Homologs in group_1204

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06540 FBDBKF_06540 95.4 Morganella morganii S1 arcA two-component system response regulator ArcA
EHELCC_09585 EHELCC_09585 95.4 Morganella morganii S2 arcA two-component system response regulator ArcA
NLDBIP_09965 NLDBIP_09965 95.4 Morganella morganii S4 arcA two-component system response regulator ArcA
LHKJJB_07790 LHKJJB_07790 95.4 Morganella morganii S3 arcA two-component system response regulator ArcA
HKOGLL_07340 HKOGLL_07340 95.4 Morganella morganii S5 arcA two-component system response regulator ArcA
F4V73_RS15395 F4V73_RS15395 95.0 Morganella psychrotolerans arcA two-component system response regulator ArcA

Distribution of the homologs in the orthogroup group_1204

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1204

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9Q4 4.5e-162 450 92 0 238 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 4.5e-162 450 92 0 238 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 4.5e-162 450 92 0 238 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 4.5e-162 450 92 0 238 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P44918 1.8e-132 375 77 1 237 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P38684 5.56e-58 186 41 4 233 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P58357 1.19e-57 185 41 4 233 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q9HUI2 6.94e-54 176 38 3 236 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13359 1.55e-42 147 33 3 234 3 virG Regulatory protein VirG Rhizobium rhizogenes
P37478 2.62e-42 146 37 1 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q4LAJ9 5.69e-41 143 35 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q7A216 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 7.13e-41 142 35 3 236 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 7.13e-41 142 35 3 236 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 7.13e-41 142 35 3 236 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 7.13e-41 142 35 3 236 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CQK0 9.13e-41 142 35 3 230 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 9.13e-41 142 35 3 230 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P39663 9.8e-41 143 36 5 238 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A0A4P7TS68 3.08e-40 141 34 4 233 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 3.08e-40 141 34 4 233 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 3.08e-40 141 34 4 233 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 3.08e-40 141 34 4 233 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 3.08e-40 141 34 4 233 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 3.08e-40 141 34 4 233 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 3.08e-40 141 34 4 233 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 3.08e-40 141 34 4 233 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
Q8DPL7 3.16e-40 141 36 2 226 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 3.16e-40 141 36 2 226 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 3.16e-40 141 36 2 226 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4A160 6.19e-40 140 34 3 233 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P07545 2e-39 139 34 3 234 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
P32040 2.95e-39 139 36 5 239 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
G3XCY6 4.99e-39 138 33 3 228 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL9 5.97e-39 137 32 3 230 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 5.97e-39 137 32 3 230 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 5.97e-39 137 32 3 230 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9F868 4.07e-38 135 32 2 229 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P94504 6.54e-38 135 32 3 233 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P48259 8.54e-38 135 35 3 229 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q9TLQ4 9.84e-38 135 32 3 237 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q7A1J1 1.31e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.31e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.31e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.31e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.31e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.31e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.31e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.31e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.31e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.31e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P62722 1.35e-37 135 32 2 233 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
Q8CQ17 3.01e-37 133 35 6 231 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 3.01e-37 133 35 6 231 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A0U4 6.97e-37 132 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 6.97e-37 132 31 2 228 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 6.97e-37 132 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 6.97e-37 132 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 6.97e-37 132 31 2 228 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 6.97e-37 132 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 6.97e-37 132 31 2 228 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 6.97e-37 132 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
O78428 1.49e-36 132 35 3 229 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P94413 1.75e-36 131 31 3 227 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P23620 3.9e-36 130 36 6 232 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q44444 1.77e-35 129 32 2 233 3 virG Regulatory protein VirG Rhizobium radiobacter
Q06239 8.16e-35 127 33 3 228 3 vanR Regulatory protein VanR Enterococcus faecium
P45606 2.1e-34 125 34 6 232 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P28835 2.12e-34 126 34 5 236 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P45605 3.11e-34 125 33 5 233 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P31079 3.81e-34 125 31 3 237 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0AFJ5 5.61e-34 124 34 5 231 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 5.61e-34 124 34 5 231 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P45607 7.17e-34 124 34 5 231 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P35163 9.66e-34 124 30 4 232 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P69228 1.01e-33 124 32 2 233 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 1.01e-33 124 32 2 233 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P54884 4.57e-33 121 32 3 201 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P42244 5.34e-33 122 29 2 226 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P51358 4.16e-32 120 34 6 237 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 8.48e-32 119 33 5 235 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q44929 9.51e-32 119 31 3 236 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P50350 1.15e-31 119 33 5 241 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q04942 2.48e-31 117 30 2 229 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P13792 2.98e-31 118 32 4 234 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q07783 1.86e-30 116 33 7 247 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
O34903 2.27e-30 115 34 4 235 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q9I0I1 3.84e-30 114 30 4 230 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q82EB1 3.9e-30 115 30 4 234 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P50351 5.27e-30 115 32 5 242 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A0QTK2 7.79e-30 114 29 2 227 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P28257 1.07e-29 114 32 4 231 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P44895 1.49e-29 113 31 3 225 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WGM7 1.67e-29 113 31 3 227 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 1.67e-29 113 31 3 227 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 1.67e-29 113 31 3 227 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q93CB8 1.93e-29 113 31 3 227 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P08368 2.95e-29 112 31 3 235 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
O32192 3.11e-29 112 32 6 232 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
A0R3I8 4.11e-29 112 30 4 227 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9ZEP4 6.41e-29 112 30 6 234 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q52990 1.8e-28 110 31 4 230 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
L7N689 2.02e-28 111 33 4 226 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9CCJ2 3.77e-28 109 30 3 226 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P23836 6.86e-28 108 31 4 228 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 8.66e-28 108 31 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 8.66e-28 108 31 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H3GGB5 1.89e-27 108 32 4 231 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q5HLN2 3.2e-27 107 30 4 226 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8X738 3.51e-27 107 31 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P45189 4.23e-27 107 30 6 237 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P21866 5.11e-27 106 32 3 229 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q8CN92 5.6e-27 106 30 4 226 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1B3X8 5.61e-27 106 30 4 227 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 5.61e-27 106 30 4 227 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 5.61e-27 106 30 4 227 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P0C001 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 6.56e-27 106 30 4 226 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 6.56e-27 106 30 4 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P76340 7.21e-27 106 31 4 229 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P0AE90 1.08e-26 105 33 4 231 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 1.08e-26 105 33 4 231 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 1.08e-26 105 33 4 231 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
Q8Z7H2 1.31e-26 105 31 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P0DMK7 1.87e-26 105 31 3 226 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 1.87e-26 105 31 3 226 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
A1TEL7 2.08e-26 105 29 4 227 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P0DM78 3.46e-26 104 31 4 228 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 3.46e-26 104 31 4 228 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 3.46e-26 104 31 4 228 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 3.46e-26 104 31 4 228 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 3.46e-26 104 31 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q47744 3.54e-26 104 32 4 231 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
P9WGN1 7.34e-26 103 29 3 227 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 7.34e-26 103 29 3 227 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q44006 7.81e-26 103 28 4 226 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q99U73 2.55e-25 102 30 4 227 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q57QC3 3.21e-25 102 30 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
A1KHB7 4.98e-25 101 29 4 227 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 4.98e-25 101 29 4 227 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0PWB4 7.21e-25 101 29 5 229 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P9WGM9 1.02e-24 100 29 4 227 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.02e-24 100 29 4 227 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.02e-24 100 29 4 227 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q742C1 1.34e-24 100 29 4 227 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.34e-24 100 29 4 227 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q9HV32 1.49e-24 100 29 4 226 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q55890 2.28e-24 100 28 2 230 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9AE24 3.5e-24 99 30 5 228 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q9I4F9 4.38e-24 99 29 4 228 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q01473 7.89e-24 102 32 4 228 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 4.27e-06 50 25 1 124 3 rcaC Protein RcaC Microchaete diplosiphon
Q49VK3 8.94e-24 98 28 5 232 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YZ24 1.31e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
O31432 1.61e-23 97 29 9 237 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q7A039 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.83e-23 97 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7D9K0 2.7e-23 97 32 6 236 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 2.7e-23 97 32 6 236 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q4L8L9 2.81e-23 97 28 5 232 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
A6QJK3 2.9e-23 96 28 5 234 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 2.9e-23 96 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q49ZT8 3.29e-23 96 29 4 226 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P54443 3.98e-23 96 31 5 229 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
P42421 4.76e-23 96 26 3 227 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q55933 4.81e-23 96 29 5 238 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6GE73 5.86e-23 95 28 5 234 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q4L6C6 9.27e-23 95 28 4 226 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q9CD68 1.02e-22 95 28 6 228 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q4L481 3.52e-22 94 28 6 230 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
O06978 3.54e-22 94 28 4 233 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q8CQ37 3.86e-22 94 28 5 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 3.86e-22 94 28 5 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0ACZ8 6.12e-22 93 29 5 227 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 6.12e-22 93 29 5 227 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 6.12e-22 93 29 5 227 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q47456 6.94e-22 93 29 4 227 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P0A4I0 1.21e-21 92 31 5 227 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 1.21e-21 92 31 5 227 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P52108 2.51e-21 92 29 3 232 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q31S42 5.37e-21 91 28 3 230 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q49XM7 1.18e-20 89 27 3 227 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A6WZ81 8.14e-20 87 25 3 227 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P0A4I2 1.16e-19 87 28 4 229 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 1.16e-19 87 28 4 229 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02540 1.79e-19 87 27 4 227 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q9K621 2.03e-19 86 27 4 225 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P9WGM1 2.11e-19 86 29 4 206 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 2.11e-19 86 29 4 206 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 2.11e-19 86 29 4 206 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8FZ93 2.44e-19 86 25 3 227 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 2.44e-19 86 25 3 227 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 2.44e-19 86 25 3 227 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 2.44e-19 86 25 3 227 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 2.44e-19 86 25 3 227 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 2.44e-19 86 25 3 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 2.44e-19 86 25 3 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 2.44e-19 86 25 3 227 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q9ZHD3 3.25e-19 86 29 5 228 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q5HPC3 4.45e-19 85 28 3 226 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8Z181 6.77e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 6.77e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 6.77e-19 85 26 5 229 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 6.77e-19 85 26 5 229 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 6.77e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
P52076 6.81e-19 85 28 5 226 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q2YSS2 7.05e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P66795 7.56e-19 85 28 4 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 7.56e-19 85 28 4 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q7A1L2 8.15e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 8.15e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 8.15e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 8.15e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 8.15e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 8.15e-19 85 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CP82 8.38e-19 84 28 3 226 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q50136 8.61e-19 85 29 4 206 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q932F1 8.86e-19 85 26 5 229 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GJ11 1e-18 84 26 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
B8H358 1.76e-18 84 25 5 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 1.76e-18 84 25 5 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P30843 2.1e-18 84 29 4 231 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q04803 2.51e-18 85 29 3 230 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45337 3.49e-18 83 26 4 226 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8XBS3 5.24e-18 82 28 5 226 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
O34951 4.47e-17 80 24 4 225 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q2FWH6 8.88e-17 79 27 6 229 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
P0A4H8 1.47e-16 79 25 5 227 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 1.47e-16 79 25 5 227 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P72781 1.8e-16 79 34 3 138 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KM23 4.34e-16 78 30 8 228 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DN02 7.66e-16 77 24 4 229 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 7.66e-16 77 24 4 229 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q70FH0 1.62e-15 76 27 4 226 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
O24973 2.93e-15 75 26 2 171 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
O69730 3.16e-15 75 27 4 230 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q07597 2.69e-14 72 24 3 235 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
P36556 4.91e-14 72 26 4 230 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33112 6e-14 71 30 6 186 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
P48359 7.35e-14 71 34 1 119 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P0CL17 8.57e-14 71 34 1 117 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 8.57e-14 71 34 1 117 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q1XDE4 8.31e-12 65 29 1 118 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
T2KMF4 1.34e-11 67 33 2 122 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P43501 2.32e-11 62 33 1 108 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25918 5.45e-11 63 24 5 234 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q8EQQ3 1.22e-10 63 30 4 124 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q06065 1.4e-10 63 26 6 212 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
B0R4K1 2.62e-10 59 34 2 105 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P51586 1.16e-09 58 34 1 108 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P52942 1.69e-09 57 32 3 118 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
P9WGM3 1.72e-09 59 31 2 145 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.72e-09 59 31 2 145 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8GZM2 2.74e-09 60 29 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 2.74e-09 60 29 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1RJS1 3.85e-09 59 27 4 198 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P40138 4.51e-09 59 31 2 121 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q4UU85 1.55e-08 57 31 2 119 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P18769 2.38e-08 57 32 1 101 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q56312 2.61e-08 54 29 3 118 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P24072 2.72e-08 53 29 4 122 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q9HWA4 5.11e-08 55 32 2 110 1 pprB Two-component response regulator PprB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23221 7.89e-08 54 24 5 171 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O05251 8.61e-08 54 35 3 104 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q8GP20 9e-08 54 22 6 229 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P23747 9.67e-08 55 28 1 115 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
E0X9C7 9.72e-08 55 29 2 119 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 1.29e-07 55 29 2 119 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P06628 1.36e-07 52 30 3 114 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
A1W0A5 1.39e-07 52 28 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 1.39e-07 52 28 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 1.39e-07 52 28 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8KIY1 1.49e-07 55 29 2 119 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q04848 1.61e-07 54 28 3 135 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6K9T0 1.69e-07 52 24 2 112 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 1.69e-07 52 24 2 112 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q8E217 1.84e-07 53 32 4 128 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 1.84e-07 53 32 4 128 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
P46384 2.56e-07 51 27 1 108 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45709 2.77e-07 51 31 2 103 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q07084 2.83e-07 54 26 1 131 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P15940 2.85e-07 53 28 1 106 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q4UL27 3.01e-07 53 26 4 198 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1IRH0 3.45e-07 53 32 2 113 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q9HV27 3.76e-07 53 35 1 78 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13632 3.85e-07 53 27 2 133 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q88RJ6 3.98e-07 53 27 1 108 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P71403 5.51e-07 50 30 3 111 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P0AEV3 5.85e-07 52 33 1 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 5.85e-07 52 33 1 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 5.85e-07 52 33 1 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q88AQ2 6.15e-07 53 27 1 108 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9WY30 6.59e-07 52 30 3 115 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9KSB1 7.34e-07 52 32 1 85 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q92HC2 8.71e-07 52 25 4 198 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZM64 9.72e-07 50 30 3 111 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q05943 1.29e-06 51 36 1 69 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P31802 1.3e-06 51 30 4 118 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P55701 1.47e-06 51 25 4 182 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9AAK0 1.5e-06 51 34 4 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9KM66 1.55e-06 52 32 1 103 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q68WH4 1.59e-06 52 25 4 198 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P26487 1.7e-06 50 24 1 115 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P0DMC5 1.86e-06 52 30 1 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P30855 2.04e-06 52 35 1 101 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P58662 2.06e-06 51 30 1 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8DVB7 2.16e-06 50 33 3 106 3 lytR Sensory transduction protein LytR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q56128 2.22e-06 51 30 1 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q9ZCY9 2.34e-06 51 25 4 198 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P58402 3.17e-06 51 35 1 101 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q9HU19 3.63e-06 50 25 2 139 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1D359 4.02e-06 50 27 1 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
Q04849 4.06e-06 50 33 2 110 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P62640 4.33e-06 50 26 1 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P0DMC6 4.54e-06 50 30 1 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DOA0 5.5e-06 50 27 4 125 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P10577 5.75e-06 50 26 1 111 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
O25153 6.53e-06 50 28 2 111 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q9FAD7 6.68e-06 47 29 2 110 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q54YZ9 6.89e-06 50 28 1 110 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P51343 7.78e-06 48 28 1 119 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P94514 8.58e-06 48 32 5 111 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
Q9M9B9 9.34e-06 49 27 3 103 2 ARR19 Putative two-component response regulator ARR19 Arabidopsis thaliana
P48027 1.06e-05 49 27 1 116 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q12YX1 1.23e-05 48 23 3 140 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
P72253 1.33e-05 48 30 4 112 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
Q10WZ6 1.43e-05 48 29 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P26408 1.74e-05 48 26 4 145 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q9F8D7 1.95e-05 48 26 1 116 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P41789 1.96e-05 48 24 1 107 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7CQM8 2.36e-05 47 26 3 133 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26275 2.56e-05 47 29 4 111 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13800 2.65e-05 47 31 5 148 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q86AT9 2.8e-05 48 26 2 115 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P45671 2.89e-05 48 23 2 124 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q82Z76 3.1e-05 47 30 3 110 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
Q2FQU2 3.2e-05 47 31 1 82 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2SFK0 3.25e-05 47 29 2 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P10576 3.34e-05 47 27 2 119 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q8D0P1 3.53e-05 45 27 2 110 3 cheY Chemotaxis protein CheY Yersinia pestis
O14002 4.24e-05 47 24 2 128 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A7N6S2 4.26e-05 47 27 3 119 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P0A2D5 4.34e-05 45 26 2 110 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 4.34e-05 45 26 2 110 3 cheY Chemotaxis protein CheY Salmonella typhi
O83639 4.81e-05 47 27 4 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q9KQD5 4.97e-05 45 27 2 120 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 4.97e-05 45 27 2 120 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0AE41 5.05e-05 46 26 3 109 3 ypdB Transcriptional regulatory protein YpdB Shigella flexneri
P0AE39 5.05e-05 46 26 3 109 1 ypdB Transcriptional regulatory protein YpdB Escherichia coli (strain K12)
P0AE40 5.05e-05 46 26 3 109 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O157:H7
Q8FFE0 5.37e-05 46 27 4 110 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2LR65 5.65e-05 47 31 4 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
Q51455 6.06e-05 45 25 3 120 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3SVA1 6.26e-05 47 30 4 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P52928 6.38e-05 46 26 4 140 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
P0AE69 6.42e-05 45 27 2 110 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 6.42e-05 45 27 2 110 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 6.42e-05 45 27 2 110 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q86CZ2 6.61e-05 47 26 1 115 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q8FGP6 7.59e-05 44 27 2 110 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q52883 7.64e-05 46 30 4 110 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q3LWR6 7.66e-05 46 26 2 112 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 7.66e-05 46 26 2 112 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 7.66e-05 46 26 2 112 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P96602 7.82e-05 46 28 2 105 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q1QI44 7.96e-05 46 30 4 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
P03029 8.34e-05 46 25 1 107 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q2RX18 8.4e-05 46 31 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2W2W9 8.78e-05 46 30 1 102 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8CQE3 0.0001 45 27 2 128 3 SE_0165 Uncharacterized response regulatory protein SE_0165 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q93P00 0.000101 44 26 2 110 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q6GK93 0.000103 45 28 2 110 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
P09432 0.000103 46 24 3 147 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q2YV56 0.000107 45 28 2 110 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q0PVB3 0.000109 45 24 3 114 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
Q551X9 0.00011 46 26 2 119 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q8NYJ9 0.000111 45 28 2 110 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 0.000111 45 28 2 110 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 0.000111 45 28 2 110 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2G1E1 0.000111 45 28 2 110 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 0.000111 45 28 2 110 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
Q167K9 0.000114 46 28 5 125 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P28787 0.000114 46 24 1 107 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P37740 0.000115 45 30 2 102 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
P96686 0.000116 45 27 2 122 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P62647 0.000117 46 26 2 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q5HKE0 0.000122 45 28 2 128 3 SERP2406 Uncharacterized response regulatory protein SERP2406 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8FW53 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 0.000129 43 26 3 115 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 0.000129 43 26 3 115 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
P0A4I4 0.00013 45 25 4 140 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 0.00013 45 25 4 140 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9UYF3 0.000137 45 28 2 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q9I6V9 0.00014 45 30 4 104 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2WAJ8 0.00014 45 28 3 115 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2KCH7 0.000151 43 26 2 105 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2HWG1 0.000152 43 28 3 114 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
P0AFB8 0.000157 45 23 1 107 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 0.000157 45 23 1 107 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
Q2RRX2 0.000162 45 32 3 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q53228 0.000167 44 27 1 107 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8D5Z6 0.000169 45 29 1 111 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 0.000176 45 29 1 111 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q4L8Q6 0.00019 44 28 3 116 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q9I4N3 0.000198 45 31 3 109 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54SP4 0.000211 45 29 3 119 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P62644 0.000263 45 31 6 139 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7A7X9 0.000263 44 28 2 110 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain N315)
Q99X00 0.000263 44 28 2 110 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0HIF6 0.000277 45 27 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
A6X580 0.000291 42 25 3 112 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q0HVI0 0.000295 44 27 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
P0AFU5 0.000296 45 25 6 195 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 0.000296 45 25 6 195 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P52940 0.000304 44 23 7 187 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q0AWZ8 0.000346 44 28 3 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q39S45 0.000349 44 29 3 107 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q8NYH3 0.000351 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MW2)
Q6GCL1 0.000351 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MSSA476)
Q6GK51 0.000364 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MRSA252)
P60610 0.000364 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain N315)
P60609 0.000364 44 28 3 107 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJB5 0.000364 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain COL)
P60611 0.000364 44 28 3 107 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK09 0.000364 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain USA300)
P0AED6 0.000377 43 26 3 118 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 0.000377 43 26 3 118 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
Q13SY2 0.000377 44 28 3 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
Q2YV67 0.000392 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P39486 0.000404 43 27 4 106 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P62637 0.000405 44 26 2 111 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q54YH4 0.000441 44 24 1 122 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P38889 0.000442 44 28 1 102 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P66797 0.000442 43 26 3 118 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 0.000442 43 26 3 118 3 uvrY Response regulator UvrY Escherichia coli O157:H7
O58192 0.000445 44 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8RAZ3 0.000461 44 26 2 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P21649 0.000463 43 27 4 104 1 mrkE Protein MrkE Klebsiella pneumoniae
P52929 0.000595 43 24 5 167 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q5A599 0.000603 44 25 1 116 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5SML4 0.000611 44 24 3 126 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 0.000611 44 24 3 126 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
Q689G6 0.000624 44 23 3 143 2 PRR95 Two-component response regulator-like PRR95 Oryza sativa subsp. japonica
P24086 0.000765 42 27 3 104 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 0.000765 42 27 3 104 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q7CQM5 0.000841 42 26 3 106 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1BRL2 0.000856 43 27 3 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
Q2ILG8 0.000867 43 24 2 105 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18505
Feature type CDS
Gene arcA
Product two-component system response regulator ArcA
Location 4062408 - 4063124 (strand: -1)
Length 717 (nucleotides) / 238 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1204
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07773 two-component system, OmpR family, aerobic respiration control protein ArcA Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MQTPHILIVEDEVVTRNTLKSIFEAEGYIVHEATDGNEMHNILSDHDINLVIMDINLPGKNGLLLARELREQVSVALMFLTGRDNEVDKILGLEIGADDYITKPFNPRELTIRARNLLSRTMNLANGTEERRLVESYKFNGWELDINSRSLISPTGEQYKLPRSEFRAMLHFCENPGKIQTRAELLKKMTGRELKPHDRTVDVTIRRIRKHFESTPDTPEIIATIHGEGYRFCGDLDE

Flanking regions ( +/- flanking 50bp)

GTTACACACAGATATCCTTTTTCTATTTTTGGTAATTTTAGGTAGCAAATATGCAAACCCCGCACATTCTGATTGTTGAAGATGAAGTAGTTACTCGTAATACCCTGAAAAGCATATTCGAAGCTGAAGGGTATATCGTACACGAAGCCACTGATGGCAACGAGATGCATAATATTCTGTCCGACCATGATATCAATCTGGTTATTATGGATATTAATCTTCCTGGTAAAAACGGTCTTCTATTAGCCCGTGAATTACGTGAACAGGTAAGTGTTGCATTAATGTTCCTAACAGGTCGTGATAATGAAGTTGATAAAATCTTAGGCCTTGAAATTGGTGCCGATGATTACATCACTAAACCATTTAATCCTCGTGAATTAACTATCCGTGCTCGTAACTTATTGTCACGCACTATGAATTTAGCGAATGGCACAGAAGAGCGTCGTTTAGTTGAAAGCTATAAATTTAATGGTTGGGAGCTAGATATTAATAGTCGCTCTCTTATTAGCCCTACAGGTGAACAGTATAAATTACCTCGTAGTGAGTTTCGTGCGATGTTACATTTCTGCGAAAACCCAGGAAAAATCCAAACTCGTGCAGAATTACTGAAAAAAATGACGGGTCGTGAATTAAAACCTCATGATCGTACTGTAGACGTTACCATTCGTCGTATTCGTAAACACTTTGAATCAACCCCTGATACACCTGAGATTATCGCTACTATCCATGGTGAAGGTTATCGTTTCTGTGGTGATTTAGACGAGTGATATCAGTGTTACCCTAGTAAAAAATAATGCTAAAAACCCCGGATTTCAGT