91e-159 447 67 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q6LLK0 1.12e-158 447 69 0 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Photobacterium profundum (strain SS9)
Q603L4 1.59e-158 447 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q21PU0 1.85e-158 446 66 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1S1K6 5.09e-158 446 68 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q87KE3 1.01e-157 445 68 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q12T99 1.98e-157 444 66 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A7N128 5.09e-157 443 68 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio campbellii (strain ATCC BAA-1116)
Q7MGL4 9.92e-157 442 68 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio vulnificus (strain YJ016)
B7V0Q9 1.79e-156 442 68 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain LESB58)
P43898 1.87e-156 441 68 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02V57 1.87e-156 441 68 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8DDD5 1.98e-156 441 68 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio vulnificus (strain CMCP6)
B7VMW3 4.45e-156 441 68 1 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio atlanticus (strain LGP32)
Q9KVT4 5.02e-156 441 67 2 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4C4 5.02e-156 441 67 2 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B0TLD7 6.87e-156 440 67 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Shewanella halifaxensis (strain HAW-EB4)
A6UX86 8.68e-156 440 67 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas aeruginosa (strain PA7)
C3LPC8 4.13e-153 433 67 2 301 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Vibrio cholerae serotype O1 (strain M66-2)
A0KEX7 5.21e-153 433 69 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4XNB8 6.73e-153 432 67 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas mendocina (strain ymp)
C3K4I0 5.83e-151 428 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain SBW25)
A4VFI3 1.97e-150 426 68 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stutzerimonas stutzeri (strain A1501)
Q1I2G6 9.44e-150 424 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas entomophila (strain L48)
Q88RQ6 2.76e-149 423 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5X5U7 4.32e-149 423 64 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Paris)
A5VWK4 7.72e-149 422 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KF35 1.12e-148 422 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain GB-1)
Q5ZW72 1.39e-148 422 63 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBB3 1.39e-148 422 63 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Corby)
B1J4A2 3.86e-148 421 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas putida (strain W619)
Q5WX75 4.72e-148 421 63 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Legionella pneumophila (strain Lens)
Q3KKE0 8.32e-148 420 65 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain Pf0-1)
Q48QH6 4.74e-147 418 64 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4KKQ4 6.12e-147 417 64 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q88B49 6.42e-146 415 63 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q500S4 7.82e-146 415 63 0 294 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Pseudomonas syringae pv. syringae (strain B728a)
Q1QTJ9 5.84e-145 412 61 0 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0AEP6 7.86e-144 409 62 1 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82TL0 7.1e-143 407 61 1 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3BMT4 1.24e-139 399 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
P84155 1.54e-139 399 61 1 302 1 LMAJ006828 Oxygen-dependent coproporphyrinogen-III oxidase Leishmania major
Q5GUY0 1.8e-139 398 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SK75 1.8e-139 398 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NY70 1.8e-139 398 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B4SNL7 4.77e-139 397 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stenotrophomonas maltophilia (strain R551-3)
B2FND0 7.47e-139 397 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Stenotrophomonas maltophilia (strain K279a)
Q5QXJ4 7.74e-139 397 60 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8PF76 8.44e-139 397 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas axonopodis pv. citri (strain 306)
Q8D1X2 2.41e-138 395 58 1 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Wigglesworthia glossinidia brevipalpis
Q8P3Q0 1.27e-137 394 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UP76 1.27e-137 394 62 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain 8004)
B0RYP5 6.72e-137 392 61 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xanthomonas campestris pv. campestris (strain B100)
A9NA93 1.92e-136 391 60 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q83AZ6 3.05e-136 390 60 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q479T3 3.27e-136 390 60 1 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Dechloromonas aromatica (strain RCB)
A9KC01 4.77e-136 390 60 0 297 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Coxiella burnetii (strain Dugway 5J108-111)
Q1H4H0 8.32e-135 387 60 1 291 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q142L8 2.91e-133 383 59 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Paraburkholderia xenovorans (strain LB400)
A9AJJ8 2.91e-133 383 59 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia multivorans (strain ATCC 17616 / 249)
B0U1G5 4.11e-133 382 59 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain M12)
Q9PHC7 1.04e-132 381 59 2 300 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain 9a5c)
B1JW43 1.48e-132 381 58 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia orbicola (strain MC0-3)
Q39E99 2.18e-132 380 58 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q87FB2 2.61e-132 380 60 2 295 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2T2A3 3.23e-132 380 59 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q8XXC3 9.43e-132 379 59 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B4E5R8 4.6e-131 377 58 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q63VT1 5.65e-129 372 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain K96243)
A3N7F7 5.65e-129 372 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain 668)
A3NT46 5.65e-129 372 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia pseudomallei (strain 1106a)
Q0BD83 6.02e-129 372 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2U8Z4 8.12e-129 371 58 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Ralstonia pickettii (strain 12J)
B1YU52 1.07e-128 371 58 3 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia ambifaria (strain MC40-6)
A1V2G0 1.27e-128 371 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain SAVP1)
Q62II8 1.27e-128 371 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain ATCC 23344)
A2S4B5 1.27e-128 371 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain NCTC 10229)
A3MI45 1.27e-128 371 57 2 302 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Burkholderia mallei (strain NCTC 10247)
Q7W7U0 3.23e-128 370 58 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WL80 3.23e-128 370 58 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VWE7 9.42e-128 369 58 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q5P7I0 2.37e-127 368 58 4 312 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1VN15 2.46e-127 368 58 3 308 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Polaromonas naphthalenivorans (strain CJ2)
C5CLQ3 4.51e-127 367 58 2 298 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Variovorax paradoxus (strain S110)
Q7NEK3 1.53e-125 363 59 2 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A9ITM7 2.69e-124 360 56 3 305 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q12C42 3.64e-124 360 55 3 309 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B0U151 3.68e-124 360 55 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q6H6 8.36e-124 359 55 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. novicida (strain U112)
Q2A3H9 6.89e-123 357 55 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain LVS)
Q0BLZ2 2.73e-122 355 55 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain OSU18)
Q8DL15 3.46e-122 356 53 2 323 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B2SGG9 1.18e-121 353 54 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5NFZ8 1.33e-121 353 54 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HF0 1.33e-121 353 54 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain FSC 198)
A4IY09 1.38e-121 353 54 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q8YX58 1.59e-121 355 52 2 321 3 hemF2 Coproporphyrinogen-III oxidase, aerobic 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A7NC51 2.11e-120 350 54 3 304 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
P72848 7.46e-119 348 53 3 322 1 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YZ37 4.05e-117 342 54 2 312 3 hemF1 Coproporphyrinogen-III oxidase, aerobic 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5N3S5 9.47e-113 332 51 3 326 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A3PF71 4.11e-109 323 47 2 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9301)
Q7V9T7 1.55e-108 322 48 3 319 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A8G786 2.13e-108 321 47 2 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9215)
A2BTG1 5.62e-108 320 47 2 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain AS9601)
Q318G0 6.99e-108 320 47 2 321 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9312)
A2BYW5 9.39e-108 319 48 3 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9515)
A2C524 1.36e-106 317 48 3 319 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain NATL1A)
Q7U4M7 4.83e-106 316 49 3 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Parasynechococcus marenigrum (strain WH8102)
Q7UZS3 6.8e-106 315 47 3 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q46IN4 7.26e-106 315 47 3 319 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain NATL2A)
Q3AWA8 1.43e-104 312 48 3 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain CC9902)
Q7V568 7.44e-104 310 47 2 319 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Prochlorococcus marinus (strain MIT 9313)
Q3AMK3 8.07e-104 310 48 3 320 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Synechococcus sp. (strain CC9605)
Q42946 5.28e-98 296 49 2 305 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Nicotiana tabacum
P35055 1.36e-97 295 47 2 304 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Glycine max
Q9LR75 1.51e-97 295 48 2 304 2 CPX1 Coproporphyrinogen-III oxidase 1, chloroplastic Arabidopsis thaliana
Q7XPL2 9.42e-94 286 47 4 313 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Oryza sativa subsp. japonica
Q9V3D2 1.65e-92 282 47 4 306 2 Coprox Oxygen-dependent coproporphyrinogen-III oxidase Drosophila melanogaster
Q42840 3.49e-87 269 45 5 312 2 CPX Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic Hordeum vulgare
Q3B7D0 1.13e-85 266 43 2 303 1 Cpox Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Rattus norvegicus
P36552 2.89e-85 265 43 2 303 1 Cpox Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Mus musculus
P36551 1.69e-84 264 42 2 303 1 CPOX Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial Homo sapiens
P11353 4.95e-83 256 42 5 320 1 HEM13 Oxygen-dependent coproporphyrinogen-III oxidase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A8GU63 1.32e-79 246 43 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia rickettsii (strain Sheila Smith)
B0BVQ3 1.32e-79 246 43 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia rickettsii (strain Iowa)
Q92FV8 2.92e-79 244 43 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PM25 4.41e-79 244 42 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia africae (strain ESF-5)
C4K2Y8 4.51e-79 244 43 5 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia peacockii (strain Rustic)
Q54IA7 1.62e-78 244 41 6 324 3 cpox Oxygen-dependent coproporphyrinogen-III oxidase Dictyostelium discoideum
A8GQB7 5.92e-78 241 43 5 286 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia akari (strain Hartford)
Q4UJP2 6.97e-78 241 43 5 286 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9UTE2 3.29e-75 235 42 3 292 3 hem13 Probable oxygen-dependent coproporphyrinogen-III oxidase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ZC86 6.24e-75 234 41 5 286 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia prowazekii (strain Madrid E)
Q68VN1 2.59e-74 232 40 5 286 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RGQ3 5.64e-73 229 42 5 290 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia bellii (strain RML369-C)
A8GY81 7.24e-73 228 42 5 290 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rickettsia bellii (strain OSU 85-389)
B0T8D1 5.52e-72 226 42 4 283 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter sp. (strain K31)
B8GZX1 5.1e-68 216 42 4 283 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AAT8 5.1e-68 216 42 4 283 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6U9R1 4.59e-67 214 39 6 296 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Sinorhizobium medicae (strain WSM419)
B9J7B2 1.57e-66 213 41 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q92PD8 1.97e-66 213 41 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium meliloti (strain 1021)
B3PV29 2.5e-66 213 41 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium etli (strain CIAT 652)
Q11GB4 2.84e-66 212 39 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Chelativorans sp. (strain BNC1)
Q1MDJ5 3.98e-65 209 40 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UD80 7.3e-65 209 41 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Agrobacterium fabrum (strain C58 / ATCC 33970)
B5ZY73 1.11e-64 208 40 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q89SC2 4.48e-64 207 40 6 290 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2K5S3 2.25e-62 202 39 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P63851 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella suis biovar 1 (strain 1330)
P63850 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REI6 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella melitensis biotype 2 (strain ATCC 23457)
A9M6L4 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57BW7 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus biovar 1 (strain 9-941)
Q2YS10 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus (strain 2308)
B2S710 1.15e-61 201 37 5 288 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella abortus (strain S19)
A6WZC8 1.97e-60 197 38 6 289 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B9JZ61 9.62e-60 196 41 8 290 3 hemF Oxygen-dependent coproporphyrinogen-III oxidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q93Z96 2.01e-32 122 41 2 151 2 CPX2 Coproporphyrinogen-III oxidase 2, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09075
Feature type CDS
Gene hemF
Product oxygen-dependent coproporphyrinogen oxidase
Location 1976195 - 1977103 (strand: 1)
Length 909 (nucleotides) / 302 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_584
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01218 Coproporphyrinogen III oxidase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0408 Coenzyme transport and metabolism (H) H Coproporphyrinogen-III oxidase HemH, oxygen-dependent

Kegg Ortholog Annotation(s)

Protein Sequence

MSLPDIHRVQSFFLSLQDSICHAIENIDQKATFQQDNWQREAGGGGRTRMLTQGAIFEQAGVNFSHVYGDALPASATAHRPELSGRRFQAMGVSLVIHPLNPYIPTSHANVRFFIAEKEGEDPVWWFGGGFDLTPYYGFEEDVIHWHKVAKSVCDPFSQDYYARYKKWCDDYFYLKHRNEPRGVGGLFFDDLNTPDFDHCFEFVQHVGQGYLDAYLPIVEKRKSIPWGERERQFQLYRRGRYVEFNLVWDRGTLFGLQSGGRTESILMSMPPLVRFAYDYRPEPNTPEAKLYTDFLIHKEWV

Flanking regions ( +/- flanking 50bp)

GTCATATCGCGTTCCATTTTTAATAAATATGATAAAAACTGTAGGTTATTATGAGTTTACCTGATATTCATCGTGTGCAATCATTTTTTTTGTCGTTGCAAGATAGTATTTGCCATGCTATTGAAAATATAGACCAAAAAGCAACCTTTCAGCAAGATAATTGGCAAAGAGAAGCTGGCGGTGGTGGTCGTACTCGAATGCTCACCCAAGGTGCTATTTTTGAACAAGCGGGTGTTAATTTTTCCCATGTTTATGGAGATGCCTTACCTGCATCAGCCACGGCTCATCGCCCTGAATTAAGCGGTCGTCGTTTTCAAGCAATGGGCGTTTCATTAGTTATTCACCCTCTTAATCCCTATATTCCTACTTCACATGCAAATGTTCGTTTTTTTATTGCTGAAAAAGAGGGAGAAGATCCTGTATGGTGGTTTGGTGGAGGCTTTGACTTAACGCCTTATTATGGATTTGAAGAAGATGTTATCCATTGGCATAAAGTTGCTAAATCTGTGTGTGATCCCTTTAGCCAAGATTATTATGCTCGATATAAAAAATGGTGTGATGACTATTTTTATTTAAAACATCGTAACGAGCCGCGTGGCGTCGGTGGTCTATTTTTTGATGACTTAAACACTCCTGATTTCGATCACTGTTTTGAATTTGTACAACATGTCGGGCAAGGCTACCTGGATGCCTACTTGCCGATTGTCGAAAAACGCAAATCTATACCCTGGGGAGAGCGTGAACGCCAATTCCAACTTTATCGCCGTGGCCGTTATGTCGAGTTTAATTTGGTTTGGGATAGAGGCACGCTATTTGGTTTACAAAGTGGCGGACGTACTGAATCCATTTTAATGTCAATGCCACCATTAGTGCGCTTTGCATATGATTATCGCCCTGAACCTAATACTCCCGAAGCTAAGCTGTATACTGATTTTTTAATTCACAAAGAGTGGGTATAGCAGTTACTGACGCATTAAAACTAAAGCCATTTATTTATTATAATTGGCTT