Homologs in group_1142

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_09585 EHELCC_09585 100.0 Morganella morganii S2 arcA two-component system response regulator ArcA
NLDBIP_09965 NLDBIP_09965 100.0 Morganella morganii S4 arcA two-component system response regulator ArcA
LHKJJB_07790 LHKJJB_07790 100.0 Morganella morganii S3 arcA two-component system response regulator ArcA
HKOGLL_07340 HKOGLL_07340 100.0 Morganella morganii S5 arcA two-component system response regulator ArcA
F4V73_RS15395 F4V73_RS15395 99.6 Morganella psychrotolerans arcA two-component system response regulator ArcA
PMI_RS18505 PMI_RS18505 95.4 Proteus mirabilis HI4320 arcA two-component system response regulator ArcA

Distribution of the homologs in the orthogroup group_1142

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1142

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9Q4 4.01e-167 463 94 0 238 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 4.01e-167 463 94 0 238 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 4.01e-167 463 94 0 238 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 4.01e-167 463 94 0 238 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P44918 1.46e-132 375 77 1 237 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P38684 4.57e-59 189 41 4 233 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P58357 1.18e-58 188 41 4 233 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q9HUI2 2.65e-54 177 38 3 236 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A4P7TS68 1.84e-42 147 35 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.84e-42 147 35 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.84e-42 147 35 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.84e-42 147 35 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.84e-42 147 35 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.84e-42 147 35 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.84e-42 147 35 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.84e-42 147 35 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P13359 6.01e-42 145 32 2 233 3 virG Regulatory protein VirG Rhizobium rhizogenes
P37478 6.33e-42 145 36 1 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P32040 3.99e-41 144 38 5 239 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
G3XCY6 1.66e-40 142 33 3 230 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DPL7 5.35e-40 140 35 2 226 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 5.35e-40 140 35 2 226 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 5.35e-40 140 35 2 226 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P94504 6.33e-40 140 33 3 233 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P39663 8.2e-40 140 36 5 238 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8CQK0 1.46e-39 139 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.46e-39 139 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4LAJ9 1.85e-39 139 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q9TLQ4 2.8e-39 139 32 3 237 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q4A160 5.14e-39 138 35 2 225 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A216 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 5.48e-39 137 34 2 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 5.48e-39 137 34 2 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 5.48e-39 137 34 2 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 5.48e-39 137 34 2 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WGL9 8.07e-39 137 32 3 230 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 8.07e-39 137 32 3 230 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 8.07e-39 137 32 3 230 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P48259 1.49e-38 137 35 3 229 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P07545 2.77e-38 136 32 2 234 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
P62722 6.11e-38 136 32 2 234 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
O78428 7.6e-38 135 35 3 229 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q7A0U4 1.05e-37 134 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.05e-37 134 31 2 228 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.05e-37 134 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.05e-37 134 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.05e-37 134 31 2 228 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.05e-37 134 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.05e-37 134 31 2 228 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.05e-37 134 31 2 228 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A1J1 1.61e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.61e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.61e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.61e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.61e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.61e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.61e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.61e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.61e-37 134 34 4 229 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.61e-37 134 34 4 229 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q8CQ17 2.18e-37 133 35 5 231 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 2.18e-37 133 35 5 231 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9F868 3.63e-37 133 31 2 229 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q06239 6.17e-37 132 34 3 228 3 vanR Regulatory protein VanR Enterococcus faecium
P94413 5.16e-36 130 30 3 230 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P23620 6.46e-36 130 36 6 232 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q44444 7.46e-36 130 32 2 234 3 virG Regulatory protein VirG Rhizobium radiobacter
P28835 1.37e-34 126 32 3 234 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P45605 2.49e-34 125 34 5 233 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P45606 3.58e-34 125 34 5 232 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P31079 5.04e-34 125 31 3 237 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P42244 7.23e-34 124 30 2 226 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P50350 1.02e-33 124 34 6 241 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P0AFJ5 1.25e-33 124 33 4 231 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 1.25e-33 124 33 4 231 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P69228 1.37e-33 124 31 1 233 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 1.37e-33 124 31 1 233 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45607 1.58e-33 123 33 4 231 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P54884 4.88e-33 121 31 3 201 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P35163 5.62e-33 122 29 2 228 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P51358 1.37e-32 121 33 4 237 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 2.36e-32 121 33 4 234 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q04942 4.17e-32 120 31 2 229 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q07783 5.06e-32 120 33 7 247 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P50351 9.09e-32 119 33 5 246 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P13792 1.53e-31 119 33 2 229 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q44929 2.35e-31 118 31 2 230 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P44895 2.58e-31 117 32 3 225 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q82EB1 1.04e-30 116 30 4 234 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A0QTK2 2.13e-30 115 31 2 227 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0R3I8 4.65e-30 114 30 4 227 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P28257 7.05e-30 115 32 3 229 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q9ZEP4 9.69e-30 114 30 4 233 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O32192 1.25e-29 113 32 6 232 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P9WGM7 1.33e-29 113 31 2 227 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 1.33e-29 113 31 2 227 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 1.33e-29 113 31 2 227 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q93CB8 1.51e-29 113 31 2 227 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P08368 3.81e-29 112 31 3 235 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
O34903 7.81e-29 111 33 5 236 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q9CCJ2 3.08e-28 109 30 2 226 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q1B3X8 3.5e-28 109 30 4 227 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 3.5e-28 109 30 4 227 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 3.5e-28 109 30 4 227 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
A0A0H3GGB5 4.17e-28 109 32 4 231 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q9I0I1 4.54e-28 109 30 4 230 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52990 7.15e-28 108 32 6 237 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
L7N689 1.16e-27 109 33 4 226 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1TEL7 1.65e-27 108 30 5 228 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P45189 2.65e-27 107 30 6 239 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1KHB7 1.65e-26 105 29 4 227 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.65e-26 105 29 4 227 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0DMK7 1.93e-26 105 30 3 226 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 1.93e-26 105 30 3 226 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P0AE90 3.05e-26 104 32 2 225 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 3.05e-26 104 32 2 225 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 3.05e-26 104 32 2 225 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P9WGM9 3.14e-26 104 29 4 227 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 3.14e-26 104 29 4 227 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 3.14e-26 104 29 4 227 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P21866 3.32e-26 104 31 2 229 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q44006 3.39e-26 104 29 4 229 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5HLN2 3.42e-26 104 29 4 228 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0C001 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 5.93e-26 103 30 3 226 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 5.93e-26 103 30 3 226 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P23836 6.17e-26 103 30 4 228 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q8CN92 6.52e-26 103 29 4 228 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A0PWB4 6.66e-26 103 29 4 227 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q83RR0 7.23e-26 103 30 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 7.23e-26 103 30 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P9WGN1 7.34e-26 103 29 3 227 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 7.34e-26 103 29 3 227 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q742C1 7.52e-26 103 29 4 227 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 7.52e-26 103 29 4 227 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P76340 1.11e-25 103 30 3 229 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q9HV32 2.64e-25 102 29 4 226 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8X738 2.65e-25 102 29 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q99U73 2.99e-25 101 29 4 227 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q9AE24 3.85e-25 102 31 6 228 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q47744 7.82e-25 100 32 4 229 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
P54443 1.14e-24 100 31 4 229 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q8Z7H2 1.17e-24 100 29 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q55890 1.39e-24 100 29 3 231 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0DM78 3.47e-24 99 29 4 228 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 3.47e-24 99 29 4 228 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 3.47e-24 99 29 4 228 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 3.47e-24 99 29 4 228 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 3.47e-24 99 29 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9CD68 3.48e-24 99 28 5 228 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q2YZ24 4.11e-24 99 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A039 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 5.63e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L481 6.25e-24 98 28 6 230 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
Q8CQ37 6.45e-24 98 28 5 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 6.45e-24 98 28 5 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55933 6.91e-24 98 29 5 238 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6QJK3 7.72e-24 98 27 3 227 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 7.72e-24 98 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q49VK3 9.63e-24 98 28 5 232 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GE73 1.58e-23 97 27 3 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q01473 1.92e-23 101 32 5 232 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 7.68e-06 50 25 1 123 3 rcaC Protein RcaC Microchaete diplosiphon
Q49ZT8 2.12e-23 97 30 6 227 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O31432 2.16e-23 97 29 8 237 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q57QC3 2.45e-23 97 29 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
P42421 3.26e-23 96 27 3 227 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q7D9K0 7.04e-23 96 30 5 236 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 7.04e-23 96 30 5 236 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9I4F9 7.86e-23 95 29 5 229 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47456 1.67e-22 94 29 4 227 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
O06978 2.99e-22 94 29 4 233 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q4L6C6 6.12e-22 93 29 5 227 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P9WGM1 7.22e-22 93 31 4 206 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 7.22e-22 93 31 4 206 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 7.22e-22 93 31 4 206 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0ACZ8 9.11e-22 92 29 4 226 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 9.11e-22 92 29 4 226 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 9.11e-22 92 29 4 226 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q31S42 1.06e-21 93 29 3 230 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L8L9 1.69e-21 92 28 3 225 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q50136 3.99e-21 91 30 4 206 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
A8Z181 4.51e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 4.51e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 4.51e-21 90 27 6 230 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 4.51e-21 90 27 6 230 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 4.51e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q2YSS2 5e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1L2 5.49e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 5.49e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 5.49e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 5.49e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 5.49e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 5.49e-21 90 27 6 230 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q932F1 5.91e-21 90 27 6 230 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9K621 6.8e-21 90 26 3 225 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6GJ11 7.13e-21 90 27 5 229 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
P0A4I0 9.45e-21 90 31 4 227 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 9.45e-21 90 31 4 227 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q49XM7 1.96e-20 89 28 5 228 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9ZHD3 1.12e-19 87 30 5 228 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P0A4I2 1.17e-19 87 29 4 229 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 1.17e-19 87 29 4 229 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P52108 1.62e-19 87 29 4 233 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
P66795 3.51e-19 85 29 5 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 3.51e-19 85 29 5 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q02540 3.93e-19 85 27 5 227 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q5HPC3 6.96e-19 85 29 5 227 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q04803 1.25e-18 85 29 3 230 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6WZ81 1.35e-18 84 25 4 226 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P52076 1.41e-18 84 28 4 226 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q8CP82 1.61e-18 84 28 3 226 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P45337 1.93e-18 84 26 4 226 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34951 2.08e-18 84 24 4 225 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q8FZ93 4.36e-18 83 25 4 226 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 4.36e-18 83 25 4 226 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 4.36e-18 83 25 4 226 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 4.36e-18 83 25 4 226 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 4.36e-18 83 25 4 226 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 4.36e-18 83 25 4 226 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 4.36e-18 83 25 4 226 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 4.36e-18 83 25 4 226 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
B8H358 7.1e-18 82 26 4 226 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 7.1e-18 82 26 4 226 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P30843 7.55e-18 82 29 4 233 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q8XBS3 9.74e-18 82 28 4 226 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q9KM23 5.7e-17 80 29 5 226 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2FWH6 7.78e-17 79 27 6 229 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8DN02 3.94e-16 77 24 4 229 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 3.94e-16 77 24 4 229 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
O69730 5.82e-16 77 27 4 230 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A4H8 8.39e-16 77 26 6 226 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 8.39e-16 77 26 6 226 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O24973 8.98e-16 77 26 2 171 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
P72781 9.23e-16 77 34 3 138 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q70FH0 1.95e-15 75 28 5 226 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P0CL17 1.06e-14 73 27 6 228 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.06e-14 73 27 6 228 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P36556 2.44e-14 72 28 6 231 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33112 1.08e-13 71 30 4 184 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q07597 1.66e-13 70 23 3 235 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
P48359 1.8e-13 70 30 2 150 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q1XDE4 1.74e-12 67 30 1 118 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
T2KMF4 1.76e-11 67 33 2 122 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P43501 2.79e-11 62 33 1 108 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0R4K1 9.33e-11 60 33 2 105 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q06065 9.8e-11 64 26 6 212 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q8EQQ3 2.44e-10 62 29 4 124 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P24072 9.07e-10 58 31 4 122 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q8KIY1 9.82e-10 61 31 3 126 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
O25918 1.05e-09 60 23 5 234 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
E0X9C7 1.21e-09 61 30 3 126 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 1.67e-09 61 30 3 126 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B8GZM2 2.01e-09 60 29 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 2.01e-09 60 29 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q56312 3.43e-09 56 31 3 118 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8GP20 3.62e-09 58 23 6 229 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P51586 4.88e-09 56 33 1 108 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q1RJS1 4.95e-09 59 26 4 198 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q04848 5.1e-09 59 28 3 138 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q4UU85 6.46e-09 58 30 2 119 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P40138 6.57e-09 58 30 2 121 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
P52942 6.98e-09 55 31 3 118 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
P18769 7.96e-09 58 32 1 102 1 frzE Gliding motility regulatory protein Myxococcus xanthus
P26487 9.22e-09 57 24 3 166 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6K9T0 1.13e-08 55 26 2 112 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 1.13e-08 55 26 2 112 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q9HWA4 1.96e-08 57 33 2 110 1 pprB Two-component response regulator PprB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1W0A5 2.93e-08 54 28 3 118 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 2.93e-08 54 28 3 118 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 2.93e-08 54 28 3 118 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8E217 3.03e-08 56 36 3 105 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 3.03e-08 56 36 3 105 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
P9WGM3 3.35e-08 55 32 1 107 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 3.35e-08 55 32 1 107 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q88RJ6 3.86e-08 56 29 1 108 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P23747 4.35e-08 56 29 1 115 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AQ2 6.25e-08 56 29 1 108 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0AEV3 8.2e-08 55 33 1 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 8.2e-08 55 33 1 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 8.2e-08 55 33 1 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P71403 8.32e-08 52 30 3 111 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
O05251 8.44e-08 54 34 3 104 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q9HV27 8.52e-08 55 33 2 100 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23221 1.12e-07 53 25 1 108 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9KM66 1.22e-07 55 33 1 103 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O25153 1.5e-07 55 28 3 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
P46384 2.3e-07 52 25 1 108 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06628 2.41e-07 51 28 3 112 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
Q9ZM64 2.58e-07 51 30 3 111 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P13632 2.59e-07 54 28 1 114 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P15940 2.64e-07 53 29 1 106 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q07084 2.76e-07 54 25 1 131 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8DVB7 4.97e-07 52 33 3 106 3 lytR Sensory transduction protein LytR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9KSB1 5.17e-07 53 31 1 85 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4UL27 5.55e-07 53 25 4 198 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P45709 5.91e-07 50 30 2 103 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
P96126 6.47e-07 50 28 4 121 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
P10577 6.72e-07 53 27 1 111 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q9WY30 7.5e-07 52 30 3 115 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q05943 7.82e-07 52 27 3 138 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P31802 7.87e-07 51 32 4 118 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P10576 8.6e-07 52 29 2 119 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P0DMC5 9.98e-07 52 31 1 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q9FAD7 1.05e-06 50 29 2 110 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q1IRH0 1.11e-06 52 35 4 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
P30855 1.19e-06 52 34 1 101 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P58662 1.19e-06 52 31 1 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 1.23e-06 52 31 1 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q1D359 1.3e-06 52 29 1 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
Q92HC2 1.36e-06 52 24 4 198 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P72253 1.37e-06 52 32 4 112 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P51343 1.5e-06 50 29 1 119 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P0DOA0 1.64e-06 52 26 4 125 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P58402 1.79e-06 52 34 1 101 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P62640 1.97e-06 51 27 1 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9HU19 2.03e-06 51 26 2 130 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q68WH4 2.56e-06 51 24 4 198 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P0DMC6 2.72e-06 51 31 1 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P94514 2.82e-06 50 29 3 104 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
Q9AAK0 3.06e-06 50 30 4 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7CQM8 3.42e-06 49 25 3 135 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZCY9 3.67e-06 50 25 4 198 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q82Z76 3.76e-06 50 32 3 110 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
Q04849 5.6e-06 50 33 2 110 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P0AE41 6.78e-06 49 27 4 110 3 ypdB Transcriptional regulatory protein YpdB Shigella flexneri
P0AE39 6.78e-06 49 27 4 110 1 ypdB Transcriptional regulatory protein YpdB Escherichia coli (strain K12)
P0AE40 6.78e-06 49 27 4 110 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O157:H7
Q54YZ9 7.02e-06 50 28 1 110 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q8FFE0 7.08e-06 49 27 4 110 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q86AT9 7.19e-06 50 28 3 115 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P55701 8.36e-06 48 24 4 182 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9M9B9 9.51e-06 49 27 3 103 2 ARR19 Putative two-component response regulator ARR19 Arabidopsis thaliana
P45671 9.69e-06 49 23 2 124 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q7XQA6 1.06e-05 47 26 3 115 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
P0AFB8 1.07e-05 49 24 3 147 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.07e-05 49 24 3 147 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
A7N6S2 1.14e-05 49 27 3 119 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P48027 1.17e-05 49 26 1 116 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
A2XYV5 1.2e-05 47 26 3 115 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
P37740 1.27e-05 48 31 2 102 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q9KQD5 1.44e-05 46 27 2 120 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.44e-05 46 27 2 120 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
O14002 1.5e-05 49 25 3 128 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8NYJ9 1.62e-05 48 29 4 134 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 1.62e-05 48 29 4 134 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 1.62e-05 48 29 4 134 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2G1E1 1.62e-05 48 29 4 134 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 1.62e-05 48 29 4 134 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
Q8D0P1 1.66e-05 46 27 2 110 3 cheY Chemotaxis protein CheY Yersinia pestis
Q2SFK0 1.74e-05 48 30 2 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P26275 1.79e-05 48 30 4 111 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54SP4 2.27e-05 48 28 2 119 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q3LWR6 2.32e-05 47 26 2 112 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 2.32e-05 47 26 2 112 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 2.32e-05 47 26 2 112 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9F8D7 2.41e-05 48 25 1 116 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P0A2D5 2.58e-05 46 26 2 110 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 2.58e-05 46 26 2 110 3 cheY Chemotaxis protein CheY Salmonella typhi
Q2RX18 2.64e-05 48 31 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q53228 2.65e-05 47 28 1 107 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q167K9 2.72e-05 48 28 5 125 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q52883 3.16e-05 47 31 4 110 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
P0AE69 3.57e-05 45 27 2 110 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 3.57e-05 45 27 2 110 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 3.57e-05 45 27 2 110 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q2FQU2 3.67e-05 47 32 1 82 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q7A7X9 3.72e-05 47 29 4 134 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain N315)
Q99X00 3.72e-05 47 29 4 134 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P38889 4.02e-05 47 29 1 102 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q689G6 4.06e-05 47 27 3 117 2 PRR95 Two-component response regulator-like PRR95 Oryza sativa subsp. japonica
P0AFU5 4.07e-05 47 29 1 103 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 4.07e-05 47 29 1 103 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q6GK93 4.16e-05 47 28 4 132 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
Q2YV56 4.16e-05 47 28 4 132 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P52940 4.27e-05 47 24 7 187 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q2HWG1 4.32e-05 45 28 3 114 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
Q8FW53 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 4.8e-05 45 28 2 110 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 4.8e-05 45 28 2 110 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
Q2KCH7 4.83e-05 45 25 2 105 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q93P00 4.93e-05 45 26 2 110 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q10WZ6 5.27e-05 47 28 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q8FGP6 5.65e-05 45 27 2 110 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P21649 5.66e-05 46 27 4 104 1 mrkE Protein MrkE Klebsiella pneumoniae
Q51455 7.02e-05 44 25 2 120 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P96686 7.7e-05 45 26 2 122 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q8CQE3 8.04e-05 46 29 3 122 3 SE_0165 Uncharacterized response regulatory protein SE_0165 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P62644 8.6e-05 46 30 6 139 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P09432 8.65e-05 46 27 1 114 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P39486 9.47e-05 45 27 2 102 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P0AED6 9.65e-05 45 27 3 118 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 9.65e-05 45 27 3 118 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 0.000101 45 27 3 118 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 0.000101 45 27 3 118 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P41789 0.000103 46 22 2 136 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A6X580 0.000108 44 28 2 107 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P13800 0.000116 45 30 2 113 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q5HKE0 0.000117 45 30 3 122 3 SERP2406 Uncharacterized response regulatory protein SERP2406 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5A599 0.000119 46 25 2 116 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9UYF3 0.000124 46 29 2 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q1QI44 0.000133 45 26 5 142 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9I4N3 0.000145 45 33 6 130 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62647 0.00015 45 27 2 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q13SY2 0.000166 45 29 3 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
Q54YH4 0.000173 46 23 1 122 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q2RRX2 0.000192 45 34 4 103 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q12YX1 0.00021 45 23 7 180 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q4L8Q6 0.000215 44 29 3 116 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q9I6V9 0.000245 45 30 4 104 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I4 0.000247 44 25 3 124 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 0.000247 44 25 3 124 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P58253 0.000255 44 27 3 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9LYP5 0.000264 45 26 3 122 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
P96602 0.000265 44 29 3 105 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q2ILG8 0.000266 45 24 7 173 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q5SML4 0.000273 45 24 3 126 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 0.000273 45 24 3 126 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
Q3SVA1 0.000288 45 27 5 140 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8D5Z6 0.000289 45 29 1 111 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q5A4X5 0.000293 45 27 2 116 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q7MD16 0.000295 45 29 1 111 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q551X9 0.000339 45 26 2 116 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q8NYH3 0.000344 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MW2)
Q6GCL1 0.000344 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MSSA476)
Q6GK51 0.000361 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MRSA252)
P60610 0.000361 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain N315)
P60609 0.000361 44 28 3 107 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJB5 0.000361 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain COL)
P60611 0.000361 44 28 3 107 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK09 0.000361 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain USA300)
Q8VL08 0.000373 44 29 4 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Azospirillum brasilense
Q2YV67 0.000389 44 28 3 107 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain bovine RF122 / ET3-1)
O58192 0.000391 44 31 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O83639 0.000417 44 26 4 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
P24086 0.000484 42 28 3 104 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 0.000484 42 28 3 104 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q0HIF6 0.00052 44 27 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
P03029 0.000527 44 24 1 107 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
O25408 0.000548 43 31 3 107 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q8KR08 0.000587 43 25 1 110 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P52928 0.000594 43 25 3 124 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q0HVI0 0.000597 43 27 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q0PVB3 0.000633 43 21 2 112 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
P24908 0.000649 43 30 2 106 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7CQM5 0.000685 43 26 3 106 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q132U2 0.000686 43 29 5 131 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain BisB5)
Q7WZY4 0.000694 43 31 4 119 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
P62637 0.000708 43 32 4 112 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9APD9 0.000756 43 23 1 117 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
O82868 0.001 42 25 1 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q5HLK6 0.001 42 27 3 116 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q86CZ2 0.001 43 25 1 115 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_06540
Feature type CDS
Gene arcA
Product two-component system response regulator ArcA
Location 148911 - 149627 (strand: 1)
Length 717 (nucleotides) / 238 (amino acids)

Contig

Accession contig_6
Length 178871 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1142
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07773 two-component system, OmpR family, aerobic respiration control protein ArcA Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MQTPHILIVEDEIVTRNTLKSIFEAEGYVVHEATDGAEMHNVLSDHDINLVIMDINLPGKNGLLLARELREQANVALMFLTGRDNEVDKILGLEIGADDYITKPFNPRELTIRARNLLSRTMNLAGGSEERRSVESYKFNGWELDINSRSLIGPTGEQYKLPRSEFRAMLHFCENPGKIQTRAELLKKMTGRELKPHDRTVDVTIRRIRKHFESTPDTPEIIATIHGEGYRFCGDLEE

Flanking regions ( +/- flanking 50bp)

CGGACAGATAATCAGATTTCTTATTATTCTAAGTAATTTAGGTAGCGACTATGCAAACCCCGCATATTTTAATTGTTGAAGATGAGATCGTCACCCGTAACACCCTGAAAAGTATTTTCGAAGCAGAGGGTTACGTGGTACATGAAGCCACTGACGGTGCAGAGATGCACAATGTGCTGTCAGACCATGATATCAATTTGGTTATCATGGACATCAACCTCCCGGGAAAAAATGGTCTGTTGCTGGCGCGTGAGCTCCGCGAACAGGCAAACGTGGCACTGATGTTCTTAACCGGCCGTGATAATGAAGTGGATAAAATCCTCGGTCTGGAAATCGGTGCTGATGACTACATCACCAAGCCGTTTAACCCGCGTGAACTGACTATCCGCGCACGCAACTTACTGTCACGGACCATGAATCTGGCCGGTGGCAGCGAAGAGCGCCGCAGTGTGGAAAGTTACAAGTTCAACGGCTGGGAACTGGATATCAACAGCCGCTCATTAATCGGACCAACCGGCGAGCAGTACAAGCTGCCGCGCAGTGAGTTCCGTGCAATGCTGCACTTCTGTGAGAATCCGGGCAAGATTCAGACCCGTGCTGAACTGCTGAAGAAAATGACCGGCCGTGAACTGAAACCGCATGACCGTACAGTGGATGTCACCATCCGCCGTATCCGCAAGCATTTCGAGTCCACACCGGATACCCCGGAAATCATCGCCACCATTCACGGCGAAGGTTACCGGTTCTGCGGCGATCTCGAAGAGTAATCTTCCGCTGCGGTAACATATATACGAAATCCCCGGTGATGCTGAGCACC